CN113186209B - Atractylodes lancea squalene synthase gene AlSQS2 and coded product and application thereof - Google Patents
Atractylodes lancea squalene synthase gene AlSQS2 and coded product and application thereof Download PDFInfo
- Publication number
- CN113186209B CN113186209B CN202110564378.4A CN202110564378A CN113186209B CN 113186209 B CN113186209 B CN 113186209B CN 202110564378 A CN202110564378 A CN 202110564378A CN 113186209 B CN113186209 B CN 113186209B
- Authority
- CN
- China
- Prior art keywords
- alsqs2
- ala
- squalene synthase
- synthase gene
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P33/00—Preparation of steroids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P5/00—Preparation of hydrocarbons or halogenated hydrocarbons
- C12P5/02—Preparation of hydrocarbons or halogenated hydrocarbons acyclic
- C12P5/026—Unsaturated compounds, i.e. alkenes, alkynes or allenes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
- C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
- C12Y205/01021—Squalene synthase (2.5.1.21), i.e. farnesyl-disphosphate farnesyltransferase
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a gene engineering body, in particular to a atractylis lancea squalene synthase gene AlSQS2, and a coded product and application thereof; the nucleotide sequence of the gene is shown as SEQ ID NO.1, the amino acid sequence of the encoded product is shown as SEQ ID NO.2, the atractylis lancea squalene synthase is obtained by cloning, amplifying and expressing atractylis lancea squalene synthase gene AlSQS2 in engineering bacteria, and the atractylis lancea squalene synthase gene AlSQS2 solves the problem that the biosynthetic genes related to the synthesis pathway of triterpenes in atractylis in the existing research are not separated and identified.
Description
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a atractylis lancea squalene synthase gene AlSQS2, and a coded product and application thereof.
Background
Rhizoma atractylodis is listed as the superior product by being recorded in Shen nong Ben Cao Jing by 'shu', is pungent and bitter in taste and warm in nature, and has the effects of eliminating dampness, strengthening spleen, dispelling wind, removing cold and improving eyesight. The 2020 edition "Chinese pharmacopoeia" records that rhizoma Atractylodis is derived from dried rhizome of Atractylodes lancea (Thunb.) DC. or Atractylodes chinensis (DC.) Koidz. of Compositae. Hitherto, chemical components in the rhizoma atractylodis are mainly sesquiterpenes, eneynes, triterpenes, steroids, aromatic glycosides and the like; pharmacological activity research shows that the components have the effects of protecting liver, resisting bacteria, viruses and tumors, centrally inhibiting, promoting gastrointestinal peristalsis, resisting ulcer, inhibiting gastric acid secretion and the like.
Atractylodes lancea rhizome mainly contains volatile oil components, which are composed of a series of sesquiterpenes, polyvinyl alkynes, triterpenes, organic acids and a small amount of phenols. The triterpenes in the atractylis lancea comprise beta-sitosterol, stigmasterol and other components, have the activity of reducing cholesterol, and are widely applied to the research of rheumatic diseases. Sterols are triterpenoid components, and one of the key enzymes in the biosynthetic pathway is squalene synthase. However, biosynthetic genes for the triterpene synthesis pathway in Atractylodes lancea have not been isolated and characterized.
In view of the above-mentioned drawbacks, the inventors of the present invention have finally obtained the present invention through a long period of research and practice.
Disclosure of Invention
The invention aims to solve the problem that biosynthetic genes related to a triterpene synthesis pathway in atractylis lancea are not separated and identified in the existing research, and provides an atractylis lancea squalene synthase gene AlSQS2, and a coded product and application thereof.
In order to realize the purpose, the invention discloses an atractylis lancea squalene synthase gene AlSQS2, the nucleotide sequence of which is shown in SEQ ID NO. 1.
The similarity between the nucleotide sequence of the Atractylodes lancea squalene synthase gene AlSQS2 and the nucleotide sequence shown in SEQ ID NO.1 is more than 50%.
The invention also discloses a product coded by the atractylis lancea squalene synthase gene AlSQS2, and the amino acid sequence of the coded product is shown as SEQ ID NO. 2.
The amino acid sequence EQID NO.2 of the coded product has an amino acid sequence similarity of more than 50%.
The invention also discloses a specific primer of the atractylis lancea squalene synthase gene AlSQS2, which comprises an upstream primer shown as SEQ ID NO.3 and a downstream primer shown as SEQ ID NO. 4.
The invention also discloses a recombinant expression vector containing the atractylis lancea squalene synthase gene AlSQS2, wherein the expression vector is pGEX-4T-1.
The invention also discloses application of the atractylis lancea squalene synthase gene AlSQS2 in preparation of triterpenes or sterol compounds, which comprises transferring atractylis lancea squalene synthase gene AlSQS2 into cells, expressing atractylis squalene synthase in host cells, and promoting synthesis of triterpenes or sterol compounds by atractylis squalene synthase.
The sterol compound is beta-sitosterol.
Compared with the prior art, the invention has the beneficial effects that: the atractylis lancea squalene synthase (AlSQS2) gene provided by the invention is prepared by cloning atractylis lancea plant species for the first time. Atractylodes lancea squalene synthase (AlSQS2) is a key regulatory gene of the synthesis route of Atractylodes lancea sterol and triterpene, can be used for regulating the beta-sitosterol content of Atractylodes lancea, and can be applied to a pathway for preparing squalene by taking farnesyl pyrophosphate (FPP) as a substrate. The gene provided by the invention can improve the content of the beta-sitosterol of the medicinal component of the atractylis lancea through a genetic engineering technology, can be used for generating large amount of atractylis lancea, and provides a research direction for preparing triterpenoids of the atractylis lancea.
Drawings
FIG. 1 is an agarose gel electrophoresis of Atractylodes lancea terpene synthase gene AlSQS 2;
FIGS. 2 to 5 show the prediction analysis of the structural functional domain of Atractylodes lancea terpene synthase gene AlSQS 2;
FIG. 6 is a phylogenetic tree of Atractylodes lancea terpene synthase gene AlSQS 2;
FIG. 7 shows the results of SDS-polyacrylamide gel electrophoresis of AlSQS2 protein;
FIG. 8 is an ion flow diagram of a squalene (squalene) standard;
FIG. 9 is a standard quality spectrum of squalene (squalene);
FIG. 10 is a total ion flow diagram of a product of farnesyl pyrophosphate (FPP) catalyzed by AlSQS2 protein;
FIG. 11 is a mass spectrum of the peak retention time 33.888min for AlSQS2 catalyzed FPP;
FIG. 12 is an ion flow diagram of an unloaded pGEX-4T-1 standard;
FIG. 13 is a mass spectrum of the peak at retention time 33.888min for unloaded pGEX-4T-1.
Detailed Description
The above and further features and advantages of the present invention are described in more detail below with reference to the accompanying drawings.
The technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.
Reverse transcription kit PrimeScriptTMII 1st Strand cDNA Synthesis Kit purchased from Takara Bio; the nontoxic 4S Green Plus nucleic acid dye is purchased from Shanghai biological engineering Co., Ltd; the Gel cutting recovery Kit EasyPure Quick Gel Extraction Kit, the T vector pEASY-Blunt Zero Cloning Kit, the high fidelity enzyme TransStartFastPfu Fly DNA Polymerase (containing 2.5mM dNTPs), and E.coli Transetta (DE3) are purchased from Beijing Quanyujin biotechnology Limited; restriction enzymes such as BamH I were purchased from Beijing GmbH, N.Y. (NEB) Biotechnology; the primer is synthesized by Shanghai biological engineering Co., Ltd; other reagents are imported or domestic analytical pure reagents.
Cloning of Atractylodes lancea squalene synthase AlSQS2 gene
Cloning of AlSQS2 utilized forward primers: an upstream primer: AlSQS 2-F: 5'-ATGGGGAGTTTAAAGGCAGTGTTGA-3', respectively; a downstream primer: AlSQS 2-R: 5'-TTACAAACTAACTTTCATTTTATTT-3' are provided. PCR amplification is carried out by taking the full-length sequence of the atractylis lancea squalene synthase AlSQS2 coding gene as a template. The amplification system was as follows: 5 Xbuffer 10. mu.L, dNTP (2.5 mmol. multidot.L-1) mu.L of each of primers primer-F and primer-R, 1. mu.L of TransStartFastPpfu Fly DNA Polymerase, 1. mu.L of template, and the balance made up with sterile double distilled water. Reaction conditions are as follows: pre-denaturation at 95 deg.C for 2min, denaturation at 95 deg.C for 20s, annealing at 56 deg.C for 20s, extension at 72 deg.C for 30s, 40 cycles, extension at 72 deg.C for 5min, and storing at 4 deg.C. Thus, a clone of atractylis lancea squalene synthase AlSQS2 gene was obtained.
Bioinformatic analysis of AlSQS2 Gene
The Atractylodes lancea squalene synthase gene full-length cDNA obtained by the invention has the length of an Open Reading Frame (ORF) of the AlSQS2 gene of 1257bp, and the detailed sequence is shown as SEQ ID NO.1 in a sequence table. The sequence of AlSQS2 gene was subjected to nucleotide homology search in the Non-redundant GenBank + EMBL + DDBJ + PDB and Non-redundant GenBank CDS translation + PDB + Swissprot + Superdate + PIR databases using BLAST program in NCBI database, and the gene has higher homology with SQS in other species at amino acid level and has typical Isoredundant _ Biosyn _ C1 supermary domain as shown in FIG. 2; the secondary structure of the ALSQS2 protein is composed of an alpha helix, an extended chain and a random coil, as shown in FIG. 3; ALSQS2 has a transmembrane domain at 387-406 as shown in FIG. 4; the tertiary structure of the protein is predicted by using a Swiss Model, as shown in FIG. 5, the ALSQS2 protein Model 3weg.1.A has the score of 0.64, and the similarity of the protein sequence is 48.34%; the MEGA6 software is used to construct a Neighbor-join phylogenetic tree, as shown in FIG. 6, the Atractylodes lancea ALSQS2 sequence and the Artemisia annua sequence of Compositae are located at the same branch point, and the relationship is the highest.
Construction of prokaryotic expression vector of AlSQS2 gene
A specific upstream primer and a specific downstream primer (shown in Table 1) are designed by taking AlSQS2cDNA as a template, PCR amplification reaction is carried out, and a underlined part in the primers is an enzyme cutting site.
TABLE 1 PCR amplification primer sequences
| Primer name | Sequence name | Base sequence (5 '→ 3') |
| AlSQS2-F | SEQ ID NO.3 | CGGATCTGGTTCCGCGTGGAATGGGGAGTTTAAAGGCAGTGT |
| AlSQS2-R | SEQ ID NO.4 | CGACCCGGGAATTCCGGGGATTACAAACTAACTTTCATTTTA |
And carrying out PCR amplification by using the recombinant plasmid as a template. And detecting the amplified product by 1% agarose gel electrophoresis, and cutting and recovering the product. And carrying out BamH I enzyme digestion treatment on the product after the gel cutting recovery and an expression vector pGEX-4T-1 plasmid respectively, and carrying out gel cutting recovery. Connecting the target fragment after gel cutting recovery with an expression vector pGEX-4T-1 at 50 ℃ for 30min by using a seamless splicing kit, converting the connection product into escherichia coli Trans1-T1 competent cells, and selecting a single clone to perform PCR positive test of bacterial liquid, sequencing and plasmid extraction.
Fourth, induced expression of engineering bacteria
E.coli transetta (DE3) competent cells were transformed with the target plasmid pGEX-AlSQS2, and positive strains E.coli transetta (DE3) -AlSQS containing pGEX-AlSQS2 plasmids were culture-screened. Adding the transformed expression bacteria liquid into LB culture liquid containing Amp resistance according to the proportion of 1:100, carrying out shaking culture at 37 ℃ and 200rpm until A600Under the same conditions, pGEX-4T-1 was unloaded as a blank by adding IPTG (0.4-0.6 mM final concentration) and inducing overnight at 16 ℃. Centrifuging 1mL of bacterial liquid to obtain a precipitate as a whole bacterium, centrifuging the rest bacterial liquid to remove supernatant to obtain thalli, adding 3-5mL of Buffer A, carrying out heavy suspension, adding 5 muL of 1M DTT to enable the final concentration to be 1mM, transferring to a 15mL centrifuge tube, placing in an ultrasonicator, carrying out ultrasonication for 5min (5s interval), carrying out 25% ultrasonic efficiency, inserting the centrifuge tube into a beaker filled with ice, and operating on the ice. The supernatant and the precipitate of the AlSQS2 gene were obtained after the ultrasonication lysate was centrifuged at 4 ℃ for 15min, and 12% SDS-PAGE was performed. SDS-polyacrylamide gel electrophoresis results show that at a molecular weight of about 68kDa, a gel appearsA distinct specific protein expression band was consistent with the theoretical value (see FIG. 7). Wherein lane 1 is Protein rubber Marker l, lane 2 is E.coli transetta (DE3) whole strain containing pGEX-4T-1 empty vector; lane 3 is uninduced AlSQS2 whole strain; lane 4 is induced AlSQS2 whole strain; lane 5 is the induced supernatant of AlSQS 2.
Fifth, in vitro enzyme function verification
1. Preparation of purified protein: supernatant AlSQS2 was obtained in example 5, and 1mL of the supernatant was pipetted and mixed with 500. mu.L of washed GST Resin in a 2mL centrifuge tube; putting into an ice box, and shaking on a fixed-orbit oscillator at 120rpm for more than 1 h; centrifuging at 4 deg.C for 5min at 500 Xg, and removing supernatant; adding 1mL Buffer A for heavy suspension, centrifuging at 4 ℃ for 5min and discarding the supernatant, and repeating for three times; adding 200 μ L Buffer B for elution, centrifuging at 4 deg.C and 500 Xg for 5min, and storing in a refrigerator at-80 deg.C.
2. Functional verification of AlSQS2 enzyme: FPP is taken as a reaction substrate to perform in-vitro enzyme function, and the reaction system is as follows: 100mM Tris-HCl (pH 7.5), 10mM FPP, 10mM MgCl21mM DTT, 2% Glycine, 3mM NADPH-Na4 and 475. mu.L enzyme solution. Mixing, and heating in water bath at 32 deg.C for 6 hr. Directly adding 1 volume of n-hexane, vortex-suspending for 3 times (1mL × 3 times), and mixing extractive solutions. Vacuum concentrating to dry, adding 60 μ L n-hexane for redissolving, sampling 1 μ L, and using squalene as standard substance. GC-MS detection reaction GC-M S analysis conditions were: 3min at 120 ℃, 3 to 180 ℃ at 15 ℃/min, 25 to 260 ℃ at 25 ℃/min, and performing qualitative analysis on the product, wherein the result is shown in fig. 8-13, the result shows that the retention time of the squalene standard product in GC is 32.889min, a characteristic peak exists in the sample at the retention time of 32.888min, a corresponding characteristic peak is not detected in the empty carrier control sample, and then the characteristic peak in the sample product is subjected to GC-MS analysis to determine the squalene (squalene) as the squalene, and the squalene/z 69[ CH/z 69 ] (CH/min)3(CH3)＝CHCH2-]+、410[M]+Plasma peaks were identified, and pGEX-AlSQS2 was thus identified as having activity in catalyzing squalene synthesis from FPP.
The foregoing is merely a preferred embodiment of the invention, which is intended to be illustrative and not limiting. It will be understood by those skilled in the art that various changes, modifications and equivalents may be made therein without departing from the spirit and scope of the invention as defined in the appended claims.
Sequence listing
<110> Anhui university of traditional Chinese medicine
<120> Atractylodes lancea squalene synthase gene AlSQS2, and coded product and application thereof
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1260
<212> DNA
<213> Atractylodeslancea(Thunb.) DC
<400> 1
atggggaggt taaaggatgt attacagcat cccgacgatt tttacccatt gttgaagctc 60
acgatggcgg ccaagcaggc cgagaaacag ataccgacgg agccacactg gggattctgt 120
tattcaatgc ttcataaggt ttctagaagc ttctctctcg ttatccaaca gcttggcaca 180
gagcttcgtg acgctgtatg catattttat ttggttcttc gagcccttga cactgttgag 240
gatgatacaa gcatagatac tatgattaag gtaccaattt tgatggactt tcatcgccat 300
atctatgatc ctgactggca tttcgcatgc ggtacaaagg aatacaaaat tctcatggat 360
cagttccatc atgtttctac tgcctttttg gagcttaatg aaagttatca ggaggcgatt 420
gaggatatta ccatgaaaat gggtgcagga atggcaaaat ttatatgcaa agaggttgag 480
acaattgatg actatgatga atattgccat tatgttgcgg gacttgttgg attaggattg 540
tcaaaactct ttcatgcctc gggtaaagaa gctttgtttt ctgattctat ctccaattca 600
atgggcttat ttctccagaa aacaaacatc attagagatt atcttgagga catcaacgaa 660
atacccaagt ctagaatgtt ttggcctcgc cagatatggg gtaaatatgt gaataaacta 720
gaggacttga aacgtgtaga gaactcagag aaggctgttc agtgcctaaa tgatatggtg 780
acaaacgctt taatacatat tgaagattgt ttaaagtata tgtccgactt acgtgatccg 840
gcaatcttca agttttgtgc tataccacaa atcatggcaa ttggaacact agctttatgc 900
tacaacaaca ttcaagtttt cagaggggta gtgaaattga gacgtggtct tactgcaaaa 960
ataattgatc ggactaaaac catggcggat gtgtatggtg ctttttatga tttttcctcg 1020
ttgcttaagt ccaaggttgc attgaaggat ccaaattccc atacaacaat cagcaggata 1080
gaagctgtcc aaaaaatttg caggaattcg ggcaccctcg acaaaaggag aacgtacata 1140
gctgacgatg atccaaaata cggtccagct ctgattgctt ttctaatcgt tatagtggca 1200
atttattacg catatctatc tgctaatcga cccaacaaaa tcagtgagct tattcagtaa 1260
<210> 2
<211> 419
<212> PRT
<213> Atractylodeslancea(Thunb.) DC
<400> 2
Met Gly Ala Leu Leu Ala Val Leu Gly His Pro Ala Ala Pro Thr Pro
1 5 10 15
Leu Leu Leu Leu Thr Met Ala Ala Leu Gly Ala Gly Leu Gly Ile Pro
20 25 30
Thr Gly Pro His Thr Gly Pro Cys Thr Ser Met Leu His Leu Val Ser
35 40 45
Ala Ser Pro Ser Leu Val Ile Gly Gly Leu Gly Thr Gly Leu Ala Ala
50 55 60
Ala Val Cys Ile Pro Thr Leu Val Leu Ala Ala Leu Ala Thr Val Gly
65 70 75 80
Ala Ala Thr Ser Ile Ala Thr Met Ile Leu Val Pro Ile Leu Met Ala
85 90 95
Pro His Ala His Ile Thr Ala Pro Ala Thr His Pro Ala Cys Gly Thr
100 105 110
Leu Gly Thr Leu Ile Leu Met Ala Gly Pro His His Val Ser Thr Ala
115 120 125
Pro Leu Gly Leu Ala Gly Ser Thr Gly Gly Ala Ile Gly Ala Ile Thr
130 135 140
Met Leu Met Gly Ala Gly Met Ala Leu Pro Ile Cys Leu Gly Val Gly
145 150 155 160
Thr Ile Ala Ala Thr Ala Gly Thr Cys His Thr Val Ala Gly Leu Val
165 170 175
Gly Leu Gly Leu Ser Leu Leu Pro His Ala Ser Gly Leu Gly Ala Leu
180 185 190
Pro Pro Ala Ser Ile Ser Ala Ser Met Gly Leu Pro Leu Gly Leu Thr
195 200 205
Ala Ile Ile Ala Ala Thr Leu Gly Ala Ile Ala Gly Thr Pro Leu Ser
210 215 220
Ala Met Pro Thr Pro Ala Gly Ile Thr Gly Leu Thr Val Ala Leu Leu
225 230 235 240
Gly Ala Leu Leu Ala Val Gly Ala Ser Gly Leu Ala Val Gly Cys Leu
245 250 255
Ala Ala Met Val Thr Ala Ala Leu Ile His Ile Gly Ala Cys Leu Gly
260 265 270
Thr Met Ser Ala Leu Ala Ala Pro Ala Ile Pro Leu Pro Cys Ala Ile
275 280 285
Pro Gly Ile Met Ala Ile Gly Thr Leu Ala Leu Cys Thr Ala Ala Ile
290 295 300
Gly Val Pro Ala Gly Val Val Leu Leu Ala Ala Gly Leu Thr Ala Leu
305 310 315 320
Ile Ile Ala Ala Thr Leu Thr Met Ala Ala Val Thr Gly Ala Pro Thr
325 330 335
Ala Pro Ser Ser Leu Leu Leu Ser Leu Val Ala Leu Leu Ala Pro Ala
340 345 350
Ser His Thr Thr Ile Ser Ala Ile Gly Ala Val Gly Leu Ile Cys Ala
355 360 365
Ala Ser Gly Thr Leu Ala Leu Ala Ala Thr Thr Ile Ala Ala Ala Ala
370 375 380
Pro Leu Thr Gly Pro Ala Leu Ile Ala Pro Leu Ile Val Ile Val Ala
385 390 395 400
Ile Thr Thr Ala Cys Leu Ser Ala Ala Ala Pro Ala Leu Ile Ser Gly
405 410 415
Leu Ile Gly
<210> 3
<211> 25
<212> DNA
<213> Atractylodeslancea(Thunb.) DC
<400> 3
atggggagtt taaaggcagt gttga 25
<210> 4
<211> 25
<212> DNA
<213> Atractylodeslancea(Thunb.) DC
<400> 4
ttacaaacta actttcattt tattt 25
Claims (8)
1.A Atractylodes lancea squalene synthase gene AlSQS2 is characterized in that the nucleotide sequence of the gene is shown in SEQ ID NO. 1.
2. The Atractylodes lancea squalene synthase gene AlSQS2 encoded product of claim 1, wherein the amino acid sequence of the encoded product is shown in SEQ ID NO. 2.
3. A specific primer of Atractylodes lancea squalene synthase gene AlSQS2 as claimed in claim 1, which comprises an upstream primer shown in SEQ ID NO.3 and a downstream primer shown in SEQ ID NO. 4.
4. A recombinant expression vector comprising the atractylis lancea squalene synthase gene AlSQS2 of claim 1.
5. The recombinant expression vector of claim 4, comprising atractylis lancea squalene synthase gene AlSQS2, wherein the expression vector is pGEX-4T-1.
6. Use of the atractylis lancea squalene synthase gene AlSQS2 according to claim 1 in the preparation of triterpenes or sterols.
7. The use of the Atractylodes lancea squalene synthase gene AlSQS2 in the preparation of triterpenes or sterols according to claim 6, which comprises transferring Atractylodes lancea squalene synthase gene AlSQS2 into cells, expressing Atractylodes lancea squalene synthase in host cells, and promoting the synthesis of triterpenes or sterols.
8. The use of the Atractylodes lancea squalene synthase gene AlSQS2 in the preparation of triterpenes or sterols according to claim 6, wherein the sterols is β -sitosterol.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110564378.4A CN113186209B (en) | 2021-05-24 | 2021-05-24 | Atractylodes lancea squalene synthase gene AlSQS2 and coded product and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110564378.4A CN113186209B (en) | 2021-05-24 | 2021-05-24 | Atractylodes lancea squalene synthase gene AlSQS2 and coded product and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113186209A CN113186209A (en) | 2021-07-30 |
| CN113186209B true CN113186209B (en) | 2022-04-19 |
Family
ID=76984891
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110564378.4A Active CN113186209B (en) | 2021-05-24 | 2021-05-24 | Atractylodes lancea squalene synthase gene AlSQS2 and coded product and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113186209B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114752587B (en) * | 2022-04-02 | 2023-09-08 | 安徽中医药大学 | Terpene synthase gene AlTPS1 for synthesizing elemene alcohol in rhizoma atractylodis lanceae, and coded product and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105647943A (en) * | 2016-03-14 | 2016-06-08 | 大连普瑞康生物技术有限公司 | Saussurea involucrata cell squalene synthase (SiSQS) gene as well as products coded by same and application thereof |
| CN112251427A (en) * | 2020-10-22 | 2021-01-22 | 中国农业科学院深圳农业基因组研究所 | Sesquiterpene synthase IlTPS1, coding nucleotide sequence and application thereof |
| CN113186210A (en) * | 2021-05-24 | 2021-07-30 | 安徽中医药大学 | Atractylodes lancea squalene synthase gene AlSQS1 and coded product and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040002105A1 (en) * | 2002-05-04 | 2004-01-01 | The Samuel Roberts Noble Foundation | Methods of identifying genes for the manipulation of triterpene saponins |
-
2021
- 2021-05-24 CN CN202110564378.4A patent/CN113186209B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105647943A (en) * | 2016-03-14 | 2016-06-08 | 大连普瑞康生物技术有限公司 | Saussurea involucrata cell squalene synthase (SiSQS) gene as well as products coded by same and application thereof |
| CN112251427A (en) * | 2020-10-22 | 2021-01-22 | 中国农业科学院深圳农业基因组研究所 | Sesquiterpene synthase IlTPS1, coding nucleotide sequence and application thereof |
| CN113186210A (en) * | 2021-05-24 | 2021-07-30 | 安徽中医药大学 | Atractylodes lancea squalene synthase gene AlSQS1 and coded product and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| 2个丹参鲨烯合酶基因的克隆和鉴定;马艺沔 等;《中草药》;20140531;第45卷(第9期);第1307-1312页 * |
| PREDICTED: Cynara cardunculus var. scolymus squalene synthase-like (LOC112525044), mRNA NCBI Reference Sequence: XM_025134985.1;GenBank;《GenBank》;20180516;第1-2页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113186209A (en) | 2021-07-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105647943B (en) | Saussurea involucrate cell squalene synthase gene SiSQS and coded product and application thereof | |
| CN109593745B (en) | Xylosidase mutant capable of converting notoginsenoside R1 into ginsenoside Rg1 | |
| CN113186209B (en) | Atractylodes lancea squalene synthase gene AlSQS2 and coded product and application thereof | |
| CN113186210A (en) | Atractylodes lancea squalene synthase gene AlSQS1 and coded product and application thereof | |
| JP2021535757A (en) | Microorganisms that synthesize baicalein and scutellarein, their production methods and their use | |
| US10519203B2 (en) | Gene for biosynthesis of core structure of ophiobolin | |
| CN114015676A (en) | Construction method of cellulase suitable for traditional Chinese medicine feed additive | |
| CN113308454B (en) | Atractylodes lancea sesquiterpene synthase gene Al beta-FS and coding product and application thereof | |
| CN105647995B (en) | A kind of method for extracting 2 ', 3 '-cyclic nucleoside monophosphates | |
| CN113088502B (en) | Glycosylated transferase gene of Panax ginseng and application thereof | |
| CN105154420B (en) | Red sesame Terpene synthase GL22395 encoding genes cDNA sequence and its application | |
| CN113832171B (en) | Platycodon grandiflorum geranylgeranyl pyrophosphate synthase gene PgGGPPS, and encoding product and application thereof | |
| CN103173475A (en) | Sphingomonas alginate lyase gene ZH0-III as well as prokaryotic expression vector and application thereof | |
| CN113215184B (en) | Platycodon grandiflorum squalene synthase gene PgSQS and coded product and application thereof | |
| CN102433347A (en) | Lupeol C28 oxidase gene and preparation method and application thereof | |
| CN112574981B (en) | Taraxasterol synthase, gene for coding taraxasterol synthase and preparation and application thereof | |
| CN110157720B (en) | Sesquiterpene cyclase gene peniA and method for synthesizing silphine through heterologous expression in yeast | |
| CN116790544A (en) | Glycosyltransferase PpUGT5 for biosynthesis of rhizoma paridis saponin | |
| CN112961869A (en) | Jasmonic acid amino acid synthetase JAR1 gene from red sage root and its coded protein and application | |
| CN116218883A (en) | Platycodon farnesyl pyrophosphate synthase gene PgFPPS, and coded product and application thereof | |
| CN107417784B (en) | Application of SjP40 protein of schistosoma japonicum | |
| CN103173476B (en) | Sphingomonas alginate lyase gene ZH0-II as well as prokaryotic expression vector and application thereof | |
| WO2017215174A1 (en) | Marine bacterial gene lfliz and use | |
| CN116004673B (en) | Saussurea involucrata syringin SiUGT72E gene and encoding product and application thereof | |
| CN114480451B (en) | Polygonum multiflorum chalcone synthase gene FmCHS and encoding product and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |