CN113174401A - Method and carrier for knocking-in exogenous gene into cotton genome mediated by gene editing - Google Patents
Method and carrier for knocking-in exogenous gene into cotton genome mediated by gene editing Download PDFInfo
- Publication number
- CN113174401A CN113174401A CN202110608540.8A CN202110608540A CN113174401A CN 113174401 A CN113174401 A CN 113174401A CN 202110608540 A CN202110608540 A CN 202110608540A CN 113174401 A CN113174401 A CN 113174401A
- Authority
- CN
- China
- Prior art keywords
- vector
- sequence
- gene
- beydv
- cas9
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
- A01H4/005—Methods for micropropagation; Vegetative plant propagation using cell or tissue culture techniques
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
- A01H4/008—Methods for regeneration to complete plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Developmental Biology & Embryology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Virology (AREA)
- Botany (AREA)
- Environmental Sciences (AREA)
- Mycology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to the technical field of genetic engineering, and discloses a method for knocking in exogenous genes mediated by gene editing into a cotton genome, which comprises the following steps: 1) acquisition of replicon elements of soybean yellow dwarf virus BeSRL and ULIR sequences of interest: the reference DNA Replicons for Plant Genome Engineering obtains the replicon element BeSRL and ULIR target sequences of the soybean yellow dwarf virus from the reference DNA Replicons, and then the replicon element BeSRL and the ULIR target sequences are synthesized by (GenScript); 2) construction of the transformation vector BeYDV-Cas 9-KI: the pRGEB32-GhU6.7-NPT II vector was digested with restriction enzyme Sbf I, the yellow dwarf virus replicon element BeSRL was ligated, and pRGEB32-GhU6.7-NPT II was digested with Sbf I. The gene editing-mediated foreign gene knock-in method and the carrier successfully establish a gene knock-in editing system which is suitable for the characteristics of cotton genomes for the first time in cotton, the system can insert the foreign gene into the cotton genomes at fixed points, the system becomes a new important technical means for researching the cotton functional genomes, and the knock-in efficiency in the cotton reaches 1.0 percent.
Description
Technical Field
The invention relates to the technical field of gene engineering, in particular to a method for knocking in exogenous genes mediated by gene editing into a cotton genome and a vector.
Background
The appearance of the CRISPR/Cas9 genome site-directed editing technology provides more choices for the fields of gene function research and the like, provides a new idea for reverse genetics research, but the research of site-directed insertion of foreign genes in plant genomes is not deep, in recent years, researches are carried out to realize DNA sequence replacement or site-directed insertion (knock-in) by using a CRISPR/Cas9 system in combination with non-homologous end joining (NHEJ) and homology-mediated repair (HDR), and the works provide a good reference for the following researches on CRISPR/Cas 9-mediated accurate gene insertion and accurate gene replacement, but the repair efficiency of the methods in different crops is low, and the gene editing efficiency of CRISPR/Cas9 is greatly influenced, and comprise the following reasons: firstly, NHEJ repair has uncontrollable property, bases are randomly inserted or deleted near a fracture opening after repair to realize frameshift mutation of coding genes, but accurate genome editing cannot be realized; secondly, HDR repair is used as a non-main-effect repair mode in a genome, sister chromatids need to be relied on or exogenous donor DNA needs to be provided as a repair template during working, working efficiency is low, and due to the limitations, scientific researchers are difficult to achieve the purpose of accurately editing the genome efficiently and stably under the traditional natural background, so that a new way needs to be searched to improve the introduction of exogenous genes into the cotton genome.
In order to break through the bottleneck that the repair efficiency of homologous recombination in plants is low, a new way for performing HDR repair by using a Geminivirus system (Geminivirus) is a new way, Geminivirus is a plant virus with numerous members, the genome of the Geminivirus consists of single-chain circular DNA (deoxyribonucleic acid) of 2.5-3kb, most monocotyledons and dicotyledons can be impregnated, and donor molecules required by HDR can be transformed, after Geminivirus impregnates plant cells, the Geminivirus has the characteristics of rapid impregnation, proliferation, transcription and expression without integrating into plant genomes, so that a large number of donor molecules can be generated in cells in a rolling ring replication mode, the number can reach hundreds to thousands of copies, and the probability of HDR is greatly improved.
At present, an accurate gene knock-in editing system is reported in many species, but the accurate gene knock-in editing system is not reported in allopetraploid cotton, the cotton is an important economic crop, cotton fiber is important natural fiber in textile industry, and cottonseed oil is also important oil stock, so that a new feasible and effective accurate gene knock-in editing system tool needs to be developed to provide important technical support for cotton genome function analysis, crop genetic improvement and new species breeding, and therefore, a method and a carrier for knocking in exogenous genes mediated by gene editing to cotton genomes are provided to solve the problems.
Disclosure of Invention
Technical problem to be solved
Aiming at the defects of the prior art, the invention provides a method and a carrier for knocking in exogenous genes into a cotton genome mediated by gene editing, which have the advantage of realizing accurate and efficient gene knocking in the upland cotton genome, and solve the problems that at present, an accurate gene knocking-in editing system is reported in many species, but is not reported in allopetraploid cotton, the cotton is an important economic crop, the cotton fiber is important natural fiber in the textile industry, and cottonseed oil is also important oil stock, so that a new feasible and effective accurate gene knocking-in editing system tool needs to be developed, and important technical support is provided for the function analysis of the cotton genome, the genetic improvement of crops and the breeding of new varieties.
(II) technical scheme
In order to realize the purpose of realizing accurate and efficient gene knock-in the upland cotton genome, the invention provides the following technical scheme: the gene editing-mediated foreign gene is knocked into a vector of a cotton genome, and the nucleotide sequence of the vector is shown in a sequence table:
preferably, the carrier is prepared by the following steps:
1) obtaining a target sequence replicon element (BeSRL), wherein the nucleotide sequence of the target sequence replicon element is shown in a sequence table SEQ ID NO: 3, showing: specifically, the target sequence is prepared by the following steps: sbf I was used for the comparison of SEQ ID NO: 1, carrying out enzyme digestion on pRGEB32-GhU6.7-NPT II (sequence table SEQ ID NO: 1) vector shown in the sequence table, connecting with a replicon sequence element BeSRL target sequence, and carrying out sequencing verification to obtain a DNA sequence shown in SEQ ID NO: 4 intermediate BeYDV-pRGEB32-1 suitable for knock-in of upland cotton;
2) obtaining a target sequence replicon element (ULIR), wherein the nucleotide sequence of the target sequence replicon element is shown in a sequence table SEQ ID NO: 3, specifically, the target sequence is prepared by the following steps: using Afe I for SEQ ID NO: the pRGEB32-GhU6.7-NPT II vector shown in 1 is subjected to enzyme digestion, is connected with a replicon sequence element BeSRL target sequence, and is subjected to sequencing verification to obtain a plasmid shown as SEQ ID NO: 2, the high-efficiency transformation intermediate vector BeYDV-Cas9 suitable for knocking-in of the gene of the upland cotton;
3) obtaining a target sequence homologous arm and a knock-in gene (L-arm + RFP + R-arm), wherein the nucleotide sequence of the target sequence homologous arm and the knock-in gene is shown in a sequence table SEQ ID NO: specifically, the target sequence is prepared by the following steps: pair SEQ ID NO: 2, performing enzyme digestion on the BeYDV-Cas9 vector shown in the figure, connecting the BeYDV-Cas9 vector with a homology arm and a target sequence of a knock-in gene (L-arm + RFP + R-arm), and performing sequencing verification to obtain a sequence shown as SEQ ID NO: 6, the high-efficiency transformation intermediate vector BeYDV-Cas9-KI-RFP suitable for knocking-in genes of upland cotton;
4) obtaining a target sequence sgRNA + gRNA, wherein the nucleotide sequence of the sgRNA + gRNA is shown in a sequence table SEQ ID NO: 9, specifically, the target sequence is prepared by the following steps: alignment of SEQ ID NO with Bsa I: the BeYDV-Cas9-KI-RFP vector shown in6 is subjected to enzyme digestion, is connected with the sgRNA + gRNA target sequence, and is subjected to sequencing verification to obtain a sequence shown as SEQ ID NO: 7, and a high-efficiency transformation vector BeYDV-Cas9-KI-sgRNA suitable for knocking-in genes of upland cotton.
Another technical problem to be solved by the present invention is to provide a method for gene editing-mediated knock-in of an exogenous gene into a cotton genome, comprising the steps of:
1) acquisition of replicon elements of soybean yellow dwarf virus BeSRL and ULIR sequences of interest: the reference DNA Replicons for Plant Genome Engineering obtains the replicon element BeSRL and ULIR target sequences of the soybean yellow dwarf virus from the reference DNA Replicons, and then the replicon element BeSRL and the ULIR target sequences are synthesized by (GenScript);
2) construction of the transformation vector BeYDV-Cas 9-KI: the method comprises the following steps of utilizing restriction endonuclease Sbf I to carry out digestion on pRGEB32-GhU6.7-NPT II vector, connecting a replicon element BeSRL of the yellow dwarf virus, carrying out Sbf I digestion on pRGEB32-GhU6.7-NPT II, carrying out digestion at 37 ℃ for 5 hours, observing whether a digestion band is correct or not by gel electrophoresis, then utilizing a gel recovery kit to purify a digestion product, designing primers on the digested pRGEB32-GhU6.7-NPT II vector, wherein forward primers are as follows: CCGAATTTGTGGACCTTAGCGCGTGCATGCCTG(ii) a The reverse primer is: GCGTGCATGCCTGCAACCCGAATTTGTGGACCGAG(ii) a Connecting the amplified BeSRL sequence with a cleaved pRGEB32-GhU6.7-NPT II vector In a 37 ℃ water bath by In-fusion, reacting for 30 minutes, transforming to escherichia coli competence, selecting positive clones for sequencing, obtaining a BeYDV-pRGEB32-1 intermediate vector after sequencing is correct, cleaving the BeYDV-pRGEB32-1 intermediate vector for connection with a yellow dwarf virus replicon element ULIR, cleaving the BeYDV-pRGEB32-1 intermediate vector with correct positive clone sequencing by using a restriction endonuclease Afe I, connecting a yellow dwarf virus replicon element ULIR, cleaving the BeYDV-pRGEB32-1 for Afe I, cleaving at 37 ℃ for 5 hours, observing whether a cleavage strip is correct by gel electrophoresis, purifying a cleavage product by using a gel recovery cleavage kit, designing a primer on the cleaved BeYDV-pRGEB32-1 vector after cleavage, the forward primer is: TTACGCCAAAGCGCTtagcagaaggcatgttgttg tgac(ii) a The reverse primer is: GACGGTACCGGATCCgagggtcgtacgaataattcg(ii) a Carrying out In-fusion ligation reaction on the amplified ULIR sequence and the enzyme-cleaved BeYDV-pRGEB32-1 vector In a water bath at 37 ℃ for 30 minutes, then converting the obtained product to be competent escherichia coli, selecting positive clone for sequencing, and naming the plasmid with correct sequence as a BeYDV-Cas9-KI plasmid;
3) construction of the BeYDV-Cas9-KI-sgRNA vector:
A. sgRNA design of ghcia gene:
selecting 1-deoxyxylulose-5-phosphate synthase (CLA) Gh _ D10G017610 gene of upland cotton as a verification gene, designing an sgRNA target sequence in a gene exon region by using online software CRISPR-P (http:// cbi. hzau. edu. cn/cgi-bin/CRISPR), and finally selecting 1 sgRNA from the gene to construct a plant expression vector of a gene knock-in system.
B. Obtaining the homologous arm and the sequence of the exogenous gene:
obtaining an RFP gene sequence on an Addgene website, synthesizing a sequence of a left arm + RFP + GhCLA gene right arm of a GhCLA gene through (GenScript), connecting the sequence to a BeYDV-Cas9-KI vector through infusion, converting the sequence to escherichia coli competence, selecting a positive clone for sequencing, and obtaining the BeYDV-Cas9-KI-RFP vector after the sequencing is correct.
C. Connection of sgRNA to BeYDV-Cas9-KI-RFP vector:
the target sequence inserted into the BeYDV-Cas9-KI-RFP vector is sgRNA1-gRNA, the two target fragments are synthesized by (GenScript), BsaI is used for enzyme digestion of BeYDV-Cas9-KI-RFP, the synthesized sgRNA1+ gRNA fragment is respectively connected to the BsaI enzyme digestion site of the BeYDV-Cas9-KI-RFP vector through In-fusion connection and is transformed to escherichia coli competence, a positive clone is selected for sequencing, and the BeYDV-Cas9-KI-sgRNA vector is obtained after the sequencing is correct;
4) agrobacterium-mediated genetic transformation: the method comprises the following specific steps:
A. sterilizing the peeled cotton seeds (Jin 668, patent application No. 201510833618.0) with 0.1% mercuric chloride, washing with sterile water for several times, placing in sterile seedling culture medium, dark culturing at 28 deg.C for 1 day, removing seed coat, strengthening seedling, and dark culturing at 28 deg.C for 4-5 days;
B. cutting hypocotyls into small stem sections, infecting with activated agrobacterium, discarding the bacterial liquid, and drying;
C. laying the hypocotyl in a co-culture medium containing filter paper, and culturing at 20 deg.C in dark for 1-2 days;
D. transferring the hypocotyl into a callus induction culture medium added with 2, 4-D, placing the hypocotyl into a light culture chamber, and subculturing for about 20-30 days by using a fresh callus induction culture medium;
E. when the callus grows into rice-shaped particles, transferring the rice-shaped particles into a differentiation culture medium, and further differentiating into embryoids;
F. subculturing the differentiated plantlets into a rooting culture medium until the plantlets grow into plantlets with good and healthy roots;
G. transferring the plantlets into clear water, hardening the plantlets, and transferring the plantlets to a greenhouse after about one week;
5) sanger sequencing test editing efficiency: the extracted positive genomic DNA of the tender cotton leaf is used as a template to amplify the sequence of RFP gene and the 3' end of the right homology arm in a GhPLA (Gh _ D10G017610) target sequence, then a PCR fragment is connected into a pGEM-T easy vector, a connecting product is thermally shocked to transform escherichia coli competent TOP10, the picked monoclones are subjected to positive detection and Sanger sequencing, the sequencing result is compared with the target sequence, each sample is subjected to sequencing of at least 15 monoclones, and the editing condition of each target spot is counted.
(III) advantageous effects
Compared with the prior art, the invention provides a method and a carrier for knocking in exogenous genes mediated by gene editing into a cotton genome, and the method and the carrier have the following beneficial effects:
the gene editing-mediated foreign gene knock-in method and the vector successfully establish a gene knock-in editing system which is suitable for the characteristics of cotton genomes for the first time in cotton, and the system can insert the foreign gene into the cotton genomes at fixed points, thereby becoming a new important technical means for researching the cotton functional genomes.
Drawings
FIG. 1 is a vector diagram of the method for knocking in a foreign gene into a cotton genome mediated by gene editing and the vector pRGEB32-GhU6.7-NPT II provided by the present invention;
FIG. 2 is a construction diagram of a method for knocking in a foreign gene into a cotton genome mediated by gene editing and a vector expression vector BeYDV-Cas9-KI, which are provided by the invention;
FIG. 3 is a diagram showing the construction of a gene editing-mediated foreign gene knock-in method into a cotton genome and a vector intermediate BeYDV-pRGEB32-1 according to the present invention;
FIG. 4 is a construction diagram of a gene editing-mediated foreign gene knock-in cotton genome method and a cotton gene knock-in editing vector BeYDV-Cas9-KI-RFP carrying a homology arm and a foreign gene, which are provided by the invention;
FIG. 5 is a schematic diagram of a method for knocking in a foreign gene into a cotton genome mediated by gene editing and a construction of a vector BeYDV-Cas9-KI-sgRNA, which are provided by the invention;
FIG. 6 is a diagram showing the location of the sgRNA vector and the method for knocking in a foreign gene into a cotton genome mediated by gene editing according to the present invention;
FIG. 7 is a diagram showing the genetic transformation of a vector GhCLA and a method for knocking in a foreign gene into a cotton genome through gene editing according to the present invention;
FIG. 8 is an editorial view showing the gene editing-mediated knocking-in of foreign genes into the cotton genome and the editing and detection of the vector foreign gene RFP knocking-in.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Referring to fig. 1-8, the letter numbers in fig. 5 are: a hypocotyl co-culture stage; b. stem sections on selection medium containing kanamycin; c. stem segments with expanded two ends on the selective culture medium; d. callus in a differentiation medium; e. plantlets on a rooting medium; f. hydroponic plantlets; g. transgenic seedlings of T0 generation grown in greenhouse, RFP in FIG. 7 is the site of identification of foreign gene insertion.
Sequence listing SEQ ID NO: 1 is the nucleotide sequence of pRGEB32-GhU6.7-NPT II vector of the invention, and the sequence length is 16241 bp.
Sequence listing SEQ ID NO: 2 is a nucleotide sequence of a high-efficiency upland cotton genome transformation gene knock-in vector BeYDV-Cas9-KI, and the sequence length is 18273 bp.
Sequence listing SEQ ID NO: 3 is the nucleotide sequence of the replicon element BeSRL of the bean yellow dwarf virus, and the sequence length is 1637 bp.
Sequence listing SEQ ID NO: 4 is the nucleotide sequence of BeYDV-pRGEB32-1, and the sequence length is 17908 bp.
Sequence listing SEQ ID NO: 5 is the nucleotide sequence of the replicon element ULIR of the bean yellow dwarf virus, and the sequence length is 365bp
Sequence listing SEQ ID NO: 6 is a nucleotide sequence of a high-efficiency upland cotton genome transformation gene knock-in vector BeYDV-Cas9-KI-RFP, and the sequence length is 20194 bp.
Sequence listing SEQ ID NO: 7 is a nucleotide sequence vector of a high-efficiency upland cotton genome transformation gene knock-in vector BeYDV-Cas9-KI-sgRNA, and the sequence length is 20194 bp.
Sequence listing SEQ ID NO: 8 is a sgRNA + Grna sequence of the GhPLA gene, and the sequence length is 97 bp.
The gene editing-mediated foreign gene is knocked into a carrier of a cotton genome, and the nucleotide sequence of the carrier is shown in a sequence table:
the carrier is prepared by the following steps:
1) obtaining a target sequence replicon element (BeSRL), wherein the nucleotide sequence of the target sequence replicon element is shown in a sequence table SEQ ID NO: 3, showing: specifically, the target sequence is prepared by the following steps: sbf I was used for the comparison of SEQ ID NO: 1, carrying out enzyme digestion on pRGEB32-GhU6.7-NPT II (sequence table SEQ ID NO: 1) vector shown in the sequence table, connecting with a replicon sequence element BeSRL target sequence, and carrying out sequencing verification to obtain a DNA sequence shown in SEQ ID NO: 4 intermediate BeYDV-pRGEB32-1 suitable for knock-in of upland cotton;
2) obtaining a target sequence replicon element (ULIR), wherein the nucleotide sequence of the target sequence replicon element is shown in a sequence table SEQ ID NO: 3, specifically, the target sequence is prepared by the following steps: using Afe I for SEQ ID NO: the pRGEB32-GhU6.7-NPT II vector shown in 1 is subjected to enzyme digestion, is connected with a replicon sequence element BeSRL target sequence, and is subjected to sequencing verification to obtain a plasmid shown as SEQ ID NO: 2, the high-efficiency transformation intermediate vector BeYDV-Cas9 suitable for knocking-in of the gene of the upland cotton;
3) obtaining a target sequence homologous arm and a knock-in gene (L-arm + RFP + R-arm), wherein the nucleotide sequence of the target sequence homologous arm and the knock-in gene is shown in a sequence table SEQ ID NO: specifically, the target sequence is prepared by the following steps: pair SEQ ID NO: 2, performing enzyme digestion on the BeYDV-Cas9 vector shown in the figure, connecting the BeYDV-Cas9 vector with a homology arm and a target sequence of a knock-in gene (L-arm + RFP + R-arm), and performing sequencing verification to obtain a sequence shown as SEQ ID NO: 6, the high-efficiency transformation intermediate vector BeYDV-Cas9-KI-RFP suitable for knocking-in genes of upland cotton;
4) obtaining a target sequence sgRNA + gRNA, wherein the nucleotide sequence of the sgRNA + gRNA is shown in a sequence table SEQ ID NO: 9, specifically, the target sequence is prepared by the following steps: alignment of SEQ ID NO with Bsa I: the BeYDV-Cas9-KI-RFP vector shown in6 is subjected to enzyme digestion, is connected with the sgRNA + gRNA target sequence, and is subjected to sequencing verification to obtain a sequence shown as SEQ ID NO: 7, and a high-efficiency transformation vector BeYDV-Cas9-KI-sgRNA suitable for knocking-in genes of upland cotton.
Another technical problem to be solved by the present invention is to provide a method for gene editing-mediated knock-in of an exogenous gene into a cotton genome, comprising the steps of:
1) acquisition of replicon elements of soybean yellow dwarf virus BeSRL and ULIR sequences of interest: the reference DNA Replicons for Plant Genome Engineering obtains the replicon element BeSRL and ULIR target sequences of the soybean yellow dwarf virus from the reference DNA Replicons, and then the replicon element BeSRL and the ULIR target sequences are synthesized by (GenScript);
2) construction of the transformation vector BeYDV-Cas 9-KI: the method comprises the following steps of utilizing restriction endonuclease Sbf I to carry out digestion on pRGEB32-GhU6.7-NPT II vector, connecting a replicon element BeSRL of the yellow dwarf virus, carrying out Sbf I digestion on pRGEB32-GhU6.7-NPT II, carrying out digestion at 37 ℃ for 5 hours, observing whether a digestion band is correct or not by gel electrophoresis, then utilizing a gel recovery kit to purify a digestion product, designing primers on the digested pRGEB32-GhU6.7-NPT II vector, wherein forward primers are as follows: CCGAATTTGTGGACCTTAGCGCGTGCATGCCTG(ii) a The reverse primer is: GCGTGCATGCCTGCAACCCGAATTTGTGGACCGAG(ii) a The amplified BeSRL sequence and the enzyme-digested BeSRL sequencepRGEB32-GhU6.7-NPT II vector is connected In water bath at 37 ℃ through In-fusion, after reaction is carried out for 30 minutes, the vector is transformed to be competent In escherichia coli, positive clone is selected for sequencing, after sequencing is correct, a BeYDV-pRGEB32-1 intermediate vector is obtained, the BeYDV-pRGEB32-1 intermediate vector is cut by enzyme and then connected with a replicon element ULIR of the yellow dwarf virus, the BeYDV-pRGEB32-1 intermediate vector with positive clone sequencing is cut by restriction enzyme Afe I, the replicon is connected with the ULIR of the yellow dwarf virus, the BeYDV-pRGEB32-1 is cut by Afe I, the cleavage is carried out at 37 ℃ for 5 hours, gel electrophoresis is used for observing whether a cut band is correct or not, then a gel recovery kit is used for purifying a cut product, a primer is designed on the cut BeYDV-pRGEB32-1 vector, and a forward primer is: TTACGCCAAAGCGCTtagcagaaggcatgttgttg tgac(ii) a The reverse primer is: GACGGTACCGGATCCgagggtcgtacgaataattcg(ii) a Carrying out In-fusion ligation reaction on the amplified ULIR sequence and the enzyme-cleaved BeYDV-pRGEB32-1 vector In a water bath at 37 ℃ for 30 minutes, then converting the obtained product to be competent escherichia coli, selecting positive clone for sequencing, and naming the plasmid with correct sequence as a BeYDV-Cas9-KI plasmid;
restriction enzyme Sbf I the pRGEB32-GhU6.7-NPT II vector was cut as follows:
the In-fusion ligation reaction system was as follows:
the BeYDV-pRGEB32-1 vector is cut by using restriction enzyme Afe I as follows:
the sequence of sgRNA is as follows:
3) construction of the BeYDV-Cas9-KI-sgRNA vector:
A. sgRNA design of ghcia gene:
selecting 1-deoxyxylulose-5-phosphate synthase (CLA) Gh _ D10G017610 gene of upland cotton as a verification gene, designing an sgRNA target sequence in a gene exon region by using online software CRISPR-P (http:// cbi. hzau. edu. cn/cgi-bin/CRISPR), and finally selecting 1 sgRNA from the gene to construct a plant expression vector of a gene knock-in system.
B. Obtaining the homologous arm and the sequence of the exogenous gene:
obtaining an RFP gene sequence on an Addgene website, synthesizing a sequence of a left arm + RFP + GhCLA gene right arm of a GhCLA gene through (GenScript), connecting the sequence to a BeYDV-Cas9-KI vector through infusion, converting the sequence to escherichia coli competence, selecting a positive clone for sequencing, and obtaining the BeYDV-Cas9-KI-RFP vector after the sequencing is correct.
C. Connection of sgRNA to BeYDV-Cas9-KI-RFP vector:
the target sequence inserted into the BeYDV-Cas9-KI-RFP vector is sgRNA1-gRNA, the two target fragments are synthesized by (GenScript), BsaI is used for enzyme digestion of BeYDV-Cas9-KI-RFP, the synthesized sgRNA1+ gRNA fragment is respectively connected to the BsaI enzyme digestion site of the BeYDV-Cas9-KI-RFP vector through In-fusion connection and is transformed to escherichia coli competence, a positive clone is selected for sequencing, and the BeYDV-Cas9-KI-sgRNA vector is obtained after the sequencing is correct;
4) agrobacterium-mediated genetic transformation: the method comprises the following specific steps:
A. sterilizing the peeled cotton seeds (Jin 668, patent application No. 201510833618.0) with 0.1% mercuric chloride, washing with sterile water for several times, placing in sterile seedling culture medium, dark culturing at 28 deg.C for 1 day, removing seed coat, strengthening seedling, and dark culturing at 28 deg.C for 4-5 days;
B. cutting hypocotyls into small stem sections, infecting with activated agrobacterium, discarding the bacterial liquid, and drying;
C. laying the hypocotyl in a co-culture medium containing filter paper, and culturing at 20 deg.C in dark for 1-2 days;
D. transferring the hypocotyl into a callus induction culture medium added with 2, 4-D, placing the hypocotyl into a light culture chamber, and subculturing for about 20-30 days by using a fresh callus induction culture medium;
E. when the callus grows into rice-shaped particles, transferring the rice-shaped particles into a differentiation culture medium, and further differentiating into embryoids;
F. subculturing the differentiated plantlets into a rooting culture medium until the plantlets grow into plantlets with good and healthy roots;
G. transferring the plantlets into clear water, hardening the plantlets, and transferring the plantlets to a greenhouse after about one week;
the components and the mixture ratio of the culture medium used for transformation are as follows:
sterile seedling culture medium: 1/2MS macroelements, 15g/L glucose, 2.5g/L Phytagel; pH: 6.1-6.2.
Callus induction medium: MSB + 24-D0.1 mg/L + KT 0.1mg/L + 3% Glucose + 0.3% Phytagel; pH: 5.85-5.95.
Agrobacterium activating culture medium: tryptone 5g/L + NaCl 5g/L + MgSO4.7H2O 0.1g/L + KH2PO4+0.25g/L + mannitol 5g/L + glycine 1.0 g/L; pH: 5.85-5.95.
Co-culture medium: MSB +2, 4-D0.1 mg/l + KT 0.1mg/l +50mg/l AS + 3% Glucose + 0.25% Phytagel, pH 5.8.
Selecting a culture medium: MSB +2, 4-D0.1 mg/L + KT 0.1mg/L + 3% Glucose + 0.3% Phytagel, kanamycin 50mg/L and cefamycin 400 mg/L; pH: 5.85-5.95.
Differentiation medium: NH4NO3 was removed from MSB medium and the amount of KNO3 was doubled + Gln 1.0g/L + Asn 0.5g/L + IBA 0.5mg/L + KT 0.15mg/L + 3% Glucose + 0.25% Phytagel, pH: 6.1-6.2.
Rooting culture medium: 1/2MS inorganic salt + B5 organic matter, 15g/L glucose, 2.5g/L Phytagel; pH: 5.90-5.95; the MSB is composed of: MS medium + B5 vitamins.
5) Sanger sequencing test editing efficiency: the extracted positive genomic DNA of the tender cotton leaf is used as a template to amplify the sequence of RFP gene and the 3' end of the right homology arm in a GhPLA (Gh _ D10G017610) target sequence, then a PCR fragment is connected into a pGEM-T easy vector, a connecting product is thermally shocked to transform escherichia coli competent TOP10, the picked monoclones are subjected to positive detection and Sanger sequencing, the sequencing result is compared with the target sequence, each sample is subjected to sequencing of at least 15 monoclones, and the editing condition of each target spot is counted.
The invention has the beneficial effects that: the method and the carrier for knocking exogenous genes into a cotton genome mediated by gene editing successfully establish a gene knocking-in editing system suitable for the characteristics of the cotton genome for the first time in cotton, the system can insert the exogenous genes into the cotton genome at fixed points, the method becomes a new important technical means for researching the cotton functional genome, and solves the problems that at present, an accurate gene knocking-in editing system is reported in many species, but no report is found in the cotton of allopetraploid, the cotton is an important economic crop, the cotton fiber is an important natural fiber in the textile industry, and cottonseed oil is also an important oil stock, a new feasible, effective and accurate gene knocking-in editing system tool needs to be developed, and important technical support is provided for the analysis of the cotton genome function, the genetic improvement of crops and the breeding of new varieties.
Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.
Claims (3)
1. The vector for knocking in the exogenous gene mediated by gene editing into a cotton genome is characterized in that the nucleotide sequence of the vector is shown in a sequence table.
2. The gene editing-mediated foreign gene knock-in vector into the cotton genome as set forth in claim 1, which is prepared by the steps of:
1) obtaining a target sequence replicon element (BeSRL), wherein the nucleotide sequence of the target sequence replicon element is shown in a sequence table SEQ ID NO: 3, showing: specifically, the target sequence is prepared by the following steps: sbf I was used for the comparison of SEQ ID NO: 1, carrying out enzyme digestion on pRGEB32-GhU6.7-NPT II (sequence table SEQ ID NO: 1) vector shown in the sequence table, connecting with a replicon sequence element BeSRL target sequence, and carrying out sequencing verification to obtain a DNA sequence shown in SEQ ID NO: 4 intermediate BeYDV-pRGEB32-1 suitable for knock-in of upland cotton;
2) obtaining a target sequence replicon element (ULIR), wherein the nucleotide sequence of the target sequence replicon element is shown in a sequence table SEQ ID NO: 3, specifically, the target sequence is prepared by the following steps: using Afe I for SEQ ID NO: the pRGEB32-GhU6.7-NPT II vector shown in 1 is subjected to enzyme digestion, is connected with a replicon sequence element BeSRL target sequence, and is subjected to sequencing verification to obtain a plasmid shown as SEQ ID NO: 2, the high-efficiency transformation intermediate vector BeYDV-Cas9 suitable for knocking-in of the gene of the upland cotton;
3) obtaining a target sequence homologous arm and a knock-in gene (L-arm + RFP + R-arm), wherein the nucleotide sequence of the target sequence homologous arm and the knock-in gene is shown in a sequence table SEQ ID NO: specifically, the target sequence is prepared by the following steps: pair SEQ ID NO: 2, performing enzyme digestion on the BeYDV-Cas9 vector shown in the figure, connecting the BeYDV-Cas9 vector with a homology arm and a target sequence of a knock-in gene (L-arm + RFP + R-arm), and performing sequencing verification to obtain a sequence shown as SEQ ID NO: 6, the high-efficiency transformation intermediate vector BeYDV-Cas9-KI-RFP suitable for knocking-in genes of upland cotton;
4) obtaining a target sequence sgRNA + gRNA, wherein the nucleotide sequence of the sgRNA + gRNA is shown in a sequence table SEQ ID NO: 9, specifically, the target sequence is prepared by the following steps: alignment of SEQ ID NO with Bsa I: the BeYDV-Cas9-KI-RFP vector shown in6 is subjected to enzyme digestion, is connected with the sgRNA + gRNA target sequence, and is subjected to sequencing verification to obtain a sequence shown as SEQ ID NO: 7, and a high-efficiency transformation vector BeYDV-Cas9-KI-sgRNA suitable for knocking-in genes of upland cotton.
3. A method for gene editing-mediated knock-in of an exogenous gene into the genome of cotton, comprising the steps of:
1) acquisition of replicon elements of soybean yellow dwarf virus BeSRL and ULIR sequences of interest: the reference DNA Replicons for Plant Genome Engineering obtains the replicon element BeSRL and ULIR target sequences of the soybean yellow dwarf virus from the reference DNA Replicons, and then the replicon element BeSRL and the ULIR target sequences are synthesized by (GenScript);
2) construction of the transformation vector BeYDV-Cas 9-KI: the method comprises the following steps of utilizing restriction endonuclease Sbf I to carry out digestion on pRGEB32-GhU6.7-NPT II vector, connecting a replicon element BeSRL of the yellow dwarf virus, carrying out Sbf I digestion on pRGEB32-GhU6.7-NPT II, carrying out digestion at 37 ℃ for 5 hours, observing whether a digestion band is correct or not by gel electrophoresis, then utilizing a gel recovery kit to purify a digestion product, designing primers on the digested pRGEB32-GhU6.7-NPT II vector, wherein forward primers are as follows: CCGAATTTGTGGACCTTAGC GCGTGCATGCCTG(ii) a The reverse primer is: GCGTGCATGCCTGCAACCCGAATTTGTGGACCGAG(ii) a Connecting the amplified BeSRL sequence with a cleaved pRGEB32-GhU6.7-NPT II vector In a 37 ℃ water bath by In-fusion, reacting for 30 minutes, transforming to escherichia coli competence, selecting positive clones for sequencing, obtaining a BeYDV-pRGEB32-1 intermediate vector after sequencing is correct, cleaving the BeYDV-pRGEB32-1 intermediate vector for connection with a yellow dwarf virus replicon element ULIR, cleaving the BeYDV-pRGEB32-1 intermediate vector with correct positive clone sequencing by using a restriction endonuclease Afe I, connecting a yellow dwarf virus replicon element ULIR, cleaving the BeYDV-pRGEB32-1 for Afe I, cleaving at 37 ℃ for 5 hours, observing whether a cleavage strip is correct by gel electrophoresis, purifying a cleavage product by using a gel recovery cleavage kit, designing a primer on the cleaved BeYDV-pRGEB32-1 vector after cleavage, the forward primer is: TTACGCCAAAGCGCTtagcagaaggcatgttgttg tgac(ii) a The reverse primer is: GACGGTACCGGATCCgagggtcgtacgaataattcg(ii) a Carrying out In-fusion ligation reaction on the amplified ULIR sequence and the enzyme-cleaved BeYDV-pRGEB32-1 vector In a water bath at 37 ℃ for 30 minutes, then converting the obtained product to be competent escherichia coli, selecting positive clone for sequencing, and naming the plasmid with correct sequence as a BeYDV-Cas9-KI plasmid;
3) construction of the BeYDV-Cas9-KI-sgRNA vector:
A. sgRNA design of ghcia gene:
selecting 1-deoxyxylulose-5-phosphate synthase (CLA) Gh _ D10G017610 gene of upland cotton as a verification gene, designing an sgRNA target sequence in a gene exon region by using online software CRISPR-P (http:// cbi. hzau. edu. cn/cgi-bin/CRISPR), and finally selecting 1 sgRNA from the gene to construct a plant expression vector of a gene knock-in system.
B. Obtaining the homologous arm and the sequence of the exogenous gene:
obtaining an RFP gene sequence on an Addgene website, synthesizing a sequence of a left arm + RFP + GhCLA gene right arm of a GhCLA gene through (GenScript), connecting the sequence to a BeYDV-Cas9-KI vector through infusion, converting the sequence to escherichia coli competence, selecting a positive clone for sequencing, and obtaining the BeYDV-Cas9-KI-RFP vector after the sequencing is correct.
C. Connection of sgRNA to BeYDV-Cas9-KI-RFP vector:
the target sequence inserted into the BeYDV-Cas9-KI-RFP vector is sgRNA1-gRNA, the two target fragments are synthesized by (GenScript), BsaI is used for enzyme digestion of BeYDV-Cas9-KI-RFP, the synthesized sgRNA1+ gRNA fragment is respectively connected to the BsaI enzyme digestion site of the BeYDV-Cas9-KI-RFP vector through In-fusion connection and is transformed to escherichia coli competence, a positive clone is selected for sequencing, and the BeYDV-Cas9-KI-sgRNA vector is obtained after the sequencing is correct;
4) agrobacterium-mediated genetic transformation: the method comprises the following specific steps:
A. sterilizing the peeled cotton seeds (Jin 668, patent application No. 201510833618.0) with 0.1% mercuric chloride, washing with sterile water for several times, placing in sterile seedling culture medium, dark culturing at 28 deg.C for 1 day, removing seed coat, strengthening seedling, and dark culturing at 28 deg.C for 4-5 days;
B. cutting hypocotyls into small stem sections, infecting with activated agrobacterium, discarding the bacterial liquid, and drying;
C. laying the hypocotyl in a co-culture medium containing filter paper, and culturing at 20 deg.C in dark for 1-2 days;
D. transferring the hypocotyl into a callus induction culture medium added with 2, 4-D, placing the hypocotyl into a light culture chamber, and subculturing for about 20-30 days by using a fresh callus induction culture medium;
E. when the callus grows into rice-shaped particles, transferring the rice-shaped particles into a differentiation culture medium, and further differentiating into embryoids;
F. subculturing the differentiated plantlets into a rooting culture medium until the plantlets grow into plantlets with good and healthy roots;
G. transferring the plantlets into clear water, hardening the plantlets, and transferring the plantlets to a greenhouse after about one week;
5) sanger sequencing test editing efficiency: the extracted positive genomic DNA of the tender cotton leaf is used as a template to amplify the sequence of RFP gene and the 3' end of the right homology arm in a GhPLA (Gh _ D10G017610) target sequence, then a PCR fragment is connected into a pGEM-T easy vector, a connecting product is thermally shocked to transform escherichia coli competent TOP10, the picked monoclones are subjected to positive detection and Sanger sequencing, the sequencing result is compared with the target sequence, each sample is subjected to sequencing of at least 15 monoclones, and the editing condition of each target spot is counted.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110608540.8A CN113174401A (en) | 2021-06-01 | 2021-06-01 | Method and carrier for knocking-in exogenous gene into cotton genome mediated by gene editing |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110608540.8A CN113174401A (en) | 2021-06-01 | 2021-06-01 | Method and carrier for knocking-in exogenous gene into cotton genome mediated by gene editing |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113174401A true CN113174401A (en) | 2021-07-27 |
Family
ID=76927246
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110608540.8A Pending CN113174401A (en) | 2021-06-01 | 2021-06-01 | Method and carrier for knocking-in exogenous gene into cotton genome mediated by gene editing |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113174401A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108203714A (en) * | 2016-12-20 | 2018-06-26 | 华中农业大学 | A kind of edit methods of cotton gene |
| CN110283840A (en) * | 2019-04-11 | 2019-09-27 | 华中农业大学 | The accurate efficient edit methods of upland cotton genome |
-
2021
- 2021-06-01 CN CN202110608540.8A patent/CN113174401A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108203714A (en) * | 2016-12-20 | 2018-06-26 | 华中农业大学 | A kind of edit methods of cotton gene |
| CN110283840A (en) * | 2019-04-11 | 2019-09-27 | 华中农业大学 | The accurate efficient edit methods of upland cotton genome |
Non-Patent Citations (1)
| Title |
|---|
| 李波: "基于BeYDV双生病毒系统及CRISPR-LbCpf1系统在棉花基因编辑中的应用", 中国博士学位论文全文数据库农业科技辑, pages 047 - 102 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108949774B (en) | Method for obtaining multi-leaf alfalfa material by using MsPALM1 artificial site-specific mutant | |
| CN112538492B (en) | SpCas9n variant capable of recognizing NRTH (Polyacrylamide) as PAM (Polyacrylamide) sequence and corresponding base editing system | |
| CN109234310A (en) | It is quickly obtained the recombinant vector and application method of no transgene gene editor plant | |
| CN110878303B (en) | Rice Os11g0681100 gene and function and application of encoded protein thereof | |
| CN111926034A (en) | Upland cotton genome single base editing (ABE) system | |
| US11365423B2 (en) | Method of obtaining multileaflet Medicago sativa materials by means of MsPALM1 artificial site-directed mutants | |
| CN114591977A (en) | Method for obtaining glyphosate-resistant rice by accurately editing endogenous EPSPS gene and system used by method | |
| CN113265403A (en) | Soybean Dt1 gene editing site and application thereof | |
| US20230265447A1 (en) | Delivery of developmental regulators to plants for the induction of meristematic tissue with genetic alterations | |
| WO2001096583A2 (en) | Removal of selectable markers from transformed cells | |
| CN111944842A (en) | Method for constructing upland cotton insect-resistant related gene editing mutant library | |
| CN109486840B (en) | Codon-plant-modified NmeCas9 gene and application thereof | |
| CN116732070A (en) | CGBE single base editor capable of realizing base transversion and application thereof | |
| CN113174401A (en) | Method and carrier for knocking-in exogenous gene into cotton genome mediated by gene editing | |
| CN114854766A (en) | NtAIDP1 gene mutant for reducing nicotine content in tobacco leaves and application thereof | |
| CN109486832B (en) | Method for creating cotton with limited growth plant type | |
| CN113278647A (en) | Editing method for efficient directional gene regulation of upland cotton genome | |
| CN111534538B (en) | Method for rapidly screening non-transgenic site-directed mutant plants | |
| CN111909956A (en) | Method for improving drought resistance of rice by blocking or weakening gene expression of OsNAC092 of rice | |
| CN113337539A (en) | Method suitable for accurate and efficient gene editing of upland cotton | |
| CN112575014B (en) | Base editor SpCas9-LjCDAL1 and construction and application thereof | |
| CN115820691B (en) | LbCPf1 variant-based rice base editing system and application | |
| CN116716317B (en) | Application of PSK3 gene in promotion of genetic transformation efficiency of alfalfa | |
| CN117384948A (en) | Gene sequence for realizing A/T accurate replacement at target site-4 position and replacement method | |
| CN115125252A (en) | Application and method of CsSH1 gene in improvement of excessive growth resistance of cucumber in seedling stage |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |