CN113151350A

CN113151350A - Cowpea in-situ transformation method

Info

Publication number: CN113151350A
Application number: CN202110092522.9A
Authority: CN
Inventors: 叶志彪; 丁蕾; 王文乾; 卢永恩; 张余洋; 张俊红; 王涛涛; 欧阳波; 杨长宪; 叶杰
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2021-01-24
Filing date: 2021-01-24
Publication date: 2021-07-23
Anticipated expiration: 2041-01-24
Also published as: CN113151350B

Abstract

The invention provides a cowpea in-situ conversion method, which comprises the following steps: accelerating germination of cowpea seeds until cotyledonary nodes are completely exposed to obtain a transformation receptor; preparing a dip dyeing solution of agrobacterium tumefaciens containing an expression vector and a target gene; soaking the conversion receptor in the dip dyeing solution for dip dyeing under the negative pressure condition; transferring the infected transformation receptor into soil for cultivation, and screening positive plants in seedlings after two weeks. Compared with the traditional tissue culture method, the method can effectively improve the conversion rate of the cowpea seeds, and has the advantages of convenient operation, high culture efficiency and low cost.

Description

Cowpea in-situ transformation method

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to a cowpea in-situ transformation method.

Background

Cowpea (Vigna anguillata L. Walp) is rich in nutrition, rich in protein, vitamins and minerals, large in cultivation area, and is one of the most important cultivated legume crops.

The inherent gene diversity of the cowpea is low, the cowpea has strong cross incompatibility, the traditional breeding mode has little effect in cowpea breeding, and the transgenic technology provides an effective way for cowpea breeding. Cowpeas can be transformed by an agrobacterium-mediated in situ transformation method, but the traditional agrobacterium-mediated in situ transformation method is generally transformed by a tissue culture method, and the traditional tissue culture method generally comprises the following steps:

step one, dip dyeing: and adopting wounded cowpea cotyledon nodes as transformation receptors to carry out agrobacterium impregnation.

Step two, co-cultivation: the impregnated cotyledonary node is co-cultured in culture medium under aseptic condition for about 1 week.

Step three, regeneration seedling induction: inserting the co-cultured cotyledon node into a bud induction culture medium, culturing for 2 weeks, and after a new bud grows out, transferring the new bud into the culture medium again for regeneration seedling induction, wherein about 2 weeks are needed.

Fourthly, rooting induction and seedling hardening: cutting the regenerated seedling cultured in the third step, transferring the cut regenerated seedling into a rooting culture medium, and inducing rooting, wherein 1 week is probably needed; taking out the seedlings after rooting induction, cleaning the culture medium at the roots, transplanting the seedlings into a seedling raising tray, continuously culturing for about 2 weeks, and transplanting the seedlings into soil for culturing.

The traditional tissue culture method has the defects of complex operation, high cost and long period, and the conversion rate of the method is low, generally about 1%. For certain specific cowpea seeds, transformation cannot even be carried out by conventional tissue culture methods. The inventor adopts the traditional tissue culture method to treat cowpeas of Jinfujian variety without converting into work all the time. Therefore, how to adopt a simple and rapid in-situ transformation method to improve the transformation rate of the cowpeas and successfully realize the transformation of certain specific varieties of cowpeas is a technical problem which is always eagerly solved but is not successful in the technical field.

Disclosure of Invention

Based on the method, the whole cowpea seed with completely exposed cotyledon nodes is used as a receptor, and after dip dyeing is carried out under the negative pressure condition, the dip dyed seed is cultivated in soil, so that the conversion rate can be obviously improved, the operation process is simplified, and the conversion period is shortened.

The technical scheme for solving the technical problems comprises the following steps:

a cowpea in-situ transformation method comprises the following steps:

accelerating germination of cowpea seeds until cotyledonary nodes are completely exposed to obtain a transformation receptor;

preparing a dip dyeing solution of agrobacterium tumefaciens containing an expression vector and a target gene;

soaking the conversion receptor in the dip dyeing solution for dip dyeing under the negative pressure condition;

transferring the infected transformation receptor into soil for cultivation, and screening positive plants in seedlings after two weeks.

In one embodiment, the agrobacterium is C58, the expression vector is pCAMBIA1300, and the target gene is Cry 1C.

In one embodiment, the dip OD₆₀₀The value is 0.6-0.8, the negative pressure is 0.06-0.08 MPa, and the dip-dyeing time is 60-150 s.

In one embodiment, the dip OD₆₀₀The value is 0.6-0.8, the negative pressure is 0.07-0.08 MPa, and the dip-dyeing time is 120 s.

In one example, the agrobacterium is GV3101, the expression vector is phelsgate 8, and the target gene is SUN.

In one embodiment, the agrobacterium is GV3101, the expression vector is phelsgate 8, and the target gene is GLK 2.

In one embodiment, the dip OD₆₀₀The value is 0.8, the negative pressure is 0.07MPa, and the dip-dyeing time is 150 s. In one embodiment, the cowpea variety is African cowpea.

In one embodiment, the seedling screening method is a PCR assay.

In one embodiment, the preparation process of the dip dyeing solution comprises the following steps:

activating the agrobacterium in an LB solid culture medium for 2-3 days, selecting a proper amount of thalli, adding the thalli into liquid LB with corresponding resistance, and culturing overnight to obtain agrobacterium liquid; and centrifuging the agrobacterium liquid for five minutes at 3500rpm, pouring out supernatant, then resuspending the collected thalli by using prepared IM solution, and placing for 1-3 hours at room temperature in a dark place to obtain a staining solution.

Has the advantages that:

1. the invention can realize the transformation of various expression vectors of Jinfu Lomenan cowpeas under the vacuum condition by strictly controlling the dip dyeing concentration, the dip dyeing time and the like; when the agrobacterium is C58, the expression vector is pCAMBIA1300, and the target gene is Cry1C, the transformation rate can reach 20 percent at most.

2. The invention has simple operation, and compared with the traditional tissue culture method, the invention avoids the complicated operations of co-culture, regenerated seedling induction, rooting induction and seedling hardening.

3. The operation period is short, the traditional tissue culture method can obtain seedlings only in at least two months, and the method can shorten the time to about 2 weeks.

4. The method has good economic benefit, the operating environment of the method does not need sterile environment, and the culture medium does not need to be frequently replaced, the seeds after dip-dyeing are directly transplanted into soil for cultivation, the cost is low, and the large-scale production is easier to realize.

Drawings

FIG. 1 shows the results of PCR analysis in example 1;

FIG. 2 shows the results of PCR analysis in example 2;

FIG. 3 shows the results of PCR analysis in example 3;

FIGS. 4-6 are the results of the PCR analysis of example 4;

FIG. 6 shows the results of PCR analysis in example 5;

FIG. 6 shows the results of PCR analysis in example 6;

FIGS. 7-8 are the results of the PCR analysis of example 7;

FIG. 9 shows the results of PCR analysis in example 8;

FIG. 10 is a comparison of the cultivated plants of example 1 with blank plants;

FIG. 11 is a comparison of the plants grown in example 3 with blank plants.

Detailed Description

The principles and features of this invention are described below in conjunction with the following drawings, which are set forth by way of illustration only and are not intended to limit the scope of the invention.

Example 1

Experimental materials used in this example: cowpea variety: jinfulinmen, Agrobacterium species: c58, expression vector: pCAMBIA1300, gene of interest: cry 1C. The embodiment provides a cowpea in-situ conversion method, which comprises the following steps:

s1, according to a conventional method, putting cowpea seeds in an incubator at 30 ℃ for pregermination for 2-3 days until cotyledonary nodes are completely exposed;

s2, activating agrobacterium strains with expression vectors and target genes in LB solid culture medium for 2-3 days, selecting appropriate amount of strains and adding the strains into liquid LB with corresponding resistance for overnight culture; the correspondingly resistant liquid is formed by adding kanamycin and rifampicin into LB liquid, and the final concentration of the kanamycin and the rifampicin is 100 mu l/ml respectively.

S3, centrifuging the bacterial liquid at 3500rpm for five minutes, pouring out the supernatant, then suspending and collecting the bacterial body by using the prepared IM solution, and preparing the bacterial body into OD₆₀₀0.8 of the value, standing at room temperature in the dark for 1-3h for later use, wherein the IM solution comprises 4.88g of 2-morpholine ethanesulfonic acid (MES),Glucose 2.5g, NaH₂PO₄0.126 g. The preparation method comprises the following steps: MES is first added into deionized water to regulate pH value to 5.6, and glucose and NaH are then added₂PO₄Stirring uniformly, fixing the volume to 475mL, and sterilizing at high temperature to obtain the product

S4, pouring the dip dyeing liquid prepared in the step S3 into a triangular flask, soaking the cowpea seeds obtained in the step S1 into the dip dyeing liquid, vacuumizing the triangular flask to the negative pressure of 0.08MPa, and dip dyeing for 120S under the vacuum condition;

and S5, transplanting the leaves into soil after dip dyeing, planting the leaves according to a conventional method, and taking young leaves for positive detection after two weeks.

The positive detection was performed by conventional PCR analysis: the sequence of the PCR amplification primer pUBI-Fw is shown as SEQ No. 1: 5 'CTTGGATGATGGCATATGC 3' (the sequence downstream of the promoter is designed as a forward detection primer); cry1C-Rv (SEQ. NO.2):5 'GAGGCTCCTGGTTAGCCTCT 3' (Cry1C gene midstream sequence is designed as reverse detection primer); the full length of the detection sequence is 1177 bp.

The Q-PCR primer of Cry1C has a fragment size of 199bp,

Cry1C-QF(SEQ.NO.3)：5’CAATCAGAACCAGTGTATCC 3’，

Cry1C-QR(SEQ.NO.4)：5’AGAAGGTCCAACGATTCC 3’，

the internal reference gene adopts cowpea UBC9 (ubiquitin gene 9) (SEQ. NO. 5-SEQ. NO.6), 5' -ACTCACTATCTCCAAGGTACT-3 and 5'-GCCAGCCATTCTTCAATATAC-3'.

After the PCR reaction, 5. mu.L of the amplified product was electrophoresed in 1% agarose gel, observed under a gel imaging system and photographed.

This example was cultivated to obtain T₀10 transgenic plants were generated. Positive detection was performed on all plants, resulting in 2 positive plants, labeled J358 and J359, with a 20% conversion rate.

Example 2

In this example, the procedure and test materials were the same as those in example 1 except that the cell concentration was different from that in example 1. The exhaust liquor OD of this example₆₀₀The value was 0.6.

This example was cultivated to obtain T₀Generating 20 transgenic plants, detecting to obtain 1 positive plant, marking as 0.6-2, and the transformation rate is 5%.

Example 3

The concentration of the disinfectant and the time for the dip dyeing in this example were different from those in example 1, and the procedure and the test materials were the same as those in example 1. The exhaust liquor OD of this example₆₀₀The value was 0.6 and the exhaust time was 150 s.

This example was cultivated to obtain T₀Transgenic plants 31 are generated, 3 positive plants are obtained by detection, marked as J321, J323 and J324, and the transformation rate is 10%.

Example 4

The concentration and negative pressure of the sterilizing medium in this example were different from those in example 1, and the procedure and test materials were the same as those in example 1. The example dye dip OD₆₀₀The value is 0.6 and the negative pressure is 0.07 MPa. This example was cultivated to obtain T₀Generating 21 transgenic plants, detecting to obtain 4 positive plants marked as J132, J139, J328 and J333, and the conversion rate is 19%.

Example 5

The concentration and negative pressure of the sterilizing medium in this example were different from those in example 1, and the procedure and test materials were the same as those in example 1. The example dye dip OD₆₀₀The value was 0.6 and the negative pressure was 0.06 MPa. This example was cultivated to obtain T₀Generating 12 transgenic plants, detecting to obtain 1 positive plant, marking as J334, with 8% conversion rate.

Example 6

The concentration of the disinfectant and the time for the dip dyeing in this example were different from those in example 1, and the procedure and the test materials were the same as those in example 1. The example dye dip OD₆₀₀The value was 0.6 and the exhaust time was 60 s.

This example was cultivated to obtain T ₀20 transgenic plants are generated, 1 positive plant is obtained by detection, the mark is J339, and the conversion rate is 5%.

Example 7

Experimental materials used in this example: cowpea variety: jinfulinmen, Agrobacterium species: GV3101, expression vector: pHellsgate8, target gene: SUN.

The embodiment provides a cowpea in-situ conversion method, which comprises the following steps:

s2, activating agrobacterium strains with expression vectors and target genes in an LB solid culture medium for 2-3 days, selecting a proper amount of strains, adding the strains into a liquid LB with corresponding resistance for overnight culture, wherein antibodies added into the LB solid culture medium are spectacular and rifampicin, and the concentrations are all 100 mu l/ml;

s3, centrifuging the bacterial liquid at 3500rpm for five minutes, pouring out the supernatant, suspending the collected bacterial body with the prepared IM solution, and preparing the bacterial body into OD₆₀₀Standing the dip dyeing solution with the value of 0.8 at room temperature in a dark place for 1-3h for later use; the composition of the IM solution was the same as in example 1.

S4, pouring the dip dyeing liquid prepared in the step S3 into a triangular flask, soaking the cowpea seeds obtained in the step S1 into the dip dyeing liquid, vacuumizing the triangular flask to the negative pressure of 0.07MPa, and dip dyeing for 150S under the vacuum condition;

The positive detection was performed by conventional PCR analysis: PCR amplification primer 35S (seq. No. 7): 5 'ACGCACAATCCCACTATCCTTC 3' of the composition,

Gate8-Rv(SEQ.NO.8)：5‘CGGTAAGGATCTGAGCTACACAT3’

This example was cultivated to obtain T₀Transgenic plants 101 were generated. And (3) carrying out positive detection on all the plants to obtain 3 positive plants, wherein the positive plants are marked as J458, J459 and J428, and the transformation rate is 3%.

Example 8

Experimental materials: cowpea variety: jinfu Lingmen; the agrobacterium strain: GV 3101; expression vector: pHellsgate8, target gene: GLK 2.

s2, activating agrobacterium strains with expression vectors and target genes in LB solid culture medium for 2-3 days, selecting appropriate strains and adding the strains into liquid LB with corresponding resistance for overnight culture, wherein the antibody added into the LB culture medium is. The concentrations of spectacular and rifampicin are both 100 mul/ml;

and S5, transplanting the plant in a flowerpot after dip dyeing, planting the plant according to a conventional method, and taking young leaves for positive detection after two weeks.

The positive detection was performed by conventional PCR analysis: PCR amplification primer 35S: 5 'ACGCACAATCCCACTATCCTTC 3' of the composition,

Gate8-Rv：5‘CGGTAAGGATCTGAGCTACACAT3’

This example was cultivated to obtain T₀88 transgenic plants were generated. And (3) carrying out positive detection on all the plants to obtain 1 positive plant, wherein the mark is J837, and the conversion rate is 1%.

Comparative example 1

In this comparative example, only the cell concentration was different from that in example 1, and the other steps and test materials were the same as those in example 1. The example dye dip OD₆₀₀The value was 1.0.

This example was cultivated to obtain T₀Transgenic plants 15 were generated, and positive plants were not obtained.

Comparative example 2

Comparative exampleThe cell concentration was different from that in example 1, and the other steps and test materials were the same as in example 1. The example dye dip OD₆₀₀The value was 1.2.

This example was cultivated to obtain T₀12 transgenic plants are generated, and positive plants are not obtained.

Comparative example 3

The comparative example shows a different concentration of the sterilizing agent and the different time for the impregnation than example 1, and the rest of the procedure and the test materials are the same as those of example 1. The example dye dip OD₆₀₀The value was 0.6 and the exhaust time was 30 s.

This example was cultivated to obtain T₀Transgenic plants 4 were generated, and no positive plants were obtained.

Comparative example 4

The comparative example shows a different concentration of the sterilizing agent and the different time for the impregnation than example 1, and the rest of the procedure and the test materials are the same as those of example 1. The example dye dip OD₆₀₀The value was 0.6 and the exhaust time was 90 s.

This example was cultivated to obtain T₀Transgenic plants 7 were generated, and positive plants were not obtained.

Comparative example 5

In this comparative example, only the cell concentration was different from that in example 1, and the other steps and test materials were the same as those in example 1. The example dye dip OD₆₀₀The value was 1.4.

This example was cultivated to obtain T₀Transgenic plants 14 were generated, and positive plants were not obtained.

Comparative example 6

The comparative example was different from example 1 in the concentration of the sterilizing agent and the negative pressure, and the other steps and the test materials were the same as those in example 1. The example dye dip OD₆₀₀The value was 0.6 and the negative pressure was 0.05 MPa.

Comparative example 7

The comparative example was different from example 1 in the concentration of the sterilizing agent and the negative pressure, and the other steps and the test materials were the same as those in example 1. The exhaust liquor OD of this example₆₀₀The value is 0.6 and the negative pressure is 0.09 MPa.

This implementationExample cultivation to obtain T₀5 transgenic plants are generated, and positive plants are not obtained.

The exhaust parameters of the examples and comparative examples are shown in Table 1.

TABLE 1 Dip dyeing parameters

	Dip dye OD₆₀₀Value of	Negative pressure/MPa	Dip dyeing time/s
				Example 1	0.8	0.08	120
Example 2	0.6	0.08	120
				Example 3	0.6	0.08	150
Example 4	0.6	0.07	120
				Example 5	0.6	0.06	120
Example 6	0.6	0.08	60
				Example 7	0.8	0.07	150
Example 8	0.8	0.07	150
				Comparative example 1	1.0	0.08	120
Comparative example 2	1.2	0.08	120
				Comparative example 3	0.6	0.08	30
Comparative example 4	0.6	0.08	90
				Comparative example 5	1.4	0.08	120
Comparative example 6	0.6	0.05	120
				Comparative example 7	0.6	0.09	120

The conversion of each example and comparative example is shown in table 2.

TABLE 2 conversion statistics Table

As can be seen from table 2, the conversion of example 1 is as high as 20%.

From tables 1 and 2, it can be seen that the dyebaths OD₆₀₀The value, the negative pressure and the dip dyeing time are synergistic, and the conversion rate of cowpea varieties is influenced. Only by strictly controlling the exhaust parameters can the conversion power be increased. Through a great deal of research, the inventor finds that when the OD600 value of the dip dyeing liquid is 0.6-0.8, the negative pressure intensity is 0.06-0.08 MPa, and the dip dyeing time is 60s-150And in the range of s, the conversion rate is higher.

FIGS. 1 to 9 show the results of the PCR analysis of examples 1 to 8, and the positive plants of each example are marked in the figures.

As can be seen from fig. 10 to 11, the padding process had no significant effect on the morphology of the cowpea plants.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

Sequence listing

<110> university of agriculture in Huazhong

<120> cowpea in-situ transformation method

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cttggatgat ggcatatgc 19

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gaggctcctg gttagcctct 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

caatcagaac cagtgtatcc 20

<210> 4

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

agaaggtcca acgattcc 18

<210> 5

<211> 21

<212> DNA

<213> cowpea (Vigna)

<400> 5

actcactatc tccaaggtac t 21

<210> 6

<211> 21

<212> DNA

<213> cowpea (Vigna)

<400> 6

gccagccatt cttcaatata c 21

<210> 7

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

acgcacaatc ccactatcct tc 22

<210> 8

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cggtaaggat ctgagctaca cat 23

Claims

1. The cowpea in-situ transformation method is characterized by comprising the following steps:

2. The cowpea in-situ transformation method according to claim 1, wherein the agrobacterium is C58, the expression vector is pCAMBIA1300, and the target gene is Cry 1C.

3. The cowpea in-situ conversion method according to claim 2, wherein the dip dyeing liquid OD₆₀₀The value is 0.6-0.8, the negative pressure is 0.06-0.08 MPa, and the dip-dyeing time is 60-150 s.

4. The cowpea in-situ conversion method according to claim 3, wherein the dip dyeing liquid OD₆₀₀The value is 0.6-0.8, the negative pressure is 0.07-0.08 MPa, and the dip-dyeing time is 120 s.

5. The cowpea in situ transformation method according to claim 1, wherein the agrobacterium is GV3101, the expression vector is phelsgate 8, and the target gene is SUN.

6. The cowpea in-situ transformation method according to claim 1, wherein the agrobacterium is GV3101, the expression vector is phelsgate 8, and the target gene is GLK 2.

7. Cowpea in situ conversion method according to claim 5 or 6, wherein the dip OD₆₀₀The value is 0.8, the negative pressure is 0.07MPa, and the dip-dyeing time is 150 s.

8. The cowpea in situ transformation method according to any one of claims 1-7, wherein the seedling screening method is PCR analysis.

9. A method of in situ conversion of cowpeas according to any one of claims 1 to 7, wherein the variety of cowpeas is African cowpeas.

10. The cowpea in-situ conversion method according to any one of claims 1 to 9, wherein the preparation process of the dip dyeing solution comprises the following steps:

activating the agrobacterium in an LB solid culture medium for 2-3 days, selecting a proper amount of thalli, adding the thalli into liquid LB with corresponding resistance, and culturing overnight to obtain agrobacterium liquid;

centrifuging the agrobacterium liquid for five minutes under the condition of 3500rpm, pouring out supernatant, then suspending the collected thalli by using prepared IM solution, diluting to the designed concentration, and standing at room temperature in a dark place for 1-3 hours to obtain a staining solution.