CN111218471A - Agrobacterium rhizogenes-mediated pumpkin root system transformation method and gene editing method - Google Patents
Agrobacterium rhizogenes-mediated pumpkin root system transformation method and gene editing method Download PDFInfo
- Publication number
- CN111218471A CN111218471A CN202010109866.1A CN202010109866A CN111218471A CN 111218471 A CN111218471 A CN 111218471A CN 202010109866 A CN202010109866 A CN 202010109866A CN 111218471 A CN111218471 A CN 111218471A
- Authority
- CN
- China
- Prior art keywords
- pumpkin
- root system
- seq
- agrobacterium rhizogenes
- gene editing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Developmental Biology & Embryology (AREA)
- Mycology (AREA)
- Immunology (AREA)
- Environmental Sciences (AREA)
- Virology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to an agrobacterium rhizogenes mediated pumpkin root system transformation method and a gene editing method, which realize the agrobacterium rhizogenes mediated pumpkin root system transformation for the first time through specific process steps, realize the gene editing of the transformed root system and facilitate the research on molecular biology and gene functions of pumpkins.
Description
Technical Field
The invention relates to the technical field of plants, in particular to an agrobacterium rhizogenes-mediated pumpkin root system transformation method and a gene editing method.
Background
The cucurbitaceae family is one of the most important edible plant families in the world, and comprises common vegetables and melons and fruits such as cucumbers, pumpkins, loofah, watermelons and the like. Wherein, the fruits, young stems and leaves and flowers of the pumpkin are edible, and have high nutritive value and certain health care function. Meanwhile, the pumpkin has the advantages of barren resistance, good stress resistance and the like, and can be used as a stock of other cucurbits such as watermelon, melon, cucumber and the like to solve the problems of continuous cropping obstacle and the like.
However, at present, no report is provided for pumpkin root system transformation, which is not beneficial to promoting research on pumpkin molecular biology and gene function.
Disclosure of Invention
Therefore, the agrobacterium rhizogenes-mediated pumpkin root system transformation method and the gene editing method are needed to be provided, the pumpkin root system transformation is realized for the first time, and the research on molecular biology and gene functions of pumpkins is facilitated.
The technical scheme for solving the technical problems is as follows:
the invention provides a method for transforming a pumpkin root system mediated by agrobacterium rhizogenes, which comprises the following steps:
obtaining an explant containing a cotyledon base and an embryonic axis connecting section;
soaking the explant with an infecting liquid containing agrobacterium rhizogenes Ar-qual, placing the soaked explant in a co-culture medium, co-culturing at the temperature of 23 +/-2 ℃ under a dark condition, and soaking to obtain the infected explant;
transferring the infected explant to rooting culture medium at light intensity of 100 +/-10 mu mol/m2/s2Culturing for 8-10 days under the conditions of 14 +/-0.5 h/10 +/-0.5 h photoperiod and 25 +/-3 ℃ of temperature, picking out a rooting explant, removing a first batch of new roots on the rooting explant, placing the rooting explant in a fresh rooting culture medium and continuously culturing under the same external environmental condition until a second batch of new roots grow, and obtaining the pumpkin tissue culture seedling with the transformed roots.
Preferably, the co-culture medium is an MS culture medium containing 100 μ M acetosyringone, 3% sucrose and 0.7% agar; the rooting medium is an MS medium containing 1% of sucrose, 200mg/L of TMT and 0.3% of plant gel.
In one embodiment, the agrobacterium rhizogenes-mediated transformation method for the pumpkin root system further comprises a seedling hardening step of the pumpkin tissue culture seedling:
planting the pumpkin tissue culture seedling with the transformed root system in a hole tray filled with sterilized river sand and sealed by a transparent plastic cover at the light intensity of 100 +/-10 mu mol/m2/s2Continuously culturing for 3-5 days under the conditions of a photoperiod of 14 +/-0.5 h/10 +/-0.5 h and a temperature of 25 +/-3 ℃, ventilating and continuously culturing to obtain the robust pumpkin seedlings with the transformed root systems.
In one embodiment, the step of obtaining an explant comprising a cotyledon base and an embryonic axis connecting section is:
selecting plump pumpkin seeds, sterilizing, placing in a tissue culture bottle added with a 1/2MS culture medium containing sucrose, accelerating germination at 28 +/-5 ℃ until the embryonic axis extends, culturing under the illumination condition until the cotyledon turns green, taking out, and cutting.
In one embodiment, the steps of selecting full pumpkin seeds and sterilizing are as follows: soaking pumpkin seeds in hot water of 55 +/-5 ℃ for 2-4h, removing seed shells, sterilizing the seeds with sodium hypochlorite solution, and washing with sterile water to obtain kernels separated from seed coats.
Furthermore, the agrobacterium rhizogenes Ar-qual also contains a vector pCAMBIA1305.4 carrying two sets of marker genes of GUS and GFP.
The invention also provides a pumpkin root system gene editing method, which comprises the following steps:
preparing a gene editing vector containing a sgRNA sequence by using a vector pKSE402 containing a Cas9 protein and a sgRNA expression frame, transforming escherichia coli, and extracting a pKSE402 plasmid of a positive strain;
constructing agrobacterium rhizogenes Ar-qual containing pKSE402 plasmid;
and carrying out pumpkin root system transformation according to the agrobacterium rhizogenes-mediated pumpkin root system transformation method to obtain pumpkin seedlings with gene editing root systems.
Preferably, the sgRNA sequence is NACsgRNA, rbosgrna or NHXsgRNA against cmoch01g014300.1, cmoch14g010850.1, cmoch 10g011690.1.
In one embodiment, the sequences of primer pairs for the enzyme digestion ligation system corresponding to the NACGRNA are respectively shown as SEQ ID No.1 and SEQ ID No. 2;
the sequences of primer pairs for an enzyme digestion connection system corresponding to the RBOHSgRNA are respectively shown as SEQ ID NO.3 and SEQ ID NO. 4;
the sequences of the primer pair for the enzyme digestion connection system corresponding to the NHXsgRNA are respectively shown as SEQ ID NO.5 and SEQ ID NO. 6.
In one embodiment, the method for editing the pumpkin root system gene further comprises the steps of editing a gene editing vector containing NACsgRNA to obtain a pumpkin seedling, wherein PCR primer pairs used for identifying the pumpkin seedling are respectively shown as SEQ ID No.12 and SEQ ID No. 13;
PCR primer pairs used for identifying the pumpkin seedlings obtained by editing the gene editing vector containing the RBOHSRNA are respectively shown as SEQ ID NO.14 and SEQ ID NO. 15.
PCR primer pairs used for identifying the pumpkin seedlings obtained by editing the gene editing vector containing NHXsgRNA are respectively shown as SEQ ID NO.16 and SEQ ID NO. 17.
The invention has the beneficial effects that:
the invention realizes the first time of utilizing agrobacterium rhizogenes to mediate the transformation of the pumpkin root system by screening specific process conditions, realizes the gene editing of the transformed root system, and is convenient for promoting the research of molecular biology and gene function of the pumpkin.
Drawings
FIG. 1 map of vector pKSE 402;
FIG. 2 map of vector pCAMBIA1305.4;
FIG. 3 is a graph of key nodes for tissue culture of the hairy root system of Cucurbita pepo in example 3;
FIG. 4 is a photograph showing the root system of a pumpkin seedling in example 3, wherein A is a comparative GFP fluorescence photograph, C is the expression of GUS gene, and B is a GUS staining photograph;
fig. 5 is an editorial test chart of the pumpkin seedling root system of example 4.
Detailed Description
The present invention is described below by way of example, which is only for the purpose of explaining the present invention and is not intended to limit the scope of the present invention.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
Sources of materials
The vector pKSE402 for gene editing is from the Huang-san-Wen subject group of Chinese academy of agricultural sciences, the map is shown in figure 1, the vector pKSE402 contains Cas9 protein and sgRNA expression cassettes, the vector pKSE401 is modified on the basis of pKSE, eGFP is inserted, an eGFP sequence is expressed and translated to generate green fluorescent protein when the vector is successfully transferred into a plant cell, fluorescence emitted by the eGFP can be seen through a fluorescent microscope, and further the light emitting condition of the eGFP can be seen under the condition of living bodies and no harm to plants, and a cell line or a plant which is successfully converted is screened. The vector can be provided to the public of society for 20 years.
The vector pCAMBIA1305.4 for gene overexpression is from the yellow-third language subject group of Chinese academy of agricultural sciences, the map is shown in figure 2, the vector contains two sets of marker genes of GUS and GFP driven by a 35S promoter, and the vector can be used for exogenous gene overexpression of a rooting system and used for screening cell lines or plants successfully transformed. The vector can be provided to the public of society for 20 years.
The test material was "green ground" pumpkin rootstock.
Agrobacterium rhizogenes Ar-qual, purchased from Shanghai, the only living being.
Escherichia coli Trans5 α, purchased from Beijing, all-Trans gold.
Example 1
The embodiment provides an Agrobacterium rhizogenes Ar-qual strain containing pCAMBIA1305.4, the construction method refers to an Ar-qual use instruction, the transformation method is a liquid nitrogen freeze-thaw method, and the successfully transformed Agrobacterium rhizogenes Ar-qual strain is stored at the temperature of minus 80 ℃.
Example 2
The embodiment provides a method for constructing an agrobacterium rhizogenes Ar-qual strain containing a gene editing vector, which comprises the following steps:
s1, downloading each target gene genome sequence from a cucurbitaceae genome database (http:// curbitangenomics. org /) aiming at genes ID CmoCh10G011690.1, CmoCh14G011690.1 and CmoCh01G014300.1 respectively, then submitting the sequences to a Geneious software, marking out exons and introns, selecting a genome file, running a program to obtain a sgRNA sequence set, and selecting the sgRNA sequence which is positioned on the exons and has the highest score.
sgRNA primer pairs shown in table 1 below were obtained according to the sequence design:
table 1 sgRNA primer pair sequences
Sending each sgRNA primer pair to a primer synthesis company (Beijing, Ongji) for synthesis.
Annealing the synthesized primer pair, and configuring a primer annealing reaction system according to the following table 2:
TABLE 2 reaction System
| Composition (I) | Concentration of | Volume of |
| sgRNA-F | 100μM | 1.5μL |
| sgRNA-R | 100μM | 1.5μL |
| 10x NEB buffer | 3.1 | 5μL |
| ddH20 | - | 42μL |
And placing the uniformly mixed reaction solution in hot water at 95 ℃ for natural cooling to room temperature to obtain the annealing primer.
S3, after the annealing is finished, carrying out carrier connection according to the reaction system shown in the following table 3 and the reaction procedure shown in the following table 4 to obtain a connection product:
TABLE 3 restriction ligation System
| Annealing primer | 1μL |
| Vector pKSE402(200ng) | 1μL |
| 10xNEB T4 Buffer | 1μL |
| 10xBSA | 1μL |
| BsaI(NEB) | 1μL |
| T4 Ligase(NEB) | 1μL |
| ddH20 | 4μL |
| Total volume | 10μL |
TABLE 4 reaction procedure
| Reaction temperature | Reaction time |
| 37℃ | 5h |
| 50℃ | 5min |
| 80℃ | 10min |
S4, respectively transforming each ligation product into Escherichia coli Trans5 α (Beijing, all-open gold), specifically referring to a Trans5 α application instruction, and carrying out colony PCR identification (identifying primer U626-IDF: TGTCCCAGGATTAGAATGATTAGGC (SEQ IN NO.7) and corresponding sgRNA-R sequence) after a single clone grows out.
And (4) sending the bacterial liquid with positive identification result to a sequencing company for sequencing analysis, and culturing and extracting the bacterial strain with correct sequencing result.
S5, respectively transforming Agrobacterium rhizogenes Ar-qual (Shanghai, solitary organisms) with pKSE402 plasmids containing NACGRNA, RBOHGRNA and NHXsgRNA, wherein the transformation method is a liquid nitrogen freeze thawing method, and specifically, the Agrobacterium rhizogenes Ar-qual strain containing NACGRNA single-gene editing vectors, the Agrobacterium rhizogenes Ar-qual strain containing RBOHGRNA single-gene editing vectors and the Agrobacterium rhizogenes Ar-qual strain containing NHXsgRNA single-gene editing vectors are respectively obtained by referring to Ar-qual application instructions.
Example 3
As shown in fig. 3, this embodiment provides a method for agrobacterium rhizogenes-mediated transformation of a pumpkin root system, including the following steps:
(1) selecting full pumpkin seeds for sterilization:
selecting full and healthy pumpkin seeds, soaking in hot water at 55 ℃ for 2-4h, then washing with clear water, removing seed shells, then transferring to an ultra-clean workbench for operation, transferring the seed shells removed seeds to a sterilized triangular flask, adding 75% alcohol for sterilization for 1min, then pouring off the alcohol, and sterilizing with sterilized ddH2And O, washing the seeds once, pouring out the sterilized water, sterilizing the seeds by using a 0.3% sodium hypochlorite (used at present) solution, washing the seeds by using the sterilized water to completely separate the seed coats from the kernels, and pouring out the water to obtain the kernels separated from the seed coats.
(2) Obtaining explants comprising cotyledon base and embryonic axis connecting sections
As shown in FIGS. 3(A) - (E), the sterilized kernels are transferred to tissue culture bottles added with solid culture medium (1/2 MS culture medium containing sucrose), 8-10 strains are cultured in each bottle, the bottles are covered with covers, the tissue culture bottles are transferred to an incubator at 28 ℃ for dark culture for 3-5 days, and then transferred to a tissue culture room (culture environment: light intensity of 100 mu mol/m)2/s2Culturing in light cycle of 14h/10h at 25 deg.C for 2-3 days, and turning cotyledon to green. And transferring the tissue culture bottle to a superclean bench, cutting the pumpkin plantlets from the basal part of the cotyledon node by using a sterilized scalpel, transferring the pumpkin plantlets to a culture dish filled with sterilized filter paper for further cutting, removing most cotyledons, only keeping one third of cotyledons at the basal part, removing most hypocotyls, only keeping hypocotyls with the length of 0.3-0.5cm, and taking out to obtain the explant containing the basal part of the cotyledons and the hypocotyls connecting sections. Explants were transferred to the staining solution (MS medium containing 100. mu.M acetosyringone and 3% sucrose) for wetting.
(3) Infecting explants
The Agrobacterium rhizogenes Ar-qual strain of example 1 containing pCAMBIA1305.4 was thawed on ice and 100. mu.L was added to an Erlenmeyer flask containing 50mL of fresh TY medium (supplemented with 50mg/L kanamycin and 25mg/L gentamicin) and sealed. The sealed Erlenmeyer flasks were transferred to a shaker for overnight culture under the following conditions: 200rpm/min, 28 ℃. When the bacterial liquid is turbid, taking out a part of the bacterial liquid, measuring the concentration (OD600 value) of the bacterial liquid by using a spectrophotometer, calculating the volume of the added bacterial liquid according to the concentration of the bacterial liquid and the total volume of the infection liquid, and keeping the OD600 value of the infection liquid to be about 0.05. Adding the explant into the infection solution, and sealing. Transferring the sealed conical flask to a shaking bed for dip dyeing for 20min, wherein the conditions are as follows: 200rpm/min, 28 ℃. Then pouring off the staining solution, transferring the explant to a co-culture medium (MS culture medium containing 100 mu M acetosyringone, 3% sucrose and 0.7% agar) padded with two layers of sterilization filter paper, co-culturing for 2 days at 23 ℃ in the dark, transferring the explant to a sterilization conical flask after co-culturing is finished, washing with sterilization water for 5 times, pouring off water, then sucking off the water on the explant by using the sterilization filter paper, and finishing infection to obtain the infected bacterium explant.
As shown in FIGS. 3(F) - (I), the water-blotted explants were transferred to rooting medium (MS medium containing 1% sucrose, 200mg/L TMT and 0.3% plant gel) with the hypocotyls inserted downwards at 100. + -. 10. mu. mol/m light intensity2/s2Culturing for 8-10 days at 25 ℃ and with the photoperiod of 14 +/-0.5 h/10 +/-0.5 h, observing the growth condition of the root system at the hypocotyl part, picking out the rooted explants, and completely removing all the first batch of grown root systems (called as 'first batch of new root systems') by using sterilized tweezers. The step is a key step, the majority of the root systems grown in the first batch are false positive root systems, and the growth of the transformed root systems can be promoted after the root systems are removed.
And then, inserting the hypocotyl of the explant downwards into a fresh rooting culture medium again, continuously culturing for 8-10 days under the same external environmental condition, observing the growth condition of a GFP (green fluorescent protein) fluorescent root system in the tissue culture bottle by using a stereoscopic fluorescence microscope, opening the tissue culture bottle when the transformed root system grows to about 1-2cm, hardening the seedling to obtain a tissue culture seedling containing the transformed root system, and preparing for transferring the tissue culture seedling into a substrate for culture.
(4) Root culture of pumpkin tissue culture seedling
And (2) taking the tissue culture seedling containing the transformed root system out of the solid culture medium gently, cutting the root system without breaking, transferring to a faucet, washing the root system with clear water, removing agar blocks adhered to the root system, transferring the cleaned tissue culture seedling to a stereoscopic microscope, and cutting off the root system which does not fluoresce by using scissors and keeping the root system which has green fluorescence to obtain the trimmed pumpkin transformed seedling as shown in figure 4A.
Adding water into sterilized river sand, stirring, placing into a tray, loosening, planting the pumpkin seedlings in river sand, sealing the tray with transparent plastic cover, maintaining the high temperature and high humidity state, transferring the planted pumpkin seedlings to a phytotron (light intensity 100 μmoL/m)2/s2Culturing at 25 deg.C in photoperiod of 14h/10h, gradually opening vent hole for ventilation after 3-5 days, removing plastic cover after one week, and culturing normally. Transplanting for about 2 weeks, after the seedlings grow robustly, pulling out the seedlings from sandy soil, checking the growth condition of the transformed root system, and obtaining the transformed pCAMBIA1305.4 pumpkin seedling root system with good growth.
(5) Detection of transformed pCAMBIA1305.4 pumpkin plant root system
Selecting a pumpkin transformation seedling which grows well, removing the pumpkin transformation seedling from a matrix, completely washing root system sandy soil under a tap, avoiding hurting the root system in the whole process, checking the GFP (green fluorescent protein) luminescence condition of the root system by using a body type fluorescence microscope, selecting a pumpkin seedling with a good luminescence root system, using one pumpkin seedling as GUS (glucuronidase) dyeing, using the other pumpkin seedling as an extraction RNA (ribonucleic acid) for reverse transcription to obtain cDNA (complementary deoxyribonucleic acid), and using the cDNA as a template for PCR (polymerase chain reaction) identification. The PCR identification takes GUS gene as a detection gene and pumpkin ACTIN as an internal reference, and the primer sequences are as follows:
GUSq-F：5’-AGGTGGTTGCAACTGGACAA-3’(SEQ ID NO.8)
GUSq-R：5’-CGCAAGTCCGCATCTTCATG-3’(SEQ ID NO.9)
ACTIN-F：5’-CTGGACTCTGGTGATGGTGT-3’(SEQ ID NO.10)
ACTIN-R：5’-CGTTCAGCAGTGGTTGTGAA-3’(SEQ ID NO.11)
the PCR identification result is shown in FIG. 4C, which shows that GUS gene is successfully introduced into the root system of pumpkin seedling.
Further performing GUS staining on root systems. Firstly, 20mL of staining solution is added into a 50mL centrifuge tube, then the root system of the pumpkin seedling is cut from the stem base part, the excessive water of the root system is sucked by absorbent paper and then is put into GUS staining solution, and the centrifuge tube is put into a centrifuge for 5min at 5000rpm/min to promote the root system to be fully contacted with the GUS staining solution. After centrifugation, the centrifuge tube was placed in an incubator at 37 ℃ for 12 hours, after the staining was completed, the staining solution was poured off, the tube was washed 3 to 5 times with tap water, drained, and decolorized by adding 95% alcohol, and the results are shown in fig. 4B, which shows that the root systems of three selected pumpkins (OE1, OE2, and OE3) were well stained blue, as compared with the wild type pumpkins (WT), indicating that the GUS gene was successfully expressed.
Example 4
The embodiment provides a pumpkin root system gene editing method, which adopts the same transformation steps as the embodiment 3, and obtains a transformed pKSE402 pumpkin plant root system by respectively transforming the pumpkin root system with the three agrobacterium rhizogenes Ar-qual strains containing single gene editing vectors obtained in the embodiment 2.
Further detection of the root system edition of the transformed pKSE402 pumpkin plant comprises the following specific steps:
a system fluorescence microscope is used for observing the GFP (green fluorescent protein) luminescence condition of the root system, the root system which grows robustly and has strong fluorescence signals is selected and immediately placed in liquid nitrogen for quick freezing, then the root system is ground into powder, and the CTAB method is used for extracting the genome DNA.
Http:// cucurbitugenmics.org/downloading the genome sequence of a target gene on a cucurbitaceae genome database, designing gene editing and identifying primers on the upstream and downstream of a gene editing site by about 200bp by using primer3plus webpage software, wherein the sequences of primer pairs are respectively as follows:
NACed-F：5’-GCCGTAAATGTGCATCGCAT-3’(SEQ ID NO.12)
NACed-R：5’-CGAATTAGCGAGCCGGTACT-3’(SEQ ID NO.13)
RBOHD-F：5’-TTCGGACGCAGATGGAAGAA-3’(SEQ ID NO.14)
RBOHD-R：5’-TTAGAACTCGGCTGTCGCTC-3’(SEQ ID NO.15)
NHX-F：5’-AGCAGGGCACACTCAACTAC-3’(SEQ ID NO.16)
NHX-R：5’-CCTTTCGGTTGGCGATCCT-3’(SEQID NO.17)
respectively using the primer pair and the extracted genome DNA as templates, performing PCR amplification by using High-Fidelity enzyme 2 x High-Fidelity Master Mix (Tsingke, China), connecting a T vector after obtaining a PCR product, transforming escherichia coli competence, and sending the product to Beijing Optimalaceae New Biotechnology Limited for sequencing.
And after obtaining the sequencing result, comparing and analyzing the sequencing result by utilizing Geneius software, and identifying the editing condition of the gene editing site.
As shown in fig. 5, the identification result indicates that sgRNA successfully mediates the editing of Cas9 protein on pumpkin genome DNA, and a gene-edited pumpkin root system is successfully obtained.
Through a large number of researches, the invention utilizes agrobacterium rhizogenes Ar-qual of a transformation plant expression vector pCAMBIA1305.4 as an infecting agrobacterium for the first time, and can establish a high-efficiency rooting genetic transformation system of pumpkin.
The invention firstly utilizes pKSE402 as a gene editing vector, designs sgRNAs of different genes through Geneius software, successfully constructs the sgRNAs onto the pKSE402 vector, and successfully transforms the corresponding pKSE402 vector into Agrobacterium rhizogenes Ar-qual.
The established pumpkin rooting conversion system is utilized, and the pumpkin is infected by agrobacterium rhizogenes Ar-qual containing different sgRNA gene editing vectors pKSE402, so that the pumpkin conversion root system with gene editing is successfully obtained, and the research on the molecular biology and the gene function of the pumpkin is facilitated.
The technical features of the above embodiments can be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the above embodiments are not described, but should be considered as the scope of the present specification as long as there is no contradiction between the combinations of the technical features.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.
Sequence listing
<110> university of agriculture in Huazhong
<120> agrobacterium rhizogenes-mediated pumpkin root system transformation method and gene editing method
<160>17
<170>SIPOSequenceListing 1.0
<210>1
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
attgtggtac ttctttacgc cga 23
<210>2
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
aaactcggcg taaagaagta cca 23
<210>3
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
attggatgta ccctgcattt cca 23
<210>4
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
aaactggaaa tgcagggtac atc 23
<210>5
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
attgcatgct ggtcgtgagt ttc 23
<210>6
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
aaacgaaact cacgaccagc atg 23
<210>7
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
tgtcccagga ttagaatgat taggc 25
<210>8
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
aggtggttgc aactggacaa 20
<210>9
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
cgcaagtccg catcttcatg 20
<210>10
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
ctggactctg gtgatggtgt 20
<210>11
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
cgttcagcag tggttgtgaa 20
<210>12
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
gccgtaaatg tgcatcgcat 20
<210>13
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>13
cgaattagcg agccggtact 20
<210>14
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>14
ttcggacgca gatggaagaa 20
<210>15
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>15
ttagaactcg gctgtcgctc 20
<210>16
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>16
agcagggcac actcaactac 20
<210>17
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>17
cctttcggtt ggcgatcct 19
Claims (10)
1. An agrobacterium rhizogenes mediated pumpkin root system transformation method is characterized by comprising the following steps:
obtaining an explant containing a cotyledon base and an embryonic axis connecting section;
soaking the explant with an infecting liquid containing agrobacterium rhizogenes Ar-qual, placing the soaked explant in a co-culture medium, co-culturing at the temperature of 23 +/-2 ℃ under a dark condition, and soaking to obtain the infected explant;
transferring the infected explant to rooting culture medium at light intensity of 100 +/-10 mu mol/m2/s2Culturing for 8-10 days under the conditions of 14 +/-0.5 h/10 +/-0.5 h photoperiod and 25 +/-3 ℃ of temperature, picking out a rooting explant, removing a first batch of new roots on the rooting explant, placing the rooting explant in a fresh rooting culture medium and continuously culturing under the same external environmental condition until a second batch of new roots grow, and obtaining the pumpkin tissue culture seedling with the transformed roots.
2. The agrobacterium rhizogenes-mediated pumpkin root system transformation method according to claim 1, wherein the co-culture medium is an MS medium containing 100 μ M acetosyringone, 3% sucrose and 0.7% agar; and/or
The rooting medium is an MS medium containing 1% of sucrose, 200mg/L of TMT and 0.3% of plant gel.
3. The agrobacterium rhizogenes-mediated pumpkin root system transformation method according to claim 1, further comprising the step of hardening the pumpkin tissue culture seedling:
planting the pumpkin tissue culture seedling with the transformed root system in a hole tray filled with sterilized river sand and sealed by a transparent plastic cover at the light intensity of 100 +/-10 mu mol/m2/s2Continuously culturing for 3-5 days under the conditions of a photoperiod of 14 +/-0.5 h/10 +/-0.5 h and a temperature of 25 +/-3 ℃, ventilating and continuously culturing to obtain the robust pumpkin seedlings with the transformed root systems.
4. The agrobacterium rhizogenes-mediated pumpkin root system transformation method according to claim 1, wherein the step of obtaining the explant comprising the cotyledon base and the embryonic axis connecting section comprises:
selecting plump pumpkin seeds, sterilizing, placing in a tissue culture bottle added with a 1/2MS culture medium containing sucrose, accelerating germination at 28 +/-5 ℃ until the embryonic axis extends, culturing under the illumination condition until the cotyledon turns green, taking out, and cutting.
5. The agrobacterium rhizogenes-mediated pumpkin root system transformation method of claim 4, wherein the step of selecting filled pumpkin seeds for sterilization comprises the following steps: soaking pumpkin seeds in hot water of 55 +/-5 ℃ for 2-4h, removing seed shells, sterilizing the seeds with sodium hypochlorite solution, and washing with sterile water to obtain kernels separated from seed coats.
6. The agrobacterium rhizogenes-mediated transformation method for the pumpkin roots according to any one of claims 1 to 5, wherein the agrobacterium rhizogenes Ar-qual further comprises a vector pCAMBIA1305.4 carrying two sets of marker genes of GUS and GFP.
7. A pumpkin root system gene editing method is characterized by comprising the following steps:
preparing a gene editing vector containing a sgRNA sequence by using a vector pKSE402 containing a Cas9 protein and a sgRNA expression frame, transforming escherichia coli, and extracting a pKSE402 plasmid of a positive strain;
constructing agrobacterium rhizogenes Ar-qual containing pKSE402 plasmid;
the method for pumpkin root system transformation mediated by agrobacterium rhizogenes according to any one of claims 1 to 4, wherein pumpkin root system transformation is carried out to obtain pumpkin seedlings with gene editing root systems.
8. The method for editing a pumpkin root gene according to claim 7, wherein the sgRNA sequence is NACsgRNA, RBOHSgRNA or NHXsgRNA directed to CmoCh01G014300.1, CmCh14G010850.1 or CmCh10G011690.1.
9. The pumpkin root system gene editing method according to claim 8, wherein sequences of primer pairs for an enzyme digestion connection system corresponding to the NACGRNA are respectively shown as SEQ ID No.1 and SEQ ID No. 2;
the sequences of primer pairs for an enzyme digestion connection system corresponding to the RBOHSgRNA are respectively shown as SEQ ID NO.3 and SEQ ID NO. 4;
the sequences of the primer pair for the enzyme digestion connection system corresponding to the NHXsgRNA are respectively shown as SEQ ID NO.5 and SEQ ID NO. 6.
10. The pumpkin root system gene editing method according to claim 8 or 9, further comprising the steps of editing a gene editing vector containing NACGRNA to obtain a pumpkin seedling, wherein PCR primer pairs used for identifying the pumpkin seedling are respectively shown as SEQ ID No.12 and SEQ ID No. 13;
PCR primer pairs adopted for identifying the pumpkin seedlings obtained by editing the gene editing vector containing the RBOHsgRNA are respectively shown as SEQ ID NO.14 and SEQ ID NO. 15;
PCR primer pairs used for identifying the pumpkin seedlings obtained by editing the gene editing vector containing NHXsgRNA are respectively shown as SEQ ID NO.16 and SEQ ID NO. 17.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010109866.1A CN111218471A (en) | 2020-02-23 | 2020-02-23 | Agrobacterium rhizogenes-mediated pumpkin root system transformation method and gene editing method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010109866.1A CN111218471A (en) | 2020-02-23 | 2020-02-23 | Agrobacterium rhizogenes-mediated pumpkin root system transformation method and gene editing method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111218471A true CN111218471A (en) | 2020-06-02 |
Family
ID=70829848
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010109866.1A Pending CN111218471A (en) | 2020-02-23 | 2020-02-23 | Agrobacterium rhizogenes-mediated pumpkin root system transformation method and gene editing method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111218471A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002014523A2 (en) * | 2000-08-11 | 2002-02-21 | Syngenta Participations Ag | Methods for stable transformation of plants |
| KR20020067303A (en) * | 2001-02-16 | 2002-08-22 | 주식회사 싸이젠하베스트 | Efficient method for the development of transgenic plants by gene manipulation |
| CN101322475A (en) * | 2008-08-07 | 2008-12-17 | 山东省农业科学院蔬菜研究所 | Method for obtaining regeneration plant from in-vitro culture of black seed pumpkin |
| CN106967728A (en) * | 2017-04-13 | 2017-07-21 | 华中农业大学 | A kind of pumpkin adversity gene CmNAC1 and its application |
| CN108368517A (en) * | 2015-10-30 | 2018-08-03 | 先锋国际良种公司 | Method and composition for quick-speed plant conversion |
-
2020
- 2020-02-23 CN CN202010109866.1A patent/CN111218471A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002014523A2 (en) * | 2000-08-11 | 2002-02-21 | Syngenta Participations Ag | Methods for stable transformation of plants |
| KR20020067303A (en) * | 2001-02-16 | 2002-08-22 | 주식회사 싸이젠하베스트 | Efficient method for the development of transgenic plants by gene manipulation |
| CN101322475A (en) * | 2008-08-07 | 2008-12-17 | 山东省农业科学院蔬菜研究所 | Method for obtaining regeneration plant from in-vitro culture of black seed pumpkin |
| CN108368517A (en) * | 2015-10-30 | 2018-08-03 | 先锋国际良种公司 | Method and composition for quick-speed plant conversion |
| CN106967728A (en) * | 2017-04-13 | 2017-07-21 | 华中农业大学 | A kind of pumpkin adversity gene CmNAC1 and its application |
Non-Patent Citations (2)
| Title |
|---|
| 孙静宇: "南瓜CmHKT1;1提高黄瓜嫁接苗耐盐性的机理及相关microRNAs鉴定", 《中国优秀博硕士学位论文全文数据库(博士) 农业科技辑》 * |
| 韦尚政: "《豪猪家养技术》", 31 May 2017, 湖南科学技术出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2019297209B2 (en) | Method of obtaining multi-leaf alfalfa material by means of MsPALM1 artificial site-directed mutant | |
| CN113265421B (en) | Method for establishing agrobacterium-mediated shortstem ephedra stem callus transgenic system | |
| CN117187294B (en) | Application of BnaC5.ACBP4 gene in improving flooding resistance of plants | |
| CN104770294A (en) | Breeding method using protocorm based on germinated phalaenopsis seeds as receptor | |
| US11365423B2 (en) | Method of obtaining multileaflet Medicago sativa materials by means of MsPALM1 artificial site-directed mutants | |
| CN111635904B (en) | Gene CsWRKY10 for enhancing cucumber target spot disease resistance and application thereof | |
| CN111876439B (en) | High-efficiency genetic transformation method for agrobacterium-mediated vacuum infection of pigeon pea | |
| CN110305894B (en) | Rapid and efficient catalpa bungei genetic transformation method | |
| CN116355951B (en) | Construction method of melon VIGS silencing system based on bud vacuum infection | |
| CN109536513B (en) | Chinese cabbage pistil development related gene BrCRF11a and application thereof | |
| CN109852634A (en) | A method of cultivating high nodulation and nitrogen fixation genetically modified plants | |
| KR20100053456A (en) | A method for producing transformed rice plant removed selection marker | |
| CN111218471A (en) | Agrobacterium rhizogenes-mediated pumpkin root system transformation method and gene editing method | |
| CN106754970A (en) | A kind of method for cultivating the type of resistance to bolting romaine lettuce by controlling LsFT genes | |
| CN113337534A (en) | Tissue culture method for improving genetic transformation efficiency of petunia hybrida | |
| CN113215191A (en) | Agrobacterium-mediated genetic transformation method for toona sinensis | |
| CN110885852A (en) | Method for efficiently inducing formation of transgenic hairy roots of bottle gourds | |
| CN118006674B (en) | Application of RcWUS gene in regulation of China rose regeneration | |
| CN113652434B (en) | Gorgon fruit DNA molecule with function of promoting rice grain enlargement and application thereof | |
| CN116334101B (en) | Corn sterol content regulating gene ZmSCYL2 and application thereof | |
| CN114540367B (en) | Application of soybean GmPRR3b gene in regulation and control of soybean drought resistance | |
| CN114958904B (en) | Method for rapidly obtaining radish transgenic material | |
| CN102428873A (en) | Method for inducing adventitious buds of hybrid eucalyptus isolated organs through callus tissue differentiation | |
| CN109762833B (en) | Leymus mutabilis phenylalanine ammonia lyase gene and application thereof | |
| JPWO2007064037A1 (en) | Methods for transformation of Araceae plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200602 |