CN113322274B

CN113322274B - Method for rapidly realizing sweet potato transgenosis

Info

Publication number: CN113322274B
Application number: CN202110705309.0A
Authority: CN
Inventors: 侯兴亮; 刘旭; 王亚如
Original assignee: South China Botanical Garden of CAS
Current assignee: South China Botanical Garden of CAS
Priority date: 2021-06-24
Filing date: 2021-06-24
Publication date: 2023-03-31
Anticipated expiration: 2041-06-24
Also published as: CN113322274A

Abstract

The invention discloses a method for rapidly realizing sweet potato transgenosis. Injecting the agrobacterium tumefaciens bacterial liquid containing the target gene expression vector into the 1 st, 2 nd or 3 rd nodes of the sweet potatoes in the 4-6 leaf stage, then cultivating, and detecting to obtain the sweet potato transgenic plant or tissue containing the target gene. Compared with the traditional crossbreeding and tissue culture, the method not only solves the problems of incompatibility of interspecific crossbreeding, low regeneration frequency, larger difference of regeneration capacity among varieties and the like, but also greatly shortens the genetic transformation and breeding period of the sweet potatoes. The invention can introduce target genes or specific DNA segments into sweet potato tissues, quickly and efficiently obtain transformed sweet potato seedlings, improve the characteristics and resistance which the existing sweet potato varieties do not have, and realize the great improvement of the sweet potato varieties.

Description

Method for rapidly realizing sweet potato transgenosis

The technical field is as follows:

the invention relates to the technical field of plants, in particular to a method for quickly realizing sweet potato transgenosis.

Background art:

sweet potatoes are important economic crops and food crops in the world, china is the first major producing and consuming country of sweet potatoes in the world, and the cultivation of new sweet potato varieties with high yield, high resistance and high quality is the main direction for promoting the development of the sweet potato industry. The conventional hybrid breeding method mainly comprises two methods, namely conventional hybrid breeding and tissue culture, but the conventional hybrid breeding method has the problems of narrow genetic basis of the sweet potato, tight linkage of good genes and poor traits, incompatibility of interspecies hybridization, long breeding period, low breeding efficiency of part of precious germplasm materials and the like, and the tissue culture method has the problems of low plant regeneration frequency, long period, poor repeatability, large difference of interspecies regeneration capacity and the like, so that the sweet potato breeding process and efficiency are severely limited.

Disclosure of Invention

The invention aims to provide a method for quickly and efficiently realizing sweet potato transgenosis, which shortens the genetic transformation and breeding period of sweet potatoes.

The method for quickly and efficiently realizing the sweet potato transgenosis comprises the following steps:

injecting the agrobacterium tumefaciens bacterial liquid containing the target gene expression vector into the 1 st, 2 nd or 3 rd nodes of the sweet potatoes in the 4-6 leaf stage, then cultivating, and detecting to obtain the sweet potato transgenic plant or tissue containing the target gene.

Preferably, the agrobacterium tumefaciens bacterial solution containing the target gene expression vector is injected into the 1 st, 2 nd or 3 rd nodes of the sweet potatoes in the 4 to 6-leaf stage, dark culture is performed firstly, then culture is performed under light, and DNA detection is performed on the adventitious roots, buds or leaves newly grown on the injected plant or the adventitious roots, buds or leaves newly grown on the potato blocks after the potato tuber of the injected plant is grown, so as to obtain the sweet potato transgenic plant or tissue containing the target gene.

Preferably, the injection concentration of the agrobacterium tumefaciens containing the target gene expression vector is OD ₆₀₀ And (c) = 0.3-0.6. Further preferably OD ₆₀₀ ＝0.5。

Preferably, the agrobacterium tumefaciens containing the target gene expression vector is injected into the 1 st, 2 nd or 3 rd nodes of the sweet potatoes in the 4-6 leaf stage, dark culture is performed firstly, then under light culture is performed, after the buds and the new leaves grow out again, the agrobacterium tumefaciens containing the target gene expression vector is injected into the 1 st, 2 nd or 3 th nodes of the sweet potatoes in the 4-6 leaf stage again, dark culture is performed firstly, then under light culture is performed, and the infection is performed for a plurality of times.

Further preferably, the Agrobacterium tumefaciens containing the target gene expression vector is injected into the 1 st, 2 nd or 3 rd nodes of the sweetpotatoes in the 4-6 leaf stage, dark culture is performed for 2 days, then under light culture is performed, after the buds and the new leaves grow out again, the Agrobacterium tumefaciens containing the target gene expression vector is injected into the 1 st, 2 nd or 3 th nodes of the sweetpotatoes in the 4-6 leaf stage again, dark culture is performed for 2 days, and then under light culture is performed.

The sweet potato in the 4-6 leaf stage is obtained by cleaning sweet potato blocks with clear water, culturing until the sweet potato blocks germinate, and culturing the stem segments of the sweet potato in sterilized soil until the stem segments grow to the 4-6 new leaf stages.

The agrobacterium tumefaciens containing the target gene expression vector is obtained by transferring a target gene into the expression vector and then transforming the target gene into the agrobacterium tumefaciens.

The agrobacterium tumefaciens liquid containing the target gene expression vector is prepared by culturing agrobacterium tumefaciens containing the target gene expression vector to logarithmic growth phase, collecting agrobacterium tumefaciens, and diluting to OD ₆₀₀ ＝0.3-0.6。

The target gene can be GUS gene.

The expression vector can be pCAMBIA1301.

Compared with the traditional crossbreeding and tissue culture, the method not only overcomes the problems of incompatibility among species, low regeneration frequency, large difference of regeneration capacity among varieties and the like, but also greatly shortens the genetic transformation and breeding period of the sweet potatoes. The invention can introduce target genes or specific DNA segments into sweet potato tissues, quickly and efficiently obtain transformed sweet potato seedlings, improve the characteristics and resistance which the existing sweet potato varieties do not have, and realize the great improvement of the sweet potato varieties.

Drawings

FIG. 1: a is a schematic diagram of a transformation vector, B is a schematic diagram of an operation method, C is an adventitious root of a sweet potato plant in a control group, D and E are GUS staining phenotypes of the transgenic adventitious root, and 35S;

FIG. 2: for GUS gene identification, identification primers are 35S-F and GUS-R, the size of a target band is about 1000bp, wherein 1 and 2 represent DNA identification results of transgenic adventitious roots with blue GUS staining; and 3, the adventitious root DNA identification result of the control group of plants.

Detailed Description

The present invention will be further described with reference to the accompanying drawings, and it should be noted that the present embodiment is based on the technical solution, and the detailed implementation and the specific operation process are provided, but the protection scope of the present invention is not limited to the present embodiment.

Example 1

The embodiment provides a method for rapidly realizing sweet potato transgenosis, which comprises the following steps:

1. cleaning sweet potato pieces with clear water in advance, culturing until they germinate, sterilizing the soil with autoclave, and transplanting the germinated sweet potato stem into the sterilized soil until it grows to 4-6 new leaves (FIG. 1B);

2、

1) Taking out the agrobacterium tumefaciens competent cells from a refrigerator at the temperature of-80 ℃, and unfreezing the agrobacterium tumefaciens competent cells on ice;

2) Adding 1 μ g of plasmid containing GUS gene (pCAMBIA 1301, FIG. 1,A) into 100 μ L of Agrobacterium tumefaciens competent cells, gently mixing, and standing on ice for 30min;

3) Freezing in liquid nitrogen for 1min, and incubating at 37 deg.C for 5min;

4) Adding 1mL LB culture medium, shaking at 28 deg.C and 200rpm, culturing for 2-4h, centrifuging at 5000rpm for 3min;

5) Discarding the supernatant, suspending the cells with 50. Mu.L of LB medium, spreading the suspension evenly on LB plates containing carrier-resistant Rifamicin (20 mg/mL), carbenicilin (25 mg/mL) and Tetracycline (12.5 mg/mL) and carrier-resistant Kanamycin (50 mg/mL) antibiotics, and culturing the suspension upside down at 28 ℃ for 2-3 days;

6) Gene and vector specific primers for single colonies (35S-F: AAACCTCCTCGGATTCCATTG and GUS-R: TTCGGCGTGGTGTAGAGCATTA) performing PCR on the bacterial liquid, and screening to obtain a positive agrobacterium monoclonal;

7) Streaking and culturing the positive monoclonals containing target Genes (GUS) on a resistant LB plate containing Acetosyringone (working concentration is 200 uM), and culturing for 2-3d at 28 ℃;

8) Washing the agrobacterium containing the target plasmid by a Wash buffer, centrifuging at 5000rpm for 5min, and collecting thalli;

9) The Agrobacterium cells were diluted to OD with an infection buffer ₆₀₀ =0.5, to be injected with a sweet potato stem segment;

3. sucking agrobacterium liquid by using a 1mL injector at a second node (counting from bottom to top,

nodes

1, 2 and 3 can be injected because the nodes are most likely to develop into storage roots in the growth process) of the sweet potato (1,B) in the 4-6 leaf stage, sucking 100ul of the agrobacterium liquid by using a needle to inject the agrobacterium liquid containing a target gene, recording the OD value of the agrobacterium, planting the stem section of the sweet potato after injection in a flowerpot with the diameter of 10cm, and culturing in dark for 2d;

4. after 2 days, transferring the sweet potato seedlings into the light for culturing until buds and new leaves grow out again, culturing the agrobacterium tumefaciens containing the target Gene (GUS) again, sucking 100ul of bacterial liquid by using a micro-injector, injecting the bacterial liquid at the node where the buds grow out for the second time, and culturing in a dark place for 2 days;

5. after 2 days, the sweetpotato was cultivated in the light, and after 1 week, newly grown leaves and roots were taken, and positive tissues were identified by GUS histochemical staining (FIG. 1,C, D, E). Wherein, in the picture C in the picture 1, the negative control is normal plants, and GUS staining cannot turn blue; d and E are transgenic plants, and adventitious roots turn blue by GUS staining. Meanwhile, genomic DNA of corresponding adventitious roots is extracted by adopting a CTAB method, PCR amplification is carried out aiming at a target gene sequence, the used primers are (35S-F and GUS-R), a target gene band is detected by agarose gel electrophoresis, as shown in figure 2, according to the result of GUS dyeing identification, a target fragment with the size of about 1000bp (2,1 and 2) can be amplified by DNA extracted from the adventitious roots of positive GUS plants, and a target fragment with the size of about 1000bp (2,3) cannot be amplified by normal plants serving as negative controls. GUS histochemical staining and DNA identification experimental results show that the method for injecting the stem segment of the sweet potato can quickly obtain the transgenic adventitious root or plant of the sweet potato.

Various changes and modifications can be made by those skilled in the art based on the above technical solutions and concepts, and all such changes and modifications should be included in the protection scope of the present invention.

Claims

1. A method for rapidly realizing sweet potato transgenosis is characterized by comprising the following steps: injecting agrobacterium tumefaciens containing a target gene expression vector into the 1 st, 2 nd or 3 th nodes of sweet potatoes in the 4-6 leaf stage, performing dark culture for 2 days, then performing light culture, growing small buds and new leaves again, injecting agrobacterium tumefaciens containing the target gene expression vector into the 1 st, 2 nd or 3 th nodes of the sweet potatoes in the 4-6 leaf stage, performing dark culture for 2 days, then performing light culture, and performing DNA detection on newly grown adventitious roots, buds or leaves on an injection plant or newly grown adventitious roots, buds or leaves on a potato block after the injection plant bears potatoes to obtain a sweet potato transgenic plant or tissue containing the target gene;

the injection concentration of the agrobacterium tumefaciens containing the target gene expression vector is OD ₆₀₀ ＝0.5；

The sweet potato in the 4-6 leaf stage is obtained by cleaning sweet potato blocks with clear water, culturing until the sweet potato blocks germinate, and culturing the stem segments of the sweet potato in sterilized soil until the stem segments grow to 4-6 new leaf stages.

2. The method according to claim 1, wherein the agrobacterium tumefaciens containing the expression vector of the target gene is obtained by transferring the target gene into the expression vector and then transforming the target gene into agrobacterium tumefaciens.

3. The method of claim 1, wherein the Agrobacterium tumefaciens strain solution containing the target gene expression vector is prepared by culturing Agrobacterium tumefaciens containing the target gene expression vector to logarithmic growth phase, collecting Agrobacterium tumefaciens, and diluting to OD ₆₀₀ ＝0.5。

4. The method as claimed in claim 1, wherein the target gene is GUS gene and the expression vector is pCAMBIA1301.