CN113151323A - Clone, function research and marker excavation of gene ZmRH4 for controlling corn kernel development - Google Patents

Abstract

The invention describes a gene for coding DExD/H-box RNA helicase protein in corn and an amino acid sequence of the coding protein thereof, wherein the nucleotide sequence and the coding protein have the functions of regulating and controlling the development of corn kernels and the structure and components of endosperm; and develops a functional marker of the gene, can be used for improving the quality of the corn, and has great application and economic value.

Description

Clone, function research and marker excavation of gene ZmRH4 for controlling corn kernel development

Technical Field

The invention relates to a corn grain development regulating gene ZmRH4 and a coding protein sequence thereof, wherein the gene codes DExD/H-box RNA helicase protein. The early termination of the gene coding frame causes defects in seed development (lower than normal grain weight) and plant establishment (leaf whitening, dwarfing and seedling death). Belongs to the field of crop molecular breeding, molecular biology and genetic engineering. In particular to clone and application of a gene ZmRH4 related to controlling the size and quality of corn grains.

Background

The corn kernel mutant comprises mutants with mutant phenotypes of various kernels, including sprouting, small grains, empty pericarp, shrinkage mutants and the like. From a biological composition perspective, corn kernel is composed primarily of embryo and endosperm, with the endosperm making up about 70% of the total weight of the corn kernel (Berger,1999), playing a key role in corn kernel size and hundred weight. Cell division of the endosperm directly affects the size and weight of the seed. Whether the corn kernel can normally develop or not directly influences the size of the corn kernel and the yield is low, and the kernel development has important significance for the research of the development process of the corn kernel and genetic breeding. With the rapid development of biotechnology, people continuously break through the methods of transposon technology, map-based cloning, high-throughput sequencing and the like, and clone some key genes influencing grain development. Many genes have been cloned so far, and these genes are involved in multiple pathways such as signal transduction, sugar metabolism, and RNA editing.

RNA links DNA to proteins and is the basis for organisms to perform a variety of physiological activities. RNA metabolic processes, including splicing, transcription, transport, translation, degradation, etc. of RNA, all require involvement of RNA helicase (RNAhelicase) (Byrd,2012) DExD/H-box family in various physiological processes such as plant morphogenesis, stress response, seed development, etc. The development of corn kernel involves a very complex network of gene regulation. In recent years, several genes have been reported that are involved in corn kernel architecture, embryo development, endosperm starch synthesis and storage protein synthesis. However, there is still limited knowledge of gene expression network information and important genes affecting grain development during grain development. Through previous GWAS research, a gene ZmRH4 for coding DExD/H-boxRNA helicase protein is located, and the early termination of the coding frame of the gene causes defects in seed development (lower than normal grain weight) and plant establishment (leaf whitening, dwarfing and seedling death). The gene directly or indirectly affects chloroplast ribosomal gene expression. The preliminary research lays a foundation for further exploring the function of the DExD/H-boxRNA helicase gene in the process of regulating and controlling the corn kernel development, and also provides a reference for improving the corn yield and the kernel type.

Disclosure of Invention

The invention aims to provide a novel DNA sequence and a cDAN sequence of a corn kernel development gene ZmRH4 and an amino acid sequence of a functional protein coded by the gene, wherein the gene codes DExD/H-boxRNA helicase protein, the DExD/H-boxRNA helicase protein is specifically expressed in chloroplast, and the loss of the function causes the corn embryo and endosperm to be prevented from developing, thereby causing embryo abortion and kernel reduction.

The first object of the present invention is: provides a novel gene ZmRH4 for regulating and controlling corn kernel development, which is characterized in that the gene is a DNA molecule selected from the following 1) or 2) or 3) or 4) or 5):

1) the DNA molecule shown in SEQ ID NO.1 (genomic DNA cloned from maize inbred line B73): the DNA molecule consists of 17748 nucleotides, 23 exons and 22 introns.

2) DNA molecule shown as SEQ ID NO.2 (cDNA cloned from maize inbred line B73)

3) A DNA molecule which is formed by one to a plurality of base substitutions and/or one to a plurality of base insertions and/or deletions and large fragment nucleotide sequence insertions/deletions/shifts/inversions on the basis of SEQ ID NO.1 and can influence the development of seed grains;

4) hybridizing and washing the membrane in a solution of 0.1 XSSPE (or 0.1 XSSPE), 0.1% (w/v) SDS at 65 ℃ to obtain a DNA molecule capable of hybridizing to the DNA molecule of SEQ ID No.2 and encoding a plant grain development related protein;

5) DNA molecules which have homology of more than 85 percent with the DNA molecules of SEQ ID NO.2 and encode the plant grain development related protein;

the second object of the present invention is: provides the related protein coded by the gene and used for regulating and controlling the development of seeds.

In one embodiment, the gene encodes a protein described in 1) or 2) below;

1) protein consisting of amino acid sequences shown by SEQ ID NO.3 of a sequence table;

2) related protein which is obtained by substituting, deleting and/or adding one or more amino acid residues in SEQ ID NO.3 of the sequence table and has the function of influencing the assembly of plant mitochondrial protein.

The third object of the present invention is: provides a recombinant expression vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the gene and/or the promoter.

A fourth object of the present invention is: provides the application of the gene in transgenic improved crops. In one embodiment, the gene is used for inducing normal development of crop seed kernels so as to introduce an exogenous gene to obtain a high-quality transgenic crop.

In a specific embodiment, the improvement comprises improvement in agronomic traits such as yield increase, quality increase, disease and pest resistance, stress tolerance, and lodging resistance.

In another embodiment, the crop is a self-pollinated or cross-pollinated crop.

In a more specific embodiment, the crop includes, but is not limited to, corn, rice, sorghum, wheat.

The fifth object of the present invention is: provides a method for obtaining the orthologous of the ZmRH4 protein in other plants and the amino acid sequences of rice, wheat and Arabidopsis obtained by the method, wherein the ZmRH4 protein is relatively conserved in rice, wheat and Arabidopsis (figure 5).

Compared with the prior art, the invention has the following beneficial effects: the plant seed organ development regulating gene ZmRH4 provided by the invention is related to the development of seed embryo and endosperm, and the embryo death is caused by the early termination of the gene coding frame. The expression is that the mutant endosperm is blocked in formation, starch granules and protein are abnormal in form, the endosperm cannot be normally deposited, and the early embryo cannot be normally divided and differentiated, so that the grain development is blocked, the seeds are loose, the filler is rare, and the grain is reduced. Through the plant biotechnology approach, the invention plays an important role in the high-quality breeding of crops.

Definition of terms

The term "gene for regulating seed grain development" refers to a nucleotide sequence with the ability of coding protein, and the sequence specifically codes protein active polypeptide with the function of regulating seed grain development, such as the nucleotide sequence from 1 st to 4239 th of SEQ ID NO.2 and the degenerate sequence thereof.

The term "degenerate sequence" refers to a sequence which is generated by substituting one or more codons in the nucleotide sequence encoding boxes 1 to 4239 of SEQ ID NO.2 with a degenerate codon encoding the same amino acid. Due to the degeneracy of codons, the degenerate sequence with homology as low as 70 percent with the nucleotide sequence from 1 st to 4239 th positions of SEQ ID NO.2 can also encode the amino acid sequence encoded by SEQ ID NO. 2.

The gene for regulating and controlling seed grain development also comprises a nucleotide sequence which can be hybridized with the nucleotide sequence of SEQ ID NO.2 under moderate strict conditions and more high strict conditions. Among them, the medium stringency conditions may be conditions of hybridization and membrane washing at 65 ℃ in a solution of 0.1 XSSPE (or 0.1 XSSC), 0.1% (w/v) SDS. The gene for regulating and controlling seed grain development also comprises a nucleotide sequence which has at least 70 percent of homology with the nucleotide sequence of SEQ ID NO.2 from 1 to 4239, preferably 80 percent, 82 percent, 85 percent, 86 percent, 88 percent and 89 percent of homology, more preferably 90 percent, 91 percent, 92 percent, 93 percent and 94 percent of homology, and most preferably at least 95 percent, 96 percent, 97 percent, 98 percent and 99 percent of homology.

The gene for regulating and controlling seed grain development also comprises a variant form of an open reading frame sequence of SEQ ID NO.2, which can encode the protein with the same function as the natural corn grain development regulating gene ZmRH 4. These variants include (but are not limited to): deletion, insertion and/or substitution of 1 or several nucleotides, and addition of several (usually, up to 60, preferably up to 30, more preferably up to 10, and most preferably up to 5) nucleotides at the 5 'or 3' end.

The gene for regulating and controlling seed grain development also comprises an amino acid sequence capable of translating and controlling the corn grain development function, such as the amino acid sequence of SEQIDNO.3. The amino acid sequence also comprises a variant form of SEQ ID NO.3 with the same function of naturally regulating and controlling the corn kernel development protein. These variants include (but are not limited to): deletion, insertion and/or substitution of 1 or several amino acids, and addition of 1 or several (usually, up to 20, preferably, up to 10, more preferably, up to 5) amino acids to the C-terminal and/or N-terminal. In the art, substitutions with amino acids of similar or similar properties do not generally alter the function of the protein; addition of one or several amino acids at the C-terminus and/or N-terminus does not generally alter the function of the protein.

In addition, the full-length nucleotide sequence of the "gene for regulating seed grain development" or a fragment thereof can be obtained by a PCR amplification method, a recombinant method or an artificial synthesis method. For the PCR amplification method, primers can be designed based on the nucleotide sequences disclosed in this example, particularly the open reading frame sequence, and the relevant sequences can be amplified using a commercially available cDNA library or a cDNA library prepared by a conventional method known to those skilled in the art as a template. When the sequence is long, two or more nested PCR amplifications are usually required, and then the PCR amplification products are spliced together in the correct order. Once the sequence of interest has been obtained, it can be obtained in bulk by recombinant methods. Usually, the sequence is cloned into a vector, and then the sequence is isolated from the expanded host cell by a conventional method such as cell transformation. Furthermore, mutations can also be introduced into the example protein sequences by chemical synthesis. In addition to being produced recombinantly, fragments of the proteins of the examples can also be produced by direct synthesis of the polypeptides using solid phase techniques. In vitro protein synthesis can be performed manually or automatically, and fragments of the example proteins can be chemically synthesized separately and then chemically linked to produce full-length protein molecules.

Drawings

FIG. 1 is a drawing F₂Generations (ems4-668a4/+ selfed progeny; A is the phenotype map of the mutant ears; B. c is a front and side comparison graph of the mutant grains; d is a section view of mature mutant seeds, and E is a section view of mature wild type seeds; f is the inside of the seed after the seed coat of the mutant seed is removed on the 13 th day after pollination, and G is the inside of the seed after the seed coat of the wild type seed is removed on the 13 th day after pollination;

FIG. 2 is a graph comparing zmrh4-1 mutant with wild type seedlings;

FIG. 3 is a structural diagram of ZmRH4 gene containing 23 exons and 22 introns;

FIG. 4 is a scanning electron microscopy phenotype image of kernel endosperm, A, C is zmrh4-1 wild type kernel 1000 times magnification phenotype, 2000 times magnification phenotype; B. d is zmrh4-1 mutant seed 1000 times magnification phenotype, 2000 times magnification phenotype; E. g is zmrh4-2 wild type seed 1000 times magnification phenotype, 2000 times magnification phenotype; F. h is mrh4-2 mutant seed 1000 times magnification phenotype, 2000 times magnification phenotype;

FIG. 5 is a tree analysis diagram of ZmRH4 protein and its homologous genes in rice, wheat and Arabidopsis;

FIG. 6 shows the result of subcellular localization of ZmRH4 protein, wherein A is the yellow fluorescence of ZmRH4-YFP fusion protein; b is a cell structure; c is chloroplast spontaneous red fluorescence; d is the coincidence of the yellow fluorescence of ZmRH4-YFP fusion protein and the spontaneous red fluorescence of chloroplast;

FIG. 7 is a comparison graph of 25 genes with different expression in nucleus-encoded chloroplast ribosome-related genes obtained from the results of zmrh4-1, zmrh4-2 mutant and wild-type grain RNA-Seq.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the scope of the invention. All technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs, unless otherwise specified. Unless otherwise indicated, all techniques used or mentioned herein are standard techniques recognized by those of ordinary skill in the art. The test materials are, unless otherwise specified, all materials commonly used in the field of the present invention. The test reagents used in the following examples were purchased from conventional biochemical reagent stores unless otherwise specified. The materials, methods, and examples are illustrative only and not intended to be limiting. The granule mutant of the invention particularly refers to that the granule development is obviously smaller than normal granule due to the mutation of the gene related to the control of the granule development, and the granule mutant is F₂The ears are obviously separated, and a certain proportion of seed mutants are expressed. So-called Dek (Defective), Smk (Smallkernel), emp (emptykernel) and the like. The grain development related genes are controlled by nuclear, cytoplasmic, e.g. mitochondrial or chloroplast genes. Thus, it is possible to provideThe invention also comprises the use of the sequence table to lock the sequence to regulate the development of grains or seeds, i.e. the gene sequence provided by the invention can influence the functions of the same or homologous genes in other plants at the genome, and/or transcriptome, and/or proteome level to achieve the purpose of controlling the development of grains. For example, the following methods are not limited to the following methods: affecting or altering the function of a plant gene by causing gene expression inhibition or loss of protein function through variation of the native sequence, by transferring the gene's antisense sequence or introducing hairpin structures into a plant, or by combining the gene with other sequences (DNA or RNA) to create new functionally active DNA or RNA strands, or any other technique known to those skilled in the art that can be used to affect seed grain development. The invention comprises a corn ZmRH4 gene, the dominant allele of which has a key effect on seed grain development, and the recessive allele with function deficiency can cause seed grain to be smaller and the development to be hindered. The gene is located on chromosome 5 of maize. The gene sequence and its homologous sequence can be obtained from any seed plant, including but not limited to maize (Zeamays), rice (Oryzasativa), sorghum (Sorghumbol), Triticum aestivum (Triticum aestivum), millet (Setaria availability), barley (Hordeum vulgare), brachypodium distachyon (Brachypodium distachyon), rye (Secalele), aegyptia procumbens (Aegliopsinus chinensis), Arabidopsis thaliana (Arabidopsis thaliana), cabbage (Brassica oleracea), soybean (Glycinemax), tomato (Lycopersicon esculentum), and the like. Methods of obtaining include, but are not limited to: calling from the genome sequence database, and/or cDNA sequence database, and/or protein sequence database of other plants by the maize ZmRH4 gene sequence using blastx, blastn, or by the amino acid sequence using blastp; designing a primer by taking a DNA or cDNA or RNA sequence of the ZmRH4 gene as a reference sequence, and directly obtaining the primer from the genome DNA or cDNA or RNA of other plants by using a PCR method; probes are designed according to the gene sequence of corn ZmRH4, and DNA or cDNA or RNA fragments containing homologous gene sequences are separated from a genome library by a nucleic acid hybridization method. ZmRH4 Gene homologous sequence "means that the identies are 35% or more after the blastx comparative analysis of the amino acids of SEQ ID NO.3And the DNA sequence of the plant gene is more than or equal to 50 percent of the positives (as shown in figure 5). When performing blastx, all parameters were performed following the default settings shown by http:// blast. ncbi. nlm. nih. gov/.

The following more detailed description is provided by way of illustration and description and is not intended to limit the scope of the invention.

Example 1: ZmRH4 and identification and gene cloning with mutants

The corn kernel development mutant is manifested by kernel abortion, developmental retardation and the like, as shown in fig. 1, and the manifestations are as follows: the mutant has no normal and plump starch granule structure, loose endosperm composition, rare filler, serious development obstruction degree, no observed embryo structure and seed abortion. The invention obtains a gene ZmRH4 which can possibly control the corn kernel development, and obtains two EMS mutagenesis mutants EMS4-668a4 and EMS4-66898 of the gene. According to the phenotype characteristics of the mutant, only heterozygous normal grains separated from the same F2 cluster can be used for propagation, and stable inheritance of the mutant phenotype is found through years and multiple generations of selfing. In addition, after two EMS mutants are subjected to allelic test (Aa multiplied by A 'a') after hybridization, the offspring is found to show a normal seed and empty fruit peel ratio of 3:1, and the genotype detection is normal, the seed shows Aa genotypes of two mutation types of EMS4-668a4 or EMS4-66898, and further the relationship between the gene ZmRH4 and the granule phenotype is confirmed, and the granule phenotype is caused due to the early termination of the translation of the ZmRH4 protein.

ZmRH4 encodes a DExD/H-box family protein, an infusion primer is designed according to a B73 genome sequence and a pGWC vector sequence, PCR amplification is carried out by taking B73 corn kernel cDNA as a template, and agarose gel electrophoresis is carried out for detection to obtain a single band which is consistent with the target size of 4.3 kb. And purifying the PCR product, constructing a pGWC vector, selecting a single clone, sequencing, and displaying the sequencing result of the vector, wherein the joint region of the vector is correct, and the sequence of the gene ZmRH4 is completely correct. As shown in FIG. 3, ZmRH4 contains 23 exons and 22 introns, wherein the lengths of the 23 exons are not greatly different and the lengths of the 22 introns are more different. DExD/H-box proteins are an important family of RNA helicases that exist in almost all eukaryotes and most prokaryotes. Most RNA helicases belong to the superfamily 2 subclasses and are characterized by sequence homology within a helicase domain consisting of 8 or 9 conserved amino acid motifs. The DExD/H-box family of proteins has a very broad spectrum of actions, and almost all cellular processes involving RNA involve the DExD/H-box proteins, starting with gene transcription, pre-splicing and export of mRNA, to ribosome production, protein translation, to finally organelle gene expression and RNA degradation. The DExD/H-box family of proteins has been reported to date in model organisms of plants, animals and microorganisms. In addition, in plants, in addition to functioning in cells, tissues, the DExD/H-box family of proteins is involved in processes such as substance transport, abiotic stress response, seed development, and the like.

Example 2: comparing the seed size and seedling of the mutant and the wild corn seed. The allelic variant ems4-668a4 is exemplified. The EMS mutant ears exhibited an empty peel phenotype with a 1/4 ratio, as shown in figure 1. Further observation of mature seed structure shows that mutant seeds can not see embryo with naked eyes, endosperm deposition is reduced, seed coats are removed from 13d mutant seeds after pollination, endosperm development is seriously retarded, and embryo can not be observed and separated. Normal grains and small grains on fruit ears are taken to perform standard seed germination experiments, and germination experiments are performed by taking soil and MS culture media as media. And (4) carrying out seed germination by using an MS culture medium, wherein the wild seeds germinate and the small seeds do not germinate. In the germination experiment with soil as a medium, no small-sized seeds germinate after the first experiment. After several experiments, there was and only one small seed that germinated, the seedling became albino, and died by withering on day 4 after germination, as shown in fig. 2. The above results indicate that the mutation causing this phenotype is a nuclear single gene stealth mutation. The gene mutation can cause seed abortion and the seedlings can not normally develop.

Example 3: scanning electron microscope phenotype comparison of mutant and wild type kernel endosperm.

Microscopic observation is carried out on endosperm of normal and mutant grains by utilizing a scanning electron microscope technology, and the forms of the zmrh4-1 and zmrh4-2 mutant starch grains and proteins are abnormal and irregular, as shown in figure 4. The two mutants were phenotypically different in degree. The zmrh4-1 mutant has no normal plump starch grain structure, loose endosperm composition, rare filler and serious development obstruction degree. The endosperm of the zmrh4-2 mutant has an obvious starch grain structure, the shape of the starch grain is regular, but the starch grain is obviously reduced, the arrangement is loose, the filling is rare, and the development resistance degree of the kernel is reduced compared with that of the zmrh4-1 mutant. In normal seeds, starch grains are full and closely arranged, and the filler is more. The functional defect of the gene causes the obstruction of endosperm development and embryo differentiation.

Example 4: ZmRH4 protein maize protoplast subcellular localization

Subcellular localization prediction of ZmRH4 was performed using URGI-Predotar (https:// URGI. versales. inra. fr/Tools/Predotar). The results show that the ZmRH4 protein is most likely localized to chloroplasts. The materials selected for the subcellular localization of maize are generally tobacco leaves and maize protoplasts. In order to observe the functional position of the protein in corn more accurately and visually, the corn protoplast is selected for subcellular localization verification. A ZmRH4-YFP fusion expression vector is constructed, transfected into a corn protoplast, and fluorescence signal detection is carried out by using a laser confocal microscope. As shown in FIG. 6, the fluorescence signal of ZmRH4-YFP fusion protein is yellow, the signal is integrated into a spheroid and completely coincides with chloroplast red fluorescence, and no yellow fluorescence signal is detected at other positions except chloroplast. The above results indicate that the ZmRH4 protein is localized in chloroplasts in maize protoplasts.

Example 5: mutant and wild type chloroplast ribosome related differential expression gene

Because the gene is located in chloroplast, and the fact that the gene is possibly related to ribosome metabolism is known according to KEGG enrichment in an RNA-seq result, 25 genes with different expressions in nucleus-encoded chloroplast ribosome-related genes are found out, the genes are analyzed by using Q-teller (https:// qteller. mainzegdb. org /) public plant expression data, genes expressed in seeds at 12 th and 13 th days after pollination are selected, and 13 genes are screened out in total. As shown in FIG. 7, the chloroplast Ribosomal gene expression of the mutant kernels and the wild kernels of the three materials are different, wherein the up-regulated expression is Glf17(Glycoside laser family 17), Rpl9 (Ribosol protein L19), Rpl28/24 (Ribosol protein L28/L24), Rps21 (Ribosol protein S21), and Rps 9-cl-like (30S ribosol protein S9 chloroplastic-like), wherein the expression level of Rps21 in the mutant kernels is 4.95 times that of the wild kernels, and the expression levels of Rps9, Rpl28/24 and Rpl9 in the mutant kernels are 2 times that of the wild kernels. Other genes are genes with down-regulated expression, wherein the expression level of RplL29/26 (Ribosolprotein L29/L36) is 3 times of that of the RplL 29/26. Premature termination of the translation of the ZmRH4 protein, directly or indirectly, resulted in a change in the expression of some chloroplast ribosomal genes, some up-regulated and some down-regulated. Thereby leading to the obstruction of plastid development and influencing the development of grains.

Sequence listing

<110> university of agriculture in China

<120> cloning, function research and marker excavation of gene ZmRH4 for controlling corn kernel development

<130> MP2029930Z

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 17748

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aataaaccat agtttatatc tgcgtttaga tcactcgttt ggtcgcttcc atctcaagtg 60

ctggttgtgc aacagtcatt gccatcctcc atccctctga actccgaagg ccgaaccagt 120

tccgacgaaa cggtacggtg acggctcacc tcgggggtct ccatgtccat ggacggccct 180

gccacctcgc cggcaagcga ggtgccgttc cgcatcagct tctccggcca cagcggccac 240

ctccgcctcg accctacccc gcacacgccc agccccattc cggacttcgt cctggtacgc 300

ttgcgttccc cgcttccgcc ctaaatcact cctggcgttc gatgcaacct ttaaaaccct 360

aaacccaccg ttgtggcaat gacgaccaca gccgccggca tacccggccg agagcccgag 420

cagcgtgaag gagtacctcg agaggaacta cctcgacccc gagctgcacc tccccaccgc 480

ggccgatagc gggagggtgt gggatgtcga ctggtttgcc ctggccaggc cgccgctgga 540

gccctccgcc ccccgcacca tgctcgcgcc cgtctgggtg ccgcctttcc ggcgcgggca 600

ggagaagttg caatccgcgg cagagtcgcg agtgtgggac cctgagtccg tgcaaatgga 660

gatggtcgac gtgttcgatt cggggaccgg ggggatagcg ccccggatgc ctggtccggc 720

gaaggacttc gtcaggggga gcatcaacaa cagacctttt cgtccaggcg gtctgcagga 780

tgacgccgct gaggcggctg cgctggaaaa ggcgttccca gagggtgcaa ggactggtga 840

ttgggtgcgt gagctcatga gcggtggccc ggcgcaggtt gcgcctccag ggttccgtaa 900

gggattggag ctgggccagt tgaaggtttg acccttactt gtgtctcttc cactatataa 960

ccacaatcac cgatgtggtc atgtggatgt gccaaactgt gcagcggcta cttttcttgt 1020

aggggtatga aagccactgg aagtgtttcc gggatggaga acttgtagag gagcaacctg 1080

catcatcatc gaatgacaca atggtaatca gaacacatat tttgcatttg aacaatccac 1140

atctgtgctt actttgccat tgtagagttg tagccttgat tatcccattg ttctgcagga 1200

gaagtactct gtgcagtttg atgatctttt caagatagcg tgggaggaag atactgccaa 1260

caagttgttg aaggacggtg ttgttcaaca atctgctgaa ggtgaaggaa tcaatggtac 1320

tttattgttc tcacacatca tatttttaag ttacatgagt acactgtctt ggcaaattgt 1380

aatagctaaa aggtaatggg acattgtaac cactgttgct actaggacat tagcattcag 1440

ttcatttacc aaagcctggt ttcttgttaa gattttcatt tttcattggc agaaattggc 1500

gaacaaaaag ttgatgcatt gcaggatgag ttcgagagta taacaacgct agatgacgag 1560

aaacaggaag ttgatgtcat aagaaatgtt cctgaaactc aaacagactt ggatcagatg 1620

ttatcttctg aagtacagga tacaggcagg gaaccaggtg catcaggtga taagaagcca 1680

acacaagatg gcatggtaag cactctttat gccttttctt ctatctcact ttctatgctg 1740

tgcttcttgt tctgtaagct tcaggggtag atattgttgc agaaatgata aatgtggttt 1800

ggtctcacaa ttctcgatag atcatggatg gaccaataat gccaatgtac ctctatttca 1860

tctataggtt tgggcacttg ttggtgggga cgaggacata gtgactaact tctccaaact 1920

cgttccagat atggcaatcg agtttccatt tgaattggat aagttccaga aggaggtaaa 1980

gtactcatat gcatcctttt ctgtttcaat gtattctcca tattgatcag agtgtctatt 2040

atactgcatc atccaagtgc atgcactgtt ttttttactt ggacttttag gcaaattcac 2100

attacatgct tctaattgta gtacttcatc tatgtttggc agccttagcc tgcaatttta 2160

ctttccggta tacactcggt cgcagcttga tttcgtatta ggacataccg acatagatac 2220

tttcatacta tacattcagc ctgcgatcat ctaaacgatt ttacttctat tgccttgcaa 2280

taccacatta gatattttct taaaacagca caaggttgca tatctctgtg agaaatttaa 2340

aagctagtcc agtctagggt tgtctttcct ggaatacaag attacggata accaatttaa 2400

atgaaaagaa acatctagtg aacatatata ccctttcttc tatttcctgt gggaactatt 2460

tgttacaagg tgtcttagat ggtaccacta cctatctgtt tttgaactta gaacaatgtt 2520

ttcaagtcgt ccgattaatt gtgattagtc gcgattaatc gtccaagtcg gtttggacca 2580

atcacgatta atcgcccaag tcatccgact aatcgtgatt aatcgtgatt aatcggttag 2640

ccagaatgat cagcaagtcg tccgacttga aaacgatgct tagaaaacta tgtttaaatt 2700

gcttcgtata gttgctaatc tatatttctt ttgtctacaa agcacaggct atatattatc 2760

tcgagaaggg tgaatcagtc tttgttgcag cccatacttc agctggaaag acggttgttg 2820

ctgagtatgc attcgcatta gcaacgaaag tatgatttca tttgctcttt cttacttttt 2880

gggtaatttt gctcgtttta aactgcttag catcttccgc acttaatagc ttctaaaccc 2940

ttgcatttag cccccagcag cccagcttat tacttttttt agttgccttg agaattttcc 3000

agttcttaat ttctgataag attcatgctt gcttttctca gtagattgat ctttagatta 3060

catgccccag tgcactatct caaattcctc accgtaatag ttgatttaaa cccccactgt 3120

aataaaaaat gctagcattg atcttattat gacagataat tttgttatgc agcattgcac 3180

taggtctgtc tatactgctc ctattaaaac tatcagcaac cagaaataca gagatttttc 3240

tgggaagttt gatgtgggac ttctgacagg agatgttagc atcaggccag aggcaacttg 3300

cttaattatg actactgaga tattgcgttc aatgctctac agaggcgcag acattatacg 3360

tgatattgaa tgggtaggct atcacttatg atttgttcac tgtgttttac tctgtgcctt 3420

caagtttcac ttttataatc ttgtaaacgg atcatgagtt gctgatatgt gtttaattgt 3480

acactcaggt aatctttgat gaagtgcatt atgtaaatga tgctgaaaga ggtgtagtct 3540

gggaggaggt cattataatg ctcccgaagc acattaacat tgttcttctt tcggcaacgg 3600

tactgattta gtgtaaacag cacttttact cactatgttc actatcaacc aaacattcat 3660

gtactggctg ttgaaacagt tgctcagtaa tagctaggca caatatgaca tactaagggc 3720

acccacaagg ccaacaacag tatagtaatc tgccctctat aatagcagta gcaattcacc 3780

ttatctacag acaggataaa agaaaaaaag ggcagaccca gtgccaaagt ctcccacatg 3840

agtgggacag tctgaggaag ggataaaccg atacaagcct cccccccata aatgtggtga 3900

gtctgttttg aacctgtgac ttggtgactt agtgagacaa ctctcaccac tgcaccaggc 3960

ctacccttct aatctacaga cacgataaaa taacacgtcc aataatgaat gatctatcta 4020

ttggcacaaa ctacaagaaa aaatctcgat ctgcgtgggt aagacaaccc ctgggtatca 4080

cattaagaag acctcacata ggccgagaaa aatcctgaaa ccttgctcca cccatacaca 4140

gcagcaccat agcccatatg ggaacgacca cgaccggggc taggccttag acccgtgctt 4200

tggcatgagc caaaaaccac agcctgaaat tcgctaccac agggagttga atttaggact 4260

tgtggagtgc tactcagacc acctaaccaa cttaggtaga ggccttttcg tcacaaggtg 4320

caagaaataa taatgcccac gggtaagaat gatagttcgt aggatggttt ctatagtggc 4380

atggcatgga aactagttag tggtgtctgg gttagggttg tcctaatgcc atttgcagtt 4440

gcttttgatc ttttgaaata gttggcacat aactctgatc ttaggagaat tttgtggttg 4500

tccaagtttt atagcatgca attatggtct tgtattgcta ttaccctgtt tcttgatatg 4560

catgcaataa agtgacatgt ccactgatgt taattgtgca acttttggct ggcagtattc 4620

atccacaaat agtacttcgt gaaaacaata tagttgaaaa ctagtcctct aaatatgatg 4680

ttatgtgata atctaatatc aaattaccat ttgaatatat tggcattgca ataataaaat 4740

attctttttg tatatttttt tatcgaactc tcaagagaat tgcatatcat ttcgttaaga 4800

gaaaagagag tacacaaaga agggcaagct tggtgcagtg gtgagaaagt ctcattgagc 4860

caccaggtca cagtttcgaa gcaacttctt tgcatttgtg agagaaaggc ttgcctcagt 4920

ttattccttc cctagacgtc actcatgggg gagcctctgg caccgggtct acctttttta 4980

gaagagtaca caaagggagg gcattcccct attggttcaa agaacaaaat gacacctgtt 5040

ctttttctac aaatatctaa agttcgaaaa cattgtattg tttcacttat tcattttttt 5100

gcagttgaac cctatttgtt tcttttcagg tcccaaatac tgttgaattt gctgactgga 5160

ttggtcggac aaagcagaag aaaattcgtg tcacatcgta agtgcactta gtataaattt 5220

taagctaatc aatcacaccc caggcccttg aactatattg tcagttggtt tagtcactag 5280

tcactacttc actaggctgg ttagagtcat ccaattagct cttttgttca tgctagtgag 5340

cggtatatgg aatctacctt gctagaaaag tactgcttat atcatgtgag tgccatttta 5400

caaaattata aatttcagtt aattattttc tatctcagga tatgagggtg gctgtagcca 5460

tcaaatacgc atttctagat tatgaagcat tcaactactc aattgtaaga ggcaaattat 5520

tggttggtct gttattaact gctggtagga tatgaatgca tataggcttc tgggcttgaa 5580

aaatcaatgt atttgcttgg attacaggat atgagaacct gacaagtatt ttgagtatgt 5640

agaatgtaga tacatcatac atgctgtcca aggacagctg ttgtcatttt ggacagctgt 5700

tgttccaagg acaactatat tctatctaat acaatttatt tctctgttct gtgattgtaa 5760

ttattcctcc cataacaaaa ggcaaagcga ttccatggta ttatgataaa ttagtttgta 5820

ttcagattat cagtgatgca gcctaacacc cacctttata gcaaatcaca tatactggat 5880

acttctagct tattcgtaat tgaactgtgc ttcttctcat tgctagcgtt gctataagtc 5940

catatgaaaa tcctgaatct catactttat gtgtaaaaaa tcaactagca atgccgttaa 6000

aataatactc caaagtagtg atacctcttt cctggcaatg ccgttaaaaa aaccagcagg 6060

ccaggattgg ccacgtcgcc gtctgcaaaa cgagctctcg gagccagtgc agcccaattc 6120

actctttatc tctgccccac taggtaaagc ggcagttttt ctgccacgct agtcacctcc 6180

tgtcaggctg tcacgtgacc agagcaggaa agctatggac gcgtgatcgg agggtaaacg 6240

ctgaggctga cctcggcgcc gagatccgtg acgccgaggt tgctgccatg caggcgccgt 6300

ctcagtgtgc ggatctgaga cctcgttgcc gagctgatgg tctattttct gaaatgaaat 6360

tgaaaagggt gtatttgtga aaaacttttg caaaaagggc taaaataaaa aaacgggact 6420

gttgctgccc aaaatgacaa gaagctgttc agcagcagct gctgcagctc actctcacag 6480

attactatgt attactgcaa agtagctcaa gcgtggaggt agatggtttt tcttgggggt 6540

ggtgggtgtt ggagaatgtg gtgattttac atcgttttgc atcttggtag ttattttaag 6600

aagcatagtg ttcgaactac acattagtta ggcagggggg ggggtttggc cgttggcggg 6660

tgttggtgaa tgtgggggtt ttacattgat ttgcatcttg gtggtagtta tccttcaaat 6720

ttaagatgcc aatcttgctt gattagacat aatggtcaca ccactttaaa tattagttaa 6780

aaatctgtac aaatctgaat ggagcaactg aaaggtctat actttaataa aacaaactca 6840

gctgaggggc aaaaattaac acactcagtt taaagggacc tgcttataca tatttgggaa 6900

gaggcatgga aaggccaaag ttgacagggg aagaggcagt aaaaggagac ttgaaaggat 6960

gggatacacc caaagatttt agccttgaat aagagtgcat ggaaaacagc tatccatgtg 7020

cctgatctct gacttgtggt ttgtgttggg tttcaactct gcctacccca acttgcttgg 7080

gactaaaaga ctttgttgtt gctgcttata catatatgga taatatatgg ggccagatca 7140

acaatactag aatttagggg gtttggttgc aggcttacca tttaagtgga taatagtttt 7200

gatttgcctt aatgcacttt tgaatatact tggatacatg gactataatt ttgatcacag 7260

tttggtcatc atgtgttcac caggaccaac aaaaggcctg ttccacttga gcattgcctg 7320

ttctactctg gagaagtgta caaaatatgt gagagggata tgtttcttgc tcaaggattt 7380

aaagaagcaa aagatgcttt caaaaagaaa aatttgaata agtttggagt gaaacctggt 7440

tcaaagtcag gaacccctgc agtacgtgct ggaactcaag gcaaaaatcc agatacatcc 7500

aacaagggga gagatcaaaa gtacccaaag caccgcaatt ccaattcagg agtagccaca 7560

gttcaacaga gctcctcagg gccaaagaga tttgaatctt tattttggat gccacttgtg 7620

aataaccttc tgaagaaatc ccttgtgcct gtatgtgaga taatagcttt tgtgatatct 7680

ccatcataca attataaatt ctgtcggttc tttacttttt catcatttac actgaatttg 7740

tttgatcctt aatttgaaat ctgaagccag tctcaatatg ttataaaatg acaggtagtt 7800

agtctcaaca ttttgggaat agacttgtct ctttttatca tgaccatgtc atttcacatt 7860

tgacattctt ttttgatcat ttagatggtc ctttaacagg tggtgatttt ttgtttctca 7920

aagaatcgct gtgataaatc ggcagatagt atgtttggca ctgatctcac cagtagttca 7980

gagaaaagtg aaatacgtgt cttctgtgac aaggcatttt cacgtcttaa aggatctgat 8040

aggaaccttc cacaggtgat cttgtgacac tgcaaaattt agtcctctag ccctcacccc 8100

gtaaacctat gcttctgtta atcagttcaa tgctttaaac tttgacctct ttgataggtt 8160

gtaggaatac aaagccttct gcgaagagga attggagtac accacgctgg gcttctccct 8220

attgtgaagg aagttgttga gatgctgttt tgccgtggtg taatcaaggt tatgctttga 8280

acgtctggta tatgtacggt atttaatcac atgatagatg ctgctttacc tagtactaag 8340

cttggcggaa gaatcgtatt gttgttttgt ttgccttaga ttgtaaatgc tgaccagtga 8400

ccactaactt agcccatcct ggccaaagtt attgcagtca tgtagactat aactgtagca 8460

acctttaccg tacacagttc tttaacttga atggacaatc caacagaaaa ttgatagtcc 8520

taataacatc gcactgctcc tgaaaagcta ttttttccaa tgctccagcg gcaaatatag 8580

catgttctgg tacatttgtc ttataattta caaaatggtg agcttctgac ttcttgaact 8640

cattgtaggt actgttttcc actgagacat ttgcaatggg tgtcaatgca ccggcaagaa 8700

cggtgagatt ctatttttta tttagggttt caatgctttg gcatcttgaa caaatcactc 8760

tagtatctac tatctaattc tatgttttgt ggcacctctt gcattctact tcctacatat 8820

taattttacc tgtgttcctg caaccatggg aacaaaattt atttcaaatt ttcctgtgga 8880

tgaaaccgtc tcttctacat tcattgtgtt ttcaaggaag ctgctacctg ggttaatcat 8940

ttgtatttag caatctagtt ttctcgaaca tgcagaagag ctgcatatca ttatatcaaa 9000

aagaaaaatg cgacaagaac tcaaacaccc acaagaaccg acacataccc cacactgctg 9060

gttcctagaa aaggcaatct atttttctat gttggcacta tgaattgcag gcgggtatgc 9120

tgtgggacca atttttatgt actagagcat ctccacgggt tttgtaaaac aactcccaat 9180

tttaatattt tagcaaaaag ggaaaaaagt gcactccaac agtttggtaa aagagctctt 9240

taaaaataaa aagatgccaa atatcctttc caacttttaa gtttctgcag ctgagaggaa 9300

ctccgtatcc gctccccgtt cggcattttt attgggagag attggagtaa atcggacaca 9360

tgcgttaatt gtggaaataa acggttcaag atgagaaagc gtaagagaca gaaactatta 9420

aaaatgatta attaataata gtttggggtt cccaatgcaa aatcatttag gaagctatta 9480

ttggaaactg ttggagaagg acaaaattta agtgtaggaa ggagagattg tgtgctgctg 9540

tgctcatggc ctaaccatcc ttgtaatttg ggctgacctc gtggtcaccc ctttttattt 9600

cttcttaatg caatgacttg cagctctcct gcggtgttct aaaaaaatag atgggattgg 9660

atgattgatt gtattgcatt gagcatggtt taaaaggcgg ctaggcggaa ctaggcgccc 9720

agccaccgcc tgaccgccta gaggcgactt aggcgggcgc ctaggcgacg ccttagtagc 9780

tgttacaaac agctgttaca aaataccaag caaccaaaca gctgttacag ctcataaact 9840

agaaatcatc acaaattgac aatagcacaa tagtggatct gaaatagcca caaagtagtt 9900

tctaaaggaa caatagcaag tcacaaaatt taaaacagca caataccaaa tctgaaatag 9960

ctacatagat agtttgtaat ggcataatta atagtaacta gctgcagtta gtaatgcagc 10020

aaatatgcta atgcaatcta gcaatagcta ctctccccgt ctcccgtcgc tcaaaaatca 10080

tcatcaaact ctcctgggat attgggtgcc tccccttctt caccatcatt gccaccatta 10140

gattcatctt cacaatctgt gatttctgca tcgtcatgtg gaacatcttc ttcatcttca 10200

tcttcctctt cagcctgcag caacataatt tcttcttgaa tacatattat gggcccttct 10260

tggtaagttt cggccacgaa gtgcttgtga tgctccaatg gcattatcca caaggtccca 10320

tgtaaggtca cactcacacc cacgcccacc ttcagggact acatgcaaag aatcagccca 10380

ctcattgtcc cagttgaagt cctcatgaac caatggatca aagtttttcc ccttcttctg 10440

gcgtagtttt tggaacctag ctttcatctt tctgttgtag gaaatgaaga caatagaatt 10500

caacctctta tgcaacaatc ggtttctttt ctttgtatgg atctacaaaa taagaaaaga 10560

gaaaacactt ggtcatttaa tcctgaaata ttggatacaa aagtagccaa gtaggtggat 10620

gaggacttga ggaggcacac ataataactt acaaattcaa aggtactcca tatgcccctg 10680

ccaaatgttg ctttaacctc tttatccctc cactaacaac ctgaccacat agggtgcatt 10740

ccaccttatc tttattttga agatctggcc aaaatccata cttccaccct ggatcagtag 10800

acttccgtgg cttccgggta ggatcgctct tcgggtcgta ctcaccagcc acagaagatg 10860

gagcctcatt tcgagaagac attatgttgt cggcttgtcg ctagtcgatg cagtcgctgc 10920

acagtctaaa aacaggggaa gcaggggatg agaaaacagg ggaagcaggg gaggagggga 10980

tgagaaacgc ggggagtagg acttaccagc aggcagcagc tagcacagca gtctcgagcg 11040

tgcgcggcca gggagcagca gccgtgccca gcagcagccg cgcgcaggga gccgcgcgca 11100

gggagcaaag ggagccgcgc gcagggagag agcgcgcaca ggggattgag cgcgcgcagg 11160

ggagagtagc cgcgcgccca gagcagcagc cgcgagcgcg cgcagggaga gggagagcgc 11220

gcgagagaga ccgcgcgcag ggagatttgc cgcgcgcaga gaaatttgcc gcacgcaggg 11280

cgctgaaatt tgccgcactg aggggagaga gcgcgcgcac agggaagccc aaaacgcgcc 11340

taaagcccag tgcaaaccct aacccaatgc aaaccctagg ctaaggcgtc gcccagaggg 11400

agaaaggcgt cgccgagacg cctaccgcgc ctaggcagac gccatactca atgtcacctg 11460

ggcggcgcgg acgcctagcc aaattcgtcg cctggatgcc taggcgtcgc ctaggcgacg 11520

ccttttaaac aatggcattg agccctcggg ccggtatata taggagtaca agacttggga 11580

ggcaagagtc ctccccggat acatatggca gtcctaggta cacacgattc ctagagatat 11640

acgatatcca atactaccaa ttgtactcta tcattaagat tgctatttct actgttaact 11700

tggcaggtct attagtttag caagtagatt ataccaaact cctggagatg ctcttatctt 11760

accaacatat tctgttgttt gctgttcttg cacttgatgc attgcccagt gtttctttgt 11820

tggaaagata aatcatttta acatagatgc ttgagatgac agatgcaggg gcgacgccag 11880

ggagggggca gaggggggca atgtcccccc cccccccaaa aaaaaaaaac ctggctcctg 11940

gcttcgcccc tggacagatg catgccttaa tttccttgtt tctttttgca catttggact 12000

gagataactg taactgtgca taggtcgcac ttgctttttc catgcccttt taaactcagg 12060

attatgaagc tagctctgag cctatctcag ttttgaccca acaggttgtg tttgattctt 12120

taagaaagtt tgatggaaaa gaacaccgga aattgcttcc aggggaatat atacaaatgg 12180

ctgggcgagc tggtcggaga ggacttgata acattggtac tgtgatcatt atgtgtcgtg 12240

atgaaattcc tgaagaaagc gatttgaaaa atttgatcgt tggaaaacca actcgtttgg 12300

aatctcaatt tcgattaaca tacaccatga tactacatct tctgcgtgtg gaggaactga 12360

aggtatacca ttatgtttcc ctggttagat atgtttatat tttcacttct caacttcata 12420

ttttaatgtg gaactgtacc tgggtctgcc tacacatttg aaaccttgga gaacgaattt 12480

ttttgacaag acatttatgt tgctcctgca gcagtgctca tatcatcctc tgttctatta 12540

aaaatacttt gtctgtgcgt gtgcatttct gcaataatga catcccctat ttattcagca 12600

tgaattatag ttgtgtaata atatttatag caatactagt atactactac tgtccttgta 12660

cagttttgct ctatatgata acccattgtg ctcttgggat gccacatggt agctgagcac 12720

caggtgaagc cttatcagac tactgtgcca ctaccctcaa ggcattaact cggctggtag 12780

gggaaagacc gctcccactg tattatatta agaagaagct caattggagc cctgaccgag 12840

aaatgtcacg aaagttggtc ccccctgcaa catgagggtc tgccccctat gggctagatc 12900

tttactcgtg ctttgagcct cccagcccct acacgaggat cttagttcca aggctgtcat 12960

tgattgacta tctgctcaat actgtacatt ccactgtttt tatgtttact gttataatta 13020

tgggtgacaa tgtgctctca attttacact ataaaattta aggatccaat cagattagga 13080

tcgagctcta ttcctgttca tttttgaact aaaattattt aagggatcaa acaaattatg 13140

aagaaatatt tggatcgcga tccattacca cccctagtta taattggcac tgatctttta 13200

tgggcaaagg atgaaaacac aatcaatttt actttcagtt gaaatgtact cattacacaa 13260

cattgttaat taaatttaga tcaaaataag aacttgtcac tctttagtag attagcataa 13320

tacaagctga ctattctaga tgggcatggt cacacctttt tatgcataag taagttttat 13380

gagcatttgc actccaatag ttagcttttg gagatcaagt tttcaaattc acaatctatc 13440

agcattttta aagccacaaa gtggaataag cttttccaaa aatcgaagct caaagaaaac 13500

aggcccttag tcatgctcat gcataagtac tttcatctca agtgcacaat gtgtcagttg 13560

taactagata ctttacctaa cttccccatt tttatttctg aaaccgcttg aagagtacat 13620

tgtgtacacc cttaatcatg catagggaaa gtaatatact gtaacatttt ttttcatagg 13680

tcgaggacat gctcaagaga agttttgctg aattccacgc acaaaagaat ttgcctgaga 13740

aggaaaagct tcttctgcaa atgcttcgtc aacctacaag gacaatagag tgagcacaaa 13800

cactaactga tttttacctg attgtttcaa tgggtaccaa cacttgcata gaatataaaa 13860

ctcaaagaag taaagtttca tggaactatc actgctgctt tagcacaata aagtgacaag 13920

caaaaatcaa aatactgata atggaaaaca ccatttcttc ctagaatctg acctttgtaa 13980

acattaacac aagtaaacta tctagtaatc ttgtagtatt attttatagc gcagtttagg 14040

agtagtcatg attgtttggt tacaagattg cagaaatgtg gatactgaac ctagataggc 14100

ttagttagaa ctgtgcattc attgcacatg tgaagactag aaatgtgggc atttttccgt 14160

gcataaagtt gcaacaaagt ttatttcata atttctttgt cgtacatttg tcaatgtttt 14220

agggcctgtt tggatgcata ggactaattg ctactgggct agtgtttagc cttagcccat 14280

ccaaacaggg ggctaatcgg tgggctaatt ttttcgccaa gcgtccaact aattgttagt 14340

caagtagctg gccaacccta actaatttgc gctaattttt atccctagct aatccaaaca 14400

ggcccttgca agcattcatt gtacatttca agtactgaca aagtttagta tccaatctct 14460

atatgcacta atcttagttt ttttaatctc tttgccttgt attatgtatt cttcgattat 14520

caggtgcata aaaggagagc cttctattga ggaatactac gagatgactt tagatgctga 14580

ggcacacagg gaatacataa cagaagcaat tatgcagctg cctaattctc aacagtttct 14640

tacgcctggg agattggtgg ttgttaaatc tgattctgta tgtattcatc atatttggtt 14700

ctctttacac acgtctgcag tttttttgcg attattttta tttatgttct attactctac 14760

taaccaccat tcaactgcta taaaactcac taaaaactgt cttccacttt gggtctttat 14820

tagcaagcat acaaaagtag tgcacacaga atatgggaaa ttagaacaaa caaaaacaat 14880

ttatgttgga aaaggaccta ttgataaaca agcaccgaat atctgagacc aagctccaaa 14940

gagaattact aaaaatcatg tgagttccat gtacaccatg atattagctt ggtcttctcg 15000

agctttaaat cagcttgatc ttatcatatt cctggttcaa gcggaactaa ctccataaga 15060

tctcaacttg tgcttactgc tttagagctt ctttctgata actaaaattg accaggaaat 15120

ttaagtaagc tactttagga agttccatta tcttgttttg caggccacca ttatattatt 15180

ggcaccataa ccatatgtac aaaagcatga ctgttttgaa attatgatgc tctactactg 15240

tctaagggtt actgtgaatg tgcgatagtt acatttttcc acatttaaac gctgtgctat 15300

ttgaacatat tggcaggatg atgatcactt gcttggtgtt atactgaaaa atccatctgc 15360

attgctaaag aaatatgttg ttctggtatt gactggtgat tgcagttcat ctgcactagc 15420

ccctgagttc aataaaaatg aaaagggtcc tgtggatttt caaggaggac aatttattgt 15480

cctgaaagga aaacgtggca tggacgatga atatttctct tctgttagtt cacgaaaagc 15540

ttcaggtgta atcaatatca atctaccata caagggggat gcatctggaa tgggctttga 15600

agtaagagca attgagaata aagaaatcat tagtatatgc agcagcaaaa taaagattga 15660

tcaagtcaga cttcttgagg agcctaacaa aactgcatac tctagaactg tccaacagct 15720

tataaaggag caaccagatg gaaccaagta tcctcctgct ttagatgcaa taaaaggtac 15780

aaattttctg catgtcttga ctatcttgtg caattatatg ttctgtgtct aggaaattct 15840

tagtttatag cctgtgaagt tcactaactt tctgacaaag tatatactgc cctagttaga 15900

gggaaggatg gtagtaatat aatcatatat gttttattta cttctttttt tttggactct 15960

gatcattgtt gtgcactggt gcgtcattta ggccctactc ttgacttctc tagttgattc 16020

atatacttta tatatagctg tttaatgtgt ccacacgatg caatgcagat ctaaaaatga 16080

aagacatgta tcttgttgaa agttaccgtg catatcacat actactgcaa aaaatgtctg 16140

aaaacaagtg ccatggttgt ataaaactga aggagcatat atcattgatg agggagcaaa 16200

agatgtacaa ggatcagttg aatgaattga aattccaaat gtccgacgag gcacttcaac 16260

aaatgccaga gtttcaaggc agagtaagat tccttcatgc acagttttcc tcgtcttgtg 16320

tcctattgtg tgcctgaaga gaaaaaaaag ttaatgtatt atggtcattg tctctgcaac 16380

atggaaaaat aataacaata ttgtcatttc tttatttttt ttgattgagt atacatggga 16440

gatctttctg gttccagctc tatcgcagta ctgtaccagg agaacagttt ggacatggat 16500

tctgattctg aatattgggc ttaatatgtt aatgttgtat ccacgcaatc catgaaagat 16560

caggaagctg cacatttgta ttgttgttgt taattcattt tctttattta tttaacatgg 16620

aatggttata gggctattat cagcattttc aagactgaaa ttttattccg tgaaccacat 16680

ctgacttcat tcctgtaatt tgaagtactt tgctaacacc ttaatctttt gcagattgat 16740

gtactaaagg taatccacta cattgattct gatctagttg tgcaacttaa gggtcgggta 16800

gcatgtgaaa tgaactccgg tgaggagtta atatcaacag aatgtctgtt tgaaaatcaa 16860

ttggatgacc tagaacccga agaagctgtg gctattatgt ctgcattcgt cttccaacaa 16920

cgcaatgctt cagaaccatc tcttactcca aaactggctg aagcgaagaa gaggttagac 16980

aaattttttt ttgctcccat aatttgactc gtgctatggt tcttttgata acctcaatta 17040

tattttctga gaagccacgt ctcaaacacg ttttgctcgt gtgtttttct atatgtatta 17100

ttaggctcta tgatacagcc ataaaattag ggaagctcca atccgagttc aaggtgcctg 17160

tggaccctga agagtatgca cgtgataatc tcaagtttgg ccttgttgag gtcgtctacg 17220

agtgggcaaa ggtatactcg tcttcaggag aattcgtctc caagatatat gcaggctgca 17280

ggattataac gctgtcactt gttatattat atcaatgcag gggacgcctt tcgcagacat 17340

atgcgagctg actgatgtat ccgaagggat cattgtaaga acaatcgtcc gtctggacga 17400

aacatgtagg gaattcagga atgcagcttc catcatgggg aactctgcgc tgttcaagaa 17460

gatggaggtc gcgtctaacg ctattaagcg tgacattgtg tttgcagcaa gtttgtatgt 17520

cacaggaatc tgatgcatgt aacctcgtag tctcccttgc ttcttttgtt agagaaatcg 17580

ttgtgctggt ggaatgctac taacctaacc ttagctagaa caattgttgt ggtatttttt 17640

tttccagttc tggattattg cttttgctag ttttgcgaag ttttctgaag cggcgaccag 17700

cagagtaaag gaaaatcgaa agcgggtggg attctcgttt ttttttca 17748

<210> 2

<211> 4239

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgtccatgg acggccctgc cacctcgccg gcaagcgagg tgccgttccg catcagcttc 60

tccggccaca gcggccacct ccgcctcgac cctaccccgc acacgcccag ccccattccg 120

gacttcgtcc tgccgccggc atacccggcc gagagcccga gcagcgtgaa ggagtacctc 180

gagaggaact acctcgaccc cgagctgcac ctccccaccg cggccgatag cgggagggtg 240

tgggatgtcg actggtttgc cctggccagg ccgccgctgg agccctccgc cccccgcacc 300

atgctcgcgc ccgtctgggt gccgcctttc cggcgcgggc aggagaagtt gcaatccgcg 360

gcagagtcgc gagtgtggga ccctgagtcc gtgcaaatgg agatggtcga cgtgttcgat 420

tcggggaccg gggggatagc gccccggatg cctggtccgg cgaaggactt cgtcaggggg 480

agcatcaaca acagaccttt tcgtccaggc ggtctgcagg atgacgccgc tgaggcggct 540

gcgctggaaa aggcgttccc agagggtgca aggactggtg attgggtgcg tgagctcatg 600

agcggtggcc cggcgcaggt tgcgcctcca gggttccgta agggattgga gctgggccag 660

ttgaaggggt atgaaagcca ctggaagtgt ttccgggatg gagaacttgt agaggagcaa 720

cctgcatcat catcgaatga cacaatggag aagtactctg tgcagtttga tgatcttttc 780

aagatagcgt gggaggaaga tactgccaac aagttgttga aggacggtgt tgttcaacaa 840

tctgctgaag gtgaaggaat caatgaaatt ggcgaacaaa aagttgatgc attgcaggat 900

gagttcgaga gtataacaac gctagatgac gagaaacagg aagttgatgt cataagaaat 960

gttcctgaaa ctcaaacaga cttggatcag atgttatctt ctgaagtaca ggatacaggc 1020

agggaaccag gtgcatcagg tgataagaag ccaacacaag atggcatggt ttgggcactt 1080

gttggtgggg acgaggacat agtgactaac ttctccaaac tcgttccaga tatggcaatc 1140

gagtttccat ttgaattgga taagttccag aaggaggcta tatattatct cgagaagggt 1200

gaatcagtct ttgttgcagc ccatacttca gctggaaaga cggttgttgc tgagtatgca 1260

ttcgcattag caacgaaaca ttgcactagg tctgtctata ctgctcctat taaaactatc 1320

agcaaccaga aatacagaga tttttctggg aagtttgatg tgggacttct gacaggagat 1380

gttagcatca ggccagaggc aacttgctta attatgacta ctgagatatt gcgttcaatg 1440

ctctacagag gcgcagacat tatacgtgat attgaatggg taatctttga tgaagtgcat 1500

tatgtaaatg atgctgaaag aggtgtagtc tgggaggagg tcattataat gctcccgaag 1560

cacattaaca ttgttcttct ttcggcaacg gtcccaaata ctgttgaatt tgctgactgg 1620

attggtcgga caaagcagaa gaaaattcgt gtcacatctg agcggtatat ggaatctacc 1680

ttgctagaaa agtactgctt atatcatttt ggtcatcatg tgttcaccag gaccaacaaa 1740

aggcctgttc cacttgagca ttgcctgttc tactctggag aagtgtacaa aatatgtgag 1800

agggatatgt ttcttgctca aggatttaaa gaagcaaaag atgctttcaa aaagaaaaat 1860

ttgaataagt ttggagtgaa acctggttca aagtcaggaa cccctgcagt acgtgctgga 1920

actcaaggca aaaatccaga tacatccaac aaggggagag atcaaaagta cccaaagcac 1980

cgcaattcca attcaggagt agccacagtt caacagagct cctcagggcc aaagagattt 2040

gaatctttat tttggatgcc acttgtgaat aaccttctga agaaatccct tgtgcctgtg 2100

gtgatttttt gtttctcaaa gaatcgctgt gataaatcgg cagatagtat gtttggcact 2160

gatctcacca gtagttcaga gaaaagtgaa atacgtgtct tctgtgacaa ggcattttca 2220

cgtcttaaag gatctgatag gaaccttcca caggttgtag gaatacaaag ccttctgcga 2280

agaggaattg gagtacacca cgctgggctt ctccctattg tgaaggaagt tgttgagatg 2340

ctgttttgcc gtggtgtaat caaggtactg ttttccactg agacatttgc aatgggtgtc 2400

aatgcaccgg caagaacgga ttatgaagct agctctgagc ctatctcagt tttgacccaa 2460

caggttgtgt ttgattcttt aagaaagttt gatggaaaag aacaccggaa attgcttcca 2520

ggggaatata tacaaatggc tgggcgagct ggtcggagag gacttgataa cattggtact 2580

gtgatcatta tgtgtcgtga tgaaattcct gaagaaagcg atttgaaaaa tttgatcgtt 2640

ggaaaaccaa ctcgtttgga atctcaattt cgattaacat acaccatgat actacatctt 2700

ctgcgtgtgg aggaactgaa ggtcgaggac atgctcaaga gaagttttgc tgaattccac 2760

gcacaaaaga atttgcctga gaaggaaaag cttcttctgc aaatgcttcg tcaacctaca 2820

aggacaatag agtgcataaa aggagagcct tctattgagg aatactacga gatgacttta 2880

gatgctgagg cacacaggga atacataaca gaagcaatta tgcagctgcc taattctcaa 2940

cagtttctta cgcctgggag attggtggtt gttaaatctg attctgatga tgatcacttg 3000

cttggtgtta tactgaaaaa tccatctgca ttgctaaaga aatatgttgt tctggtattg 3060

actggtgatt gcagttcatc tgcactagcc cctgagttca ataaaaatga aaagggtcct 3120

gtggattttc aaggaggaca atttattgtc ctgaaaggaa aacgtggcat ggacgatgaa 3180

tatttctctt ctgttagttc acgaaaagct tcaggtgtaa tcaatatcaa tctaccatac 3240

aagggggatg catctggaat gggctttgaa gtaagagcaa ttgagaataa agaaatcatt 3300

agtatatgca gcagcaaaat aaagattgat caagtcagac ttcttgagga gcctaacaaa 3360

actgcatact ctagaactgt ccaacagctt ataaaggagc aaccagatgg aaccaagtat 3420

cctcctgctt tagatgcaat aaaagatcta aaaatgaaag acatgtatct tgttgaaagt 3480

taccgtgcat atcacatact actgcaaaaa atgtctgaaa acaagtgcca tggttgtata 3540

aaactgaagg agcatatatc attgatgagg gagcaaaaga tgtacaagga tcagttgaat 3600

gaattgaaat tccaaatgtc cgacgaggca cttcaacaaa tgccagagtt tcaaggcaga 3660

attgatgtac taaaggtaat ccactacatt gattctgatc tagttgtgca acttaagggt 3720

cgggtagcat gtgaaatgaa ctccggtgag gagttaatat caacagaatg tctgtttgaa 3780

aatcaattgg atgacctaga acccgaagaa gctgtggcta ttatgtctgc attcgtcttc 3840

caacaacgca atgcttcaga accatctctt actccaaaac tggctgaagc gaagaagagg 3900

ctctatgata cagccataaa attagggaag ctccaatccg agttcaaggt gcctgtggac 3960

cctgaagagt atgcacgtga taatctcaag tttggccttg ttgaggtcgt ctacgagtgg 4020

gcaaagggga cgcctttcgc agacatatgc gagctgactg atgtatccga agggatcatt 4080

gtaagaacaa tcgtccgtct ggacgaaaca tgtagggaat tcaggaatgc agcttccatc 4140

atggggaact ctgcgctgtt caagaagatg gaggtcgcgt ctaacgctat taagcgtgac 4200

attgtgtttg cagcaagttt gtatgtcaca ggaatctga 4239

<210> 3

<211> 450

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Ser Met Asp Gly Pro Ala Thr Ser Pro Ala Ser Glu Val Pro Phe

1 5 10 15

Arg Ile Ser Phe Ser Gly His Ser Gly His Leu Arg Leu Asp Pro Thr

20 25 30

Pro His Thr Pro Ser Pro Ile Pro Asp Phe Val Leu Pro Pro Ala Tyr

35 40 45

Pro Ala Glu Ser Pro Ser Ser Val Lys Glu Tyr Leu Glu Arg Asn Tyr

50 55 60

Leu Asp Pro Glu Leu His Leu Pro Thr Ala Ala Asp Ser Gly Arg Val

65 70 75 80

Trp Asp Val Asp Trp Phe Ala Leu Ala Arg Pro Pro Leu Glu Pro Ser

85 90 95

Ala Pro Arg Thr Met Leu Ala Pro Val Trp Val Pro Pro Phe Arg Arg

100 105 110

Gly Gln Glu Lys Leu Gln Ser Ala Ala Glu Ser Arg Val Trp Asp Pro

115 120 125

Glu Ser Val Gln Met Glu Met Val Asp Val Phe Asp Ser Gly Thr Gly

130 135 140

Gly Ile Ala Pro Arg Met Pro Gly Pro Ala Lys Asp Phe Val Arg Gly

145 150 155 160

Ser Ile Asn Asn Arg Pro Phe Arg Pro Gly Gly Leu Gln Asp Asp Ala

165 170 175

Ala Glu Ala Ala Ala Leu Glu Lys Ala Phe Pro Glu Gly Ala Arg Thr

180 185 190

Gly Asp Trp Val Arg Glu Leu Met Ser Gly Gly Pro Ala Gln Val Ala

195 200 205

Pro Pro Gly Phe Arg Lys Gly Leu Glu Leu Gly Gln Leu Lys Gly Tyr

210 215 220

Glu Ser His Trp Lys Cys Phe Arg Asp Gly Glu Leu Val Glu Glu Gln

225 230 235 240

Pro Ala Ser Ser Ser Asn Asp Thr Met Glu Lys Tyr Ser Val Gln Phe

245 250 255

Asp Asp Leu Phe Lys Ile Ala Trp Glu Glu Asp Thr Ala Asn Lys Leu

260 265 270

Leu Lys Asp Gly Val Val Gln Gln Ser Ala Glu Gly Glu Gly Ile Asn

275 280 285

Glu Ile Gly Glu Gln Lys Val Asp Ala Leu Gln Asp Glu Phe Glu Ser

290 295 300

Ile Thr Thr Leu Asp Asp Glu Lys Gln Glu Val Asp Val Ile Arg Asn

305 310 315 320

Val Pro Glu Thr Gln Thr Asp Leu Asp Gln Met Leu Ser Ser Glu Val

325 330 335

Gln Asp Thr Gly Arg Glu Pro Gly Ala Ser Gly Asp Lys Lys Pro Thr

340 345 350

Gln Asp Gly Met Val Trp Ala Leu Val Gly Gly Asp Glu Asp Ile Val

355 360 365

Thr Asn Phe Ser Lys Leu Val Pro Asp Met Ala Ile Glu Phe Pro Phe

370 375 380

Glu Leu Asp Lys Phe Gln Lys Glu Ala Ile Tyr Tyr Leu Glu Lys Gly

385 390 395 400

Glu Ser Val Phe Val Ala Ala His Thr Ser Ala Gly Lys Thr Val Val

405 410 415

Ala Glu Tyr Ala Phe Ala Leu Ala Thr Lys His Cys Thr Arg Ser Val

420 425 430

Tyr Thr Ala Pro Ile Lys Thr Ile Ser Asn Gln Lys Tyr Arg Asp Phe

435 440 445

Ser Gly

450

Claims (8)

1. A gene encoding a DExD/H-box RNA helicase protein, wherein premature termination of the coding cassette results in defects in both seed development (below normal grain weight) and plant establishment (leaf albino, dwarfness, seedling lethality), wherein the DNA sequence of the gene ZmRH4 is the following DNA sequence of 1) or 2):

1) a DNA sequence shown as SEQ ID NO. 1;

2) the cDNA sequence shown in SEQ ID NO. 2.

2. Use of the protein encoded by the novel gene ZmRH4 in the use according to claim 1 for improving corn, characterized in that: inhibiting the expression of the gene ZmRH4 so as to make the function of the protein coded by the gene lost, wherein the protein is composed of the amino acid sequence shown as SEQ ID NO. 3.

3. The use according to claim 1, wherein the inhibition of the expression of the gene ZmRH4 lays a foundation for inducing the structural change of corn embryo and endosperm to regulate the function of corn kernel development, and provides a reference for corn yield and kernel type improvement, and the gene is used for production of high-quality corn breeding and the like.

4. A functional marker ZmRH4-1 of a maize granule mutant ZmRH4, which is characterized in that the functional marker includes but is not limited to a first primer ZmRH4-1F and a second primer ZmRH4-1R,

ZmRH4-1F：ATGTCCATGGACGGCCCTGC，

ZmRH4-1R：GGGAGACTACGAGGTTACATGCATCA。

5. a functional marker Zmrh4-2 of a maize granule mutant Zmrh4(ems4-668a4), wherein the functional marker includes but is not limited to a first primer Zmrh4-2-F and a second primer Zmrh 4-2-R:

Zmrh4-2-F：TCCCTTGTGCCTGTATGTGAG，

Zmrh4-2-R：ACTGTGTACGGTAAAGGTTGC。

6. a functional marker ZmRH4-3 of a maize granule mutant ZmRH4(ems4-66898), wherein the functional marker includes but is not limited to a first primer Zmrh4-3-F and a second primer Zmrh 4-3-R:

Zmrh4-3-F：ACTGTGCATAGGTCGCACT，

Zmrh4-3-R：AGACCCAGGTACAGTTCCAC。

7. the molecular marker of claim 5 and 6, which is designed according to the mutant site of the mutant gene ZmRH4 of a maize granule mutant ZmRH4, is a functional molecular marker, and the marker sequencing detects that the heterozygous site represents the existence of the mutant gene ZmRH 4.

8. The molecular markers of claims 5 and 6, which are also wild-type gene ZmRH4, can be detected to be positive according to the difference with the sequencing result of the mutant, and represent the existence of wild-type gene ZmRH 4.

Images