CN113151303B

CN113151303B - Cabbage stem cell determination related gene BrWUS1 and application thereof

Info

Publication number: CN113151303B
Application number: CN202110557991.3A
Authority: CN
Inventors: 余小林; 周芳园; 孔李俊; 赵坤; 宋建伟
Original assignee: Wuxi Dimode Biological Seed Industry Technology Co ltd; Zhejiang University ZJU
Current assignee: Wuxi Dimode Biological Seed Industry Technology Co ltd; Zhejiang University ZJU
Priority date: 2021-05-21
Filing date: 2021-05-21
Publication date: 2022-07-05
Anticipated expiration: 2041-05-21
Also published as: CN113151303A

Abstract

The invention provides a cabbage stem cell determinant gene BrWUS1 and application thereof, belonging to the technical field of plant genetic engineering. The DNA sequence of the cabbage stem cell determinant gene BrWUS1 is shown in SEQ ID No. 1. The gene is transformed into Columbia arabidopsis thaliana by an agrobacterium floral dip transformation method to obtain a BrWUS1 heterologous expression arabidopsis thaliana strain, and the result shows that the heterologous expression of a cabbage stem cell determinant gene BrWUS1 can cause the number of arabidopsis thaliana leaves to be increased, the leaves to be reduced, the number of branches to be obviously increased, the root length of primary roots to be obviously shortened, the pollen activity to be reduced and ectopic floral organs to be generated. This shows that the cabbage stem cell determination related gene BrWUS1 plays an important role in the aspects of meristematic activity, leaf blade, primary root, flower organ and stamen development, and the gene can be applied to the breeding of cabbage vegetables and other horticultural plants, and has a good application prospect.

Description

Cabbage stem cell determination related gene BrWUS1 and application thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a cabbage stem cell determination related gene BrWUS1, an encoding protein thereof and application thereof in a plant breeding process.

Background

Chinese cabbage (Brassica rapa L.syn.B.campestris L.) belongs to Brassica Brassica species crops of Brassicaceae, is rich in nutrition, has strong resistance to low temperature, and has extremely high economic value in production. And the plant has a close relationship with the model plant Arabidopsis thaliana which is also a cruciferae, and has important research significance in plant basic science. Different crop products have different organs, and can be respectively root vegetables, stem vegetables, leaf vegetables, flower vegetables and fruit vegetables according to edible parts, and Chinese cabbage is an important leaf vegetable. Furthermore, the primary root of the plant is an essential component of the root system and is essential for the early growth and survival of the plant. The leaves of the plants are the places where the plants perform photosynthesis and are also important product organs of the Chinese cabbages. Likewise, the floral organs of a plant are critical to the reproductive development of the plant.

Meristematic tissue is the basis for the production and differentiation of other diverse tissues by plants. In the vegetative growth stage of the model plant arabidopsis thaliana, the plant relies on the Shoot Apical Meristem (SAM) for morphogenesis of the above-ground parts, while relying on the Root Apical Meristem (RAM) for morphogenesis of the below-ground parts. Under appropriate environmental conditions, vegetative growth is shifted to reproductive growth, while the properties of SAM are also transformed into Inflorescence Meristem (IM), which in turn initiates a Floral Meristem (FM) in the peripheral region of IM. WUSCHEL (WUS) encodes a transcription factor containing a homeobox, which is expressed in tissue-centered cells in the central region of the meristem, and which inhibits cell differentiation, and is important for the maintenance of stem cells at the top of the meristem and for promoting meristem activity. Its proper spatio-temporal expression is essential for normal vegetative and reproductive growth of plants.

Disclosure of Invention

The invention aims to provide function and expression analysis of a cabbage stem cell determination related gene BrWUS1 aiming at the defects of the existing breeding resources.

The invention provides a stem cell determinant gene, which is as follows: a gene cloned from Chinese cabbage 'Chiifu-401-42' and having:

1) a nucleotide sequence shown as SEQ ID No. 1; or

2) The nucleotide sequence shown in SEQ ID No.1 is substituted, deleted and/or added with one or more nucleotides;

the invention provides a biological material containing the cabbage stem cell determinant gene BrWUS1, which is an expression vector, an expression cassette, a host cell or an engineering bacterium.

The invention provides an application of a cabbage stem cell determinant gene BrWUS1 in the excitation of plant meristem activity, which comprises the regulation and control of plant leaf development, branch number, primary root development and the like, wherein when the cabbage stem cell determinant gene BrWUS1 is over-expressed in a plant, the plant leaf becomes small, the branch number is obviously increased, the root length of the primary root is obviously shortened, and the pollen activity is reduced.

The invention provides an application of a cabbage stem cell determinant gene BrWUS1 in the stimulation of plant male abortion.

The invention provides an application of a cabbage stem cell determinant gene BrWUS1 in preparation of transgenic plants.

The sequence of the cabbage stem cell determinant gene BrWUS1 provided by the invention is shown in SEQ ID No. 1. The gene is introduced into arabidopsis thaliana by an agrobacterium-mediated method to obtain a transgenic arabidopsis thaliana strain with the cabbage stem cell determinant gene BrWUS1 heterologously expressed, and the result shows that the heterologously overexpressed cabbage stem cell determinant gene BrWUS1 can cause the number of arabidopsis thaliana leaves to be increased, the leaves to be reduced, the number of branches to be obviously increased, the root length of the primary root to be obviously shortened, the pollen activity to be reduced and ectopic floral organs to be generated. The result shows that the cabbage stem cell decision gene BrWUS1 has close relation with the activity of plant meristem, the vegetative growth and the reproductive growth of plants, and the gene has good application prospect when being applied to breeding of cabbage or other cruciferous vegetables.

Drawings

FIG. 1 is a CDS clone PCR electrophoresis picture of cabbage stem cell determinant gene BrWUS 1. Wherein M is DNA marker, and lane 1 is the target fragment amplification product;

FIG. 2 is a schematic diagram of BrWUS1 overexpression vector, subcellular localization vector, promoter and GUS fusion expression vector. (A) Schematic representation of BrWUS1 overexpression vector; (B) schematic representation of a BrWUS1 subcellular localization vector; (C) schematic representation of fusion expression vector of BrWUS1 promoter and GUS.

Fig. 3 shows the results of subcellular localization of BrWUS 1.

FIG. 4 shows histochemical staining results of positive Arabidopsis plants transformed with the fusion expression vector of BrWUS1 promoter and GUS. A-D are GUS staining results of inflorescences, open flowers, leaves and mature siliques of BrWUS1 promoter fusion GUS transgenic plants respectively.

FIG. 5 is a screen of BrWUS1 heterologous expression Arabidopsis plants. Wherein, the A picture is PCR positive detection of transgenic arabidopsis plants. B is the detection of the relative expression level of BrWUS1 heterologous expression Arabidopsis plants.

FIG. 6 shows the vegetative growth of BrWUS1 heterologously expressed plants compared to control plants. (A-B) control and BrWUS1 overexpressing plants 4 weeks after sowing. (C-F) control and BrWUS1 overexpressing plants 6 weeks after sowing. (G-H) post-sowing 7d control and BrWUS1 overexpressing plant T₂The growth condition of the root system is replaced. (I) Control and BrWUS1 overexpressing plants at 4 weeks post-sowing were counted for leaf number (n-9). (J) Post-sowing 7d controls and BrWUS1 overexpressing plant T₂And (5) counting the generation root length (n is more than or equal to 20). Represents a significant difference (p) from CK<0.05). The scale bar represents 2 cm.

FIG. 7 shows comparison of pollen viability status of BrWUS1 heterologously expressed plants with control plants. (A) The control plant anther alexander staining result is obtained. B is the result of the alexandrite staining of the anther of the BrWUS1 overexpression plant. C is the statistic result of pollen viability of the control and BrWUS1 overexpression plants. Represents a significant difference from CK (p < 0.05). The scale bar represents 300 μm.

FIG. 8 shows ectopic flower organs of plants with heterologous expression of BrWUS 1. (A) Control plants are on the left and WUS1-1 overexpressing plants are on the right. (B-C) WUS1-1 overexpresses plants. White boxes indicate the location of abnormal stems and ectopic floral organs. (D) And B, observing the result by a stereomicroscope at the position of a white frame. (E) And C, observing the result of the stereomicroscope at the position of the white frame.

Detailed Description

The present invention is illustrated below by means of specific examples, wherein technical means not described in detail belong to the conventional techniques well known to those skilled in the art. The examples are only intended to illustrate the invention, but not to limit the scope of the invention, and any other examples obtained on the basis of the examples of the invention by a person skilled in the art shall fall within the scope of the invention without inventive step.

The invention provides a cabbage stem cell determinant gene BrWUS1, which is: the gene cloned from Chinese cabbage of variety 'Chiifu-401-42' has the gene sequence shown in SEQ ID No. 1.

The embodiment of the invention also provides application of the cabbage stem cell determinant gene BrWUS1 in regulation and control of leaves, primary roots, flower organs and stamens thereof, and the specific description is given below.

Example 1: construction of Chinese cabbage BrWUS1 heterologous expression vector

1. Total RNA extraction from plant inflorescence

The method adopts an Omega Plant RNA Kit to extract total RNA from an inflorescence tissue sample of Chinese cabbage 'Chiifu-401-42', and comprises the following specific steps: grinding about 100mg of the sample by using liquid nitrogen, transferring the sample into a 1.5ml centrifuge tube, immediately adding 500 mu L of RB Buffer (added with beta-mercaptoethanol), and violently swirling; centrifuging at 14000rpm for 5min, transferring the supernatant into gDNA Filter Column, and centrifuging at 14000rpm for 2 min; adding 0.5 volume time of absolute ethyl alcohol into the filtrate, and reversing and uniformly mixing; transferring the mixed solution into a Hibind RNA mini column, centrifuging at 10000rpm for 1min, and removing the filtrate; adding 400 mu LRWF Wash Buffer, centrifuging at 10000rpm for 1min, and removing the filtrate; adding 500 μ L RNA Wash Buffer II, centrifuging at 10000rpm for 1min, discarding the filtrate, and repeating once; centrifuging at 10000rpm for 2min, discarding filtrate, and drying column; putting column into clean 1.5mL centrifuge tube, adding 30 μ L DEPC water, standing for 3min, centrifuging at 10000rpm for 1min, discarding column, and storing the obtained RNA in a refrigerator at-75 deg.C.

2. cDNA Synthesis

Adopts TaKaRa PrimeScriptTM RT reagent Kit with gDNA Eraser, and comprises the following steps: genomic DNA was removed first, 2. mu.L of 5 XgDNA Eraser Buffer, 1. mu.L of gDNA Eraser, 1. mu.g of RNA, RNase Free H₂Make up to 10. mu.L of O, and react at 42 ℃ for 2 min. Then, cDNA was synthesized by adding 4. mu.L of 5 XPrimer Script Buffer, 1. mu.L of RT Primer Mix, 1. mu.L of Primer Script RT Enzyme Mix, 4. mu.L of RNase Free H to the reaction mixture of the previous step₂And O, mixing uniformly, reacting at 37 ℃ for 20min, reacting at 85 ℃ for 5s to complete the synthesis of the cDNA, and storing the cDNA in a refrigerator at-20 ℃.

3. Obtaining of target Gene and linearized vector

Specific primers (table 1) are designed to obtain a BrWUS1 gene target fragment (figure 1) through high-fidelity enzyme amplification, and the target gene fragment is recovered from gel after electrophoresis. The pAC007-3 FLAG vector was double digested with Kpn I and Bam H I, and the linearized vector fragment was recovered from the gel after electrophoresis.

TABLE 1 primers used for heterologous expression vector construction

4. Construction of vectors by homologous recombination

The method adopts the Novokexin Clonexpress II One Step Cloning Kit, and comprises the following specific steps: take 4. mu.L of 5 XCEII Buffer, 2. mu.L of Exnase II, 200ng of linearized vector, 20ng of BrWUS1 gene target fragment, ddH₂O is complemented to 20 mu L; reacting in a metal bath at 37 ℃ for 30min to obtain the homologous weightAnd (4) preparing a product.

5. Freeze-thawing method for transforming escherichia coli competent DH5 alpha

Melting DH5 alpha on ice, adding the homologous recombination product, and standing for 30min on ice; heating in a metal bath at 42 ℃ for 90s, and cooling on ice for 5 min; adding 1mL of LB liquid culture medium, and shaking for 1.5h at 37 ℃; centrifuging at 5000rpm for 1min, discarding the filtrate, sucking and pumping the residual bacterial solution of about 100 μ L, mixing, and plating in LB solid culture medium containing chloramphenicol; the medium was placed in an incubator at 37 ℃ overnight with inversion, and a single colony was picked the next day for PCR (primers see Table 2) and sent for assay. After the detection is correct, the plasmid is extracted and stored at-20 ℃ for later use. Verifying and comparing successful heterologous expression vector plasmids (figure 2A) and pAC007-3 FLAG no-load plasmids, transforming agrobacterium-induced GV3101 by a freeze-thaw method, picking spots after single strain grows out for bacterial liquid PCR (primers are shown in table 2), verifying successful bacterial liquid preservation strains and reserving mother liquid for storage at 4 ℃ for later use.

TABLE 2 primers used for PCR detection of transgenic Arabidopsis

Primer name	Primer sequence (5 '-3')
		BrWUS1-OE-F	AAACCTCCTCGGATTCCATTG(SEQ ID No.4)
BrWUS1-OE-R	AGGCGTCTCGCATATCTCATT(SEQ ID No.5)

Example 2: floral dip method for transforming arabidopsis thaliana and screening positive transformant

1. Floral dip method for transforming arabidopsis

100 μ L of activated Agrobacterium strain containing heterologous expression vector plasmid and pAC007-3 FLAG airborne plasmid was added to 30mL liquid LB medium containing 50mg/mL of Rif, Str and Cmr, and shaken with shaking table at 28 ℃ overnight. When the bacterial liquid is cultured until the OD600 is about 1.0, centrifuging at 8000rpm for 10min, discarding the supernatant, resuspending with an isometric resuspension solution (5 wt% sucrose, 200. mu.L/L Silwet L-77), and stirring thoroughly for 2 min. Removing siliques and open flowers from wild Arabidopsis thaliana, immersing inflorescences in the bacterial liquid for about 30s, taking out, drying excess bacterial liquid by using absorbent paper, preserving moisture and culturing in the dark for 24h, and then putting the culture box for normal culture. After one week, the flower soaking is repeated once to obtain more transgenic seeds.

2. Preparing hygromycin screening culture medium

2.215g of dry powder MS519, 10g of sucrose (analytically pure) were taken and dissolved in water. The pH was adjusted to 5.8 with 2M NaOH, 4g of agar powder (purified biochemical reagent) was added, and the volume was adjusted to 500 mL. Sterilizing with high pressure steam at 121 deg.C for 20min, cooling to 50-60 deg.C in a clean bench, adding hygromycin to final concentration of 90mg/L, and pouring into solid plate culture medium.

3. Primary screening of positive transformants

Placing the arabidopsis thaliana seeds obtained by flower soaking transformation into a 1.5mL centrifuge tube, washing the seeds in a super clean bench for sterilization, and sequentially washing 1mL ddH₂Wash once with O, once with 1mL of 75 vol% ethanol, 1mL of ddH₂O washes three times, repeating the entire wash step once. The washed seeds were spread evenly on hygromycin screening medium, and after about two weeks of normal culture, the normally growing plants were removed from the medium and verified by PCR detection (see Table 2 for primers).

4. Real-time fluorescent quantitative PCR detection of relative expression quantity of BrWUS1 gene in transgenic arabidopsis plant

The plants were sampled, 3 rd leaf was selected for each Plant, labeled and fixed in liquid nitrogen, total RNA was extracted with Omega Plant RNA Kit, cDNA was synthesized with TaKaRa PrimeScriptTM RT reagent Kit with gDNA Eraser, and qRT-PCR analysis was performed. Real-time fluorescent quantitative PCR system: SYBR Green Master Mix 7.5. mu.L, upstream and downstream primers (SEQ ID No.8-SEQ ID No.9) 0.3. mu.L each, template cDNA 1. mu.L, ddH₂O5.9. mu.L. qRT-PCR reaction procedure: 95 ℃: 30 s;(95 ℃ C.: 5 s; 57 ℃ C.: 45s)40 cycles. AtActin7 was selected as an internal reference gene (qRT-PCR primers are shown in Table 3).

TABLE 3 fluorescent quantitative PCR primers for positive detection of BrWUS1 transgenic plants

Primer name	Primer sequence (5 '-3')
		q-AtActin7-F	GGAACTGGAATGGTGAAGGCTG(SEQ ID No.6)
q-AtActin7-R	CGATTGGATACTTCAGAGTGAGGA(SEQ ID No.7)
		q-BrWUS1-F	ACAACGTAGGTGGAGAGTGG(SEQ ID No.8)
q-BrWUS1-R	AGCATCGCCACCATAGTCTC(SEQ ID No.9)

The results show that 20 Arabidopsis plants screened by the hygromycin screening medium are all positive transformants with heterologous expression of BrWUS1, and the heterologous expression levels are all high (FIG. 5).

Example 3 detection of nutrient leaf, root length variation and pollen viability of BrWUS1 heterologous expression plants

1. Growth observation of transgenic plants

The BrWUS1 overexpression positive plants obtained by screening and the positive plants (control plants) transformed in the empty load are cultured in an incubator (the temperature is 25 ℃/22 ℃, the photoperiod L/D is 16h/8h), and the observation and sowing are carried outThe BrWUS1 over-expressed positive plants at the later 4 weeks, 6 weeks and reproductive development period had a difference in growth from the non-load transformed positive plants. For T₁Harvesting of positive plants, T₂The BrWUS 1-generation over-expression plants and the control plants were sown on MS sowing culture medium of 90mg/L hygromycin for root system difference comparison. And recording by taking a picture and performing statistical analysis.

2. Pollen viability assay

The formula of the Alexander mother liquor comprises the following steps: 5mL of 1% (mass fraction) malachite green solution (dissolved in 95 vol% ethanol), 0.5mL of 1% (mass fraction) orange G solution, 5mL of 1% (mass fraction) acid fuchsin solution, 2mL of glacial acetic acid, 25mL of glycerol, 10mL of 95 vol% ethanol, 5G of phenol, and ddH₂And O is metered to 50 mL. When in use, the working solution is diluted by 50 times to obtain the working solution.

Open flowers of well-grown BrWUS1 overexpressing plants and control plants were taken. Each 5 plants were taken, 3 flowers were taken per plant, and 3 biological replicates were taken. 20 mu L of Alexander working solution is dropped on the glass slide, the anther is immersed, the glass slide is covered, the pollen is processed in an incubator at 60 ℃ in the dark for 3 hours, and then the pollen is photographed and the pollen vitality is recorded under a microscope.

The result shows that the number of leaves of the BrWUS1 overexpression plant at 4 weeks after sowing is obviously increased compared with that of the control plant, the number of leaves of the BrWUS1 overexpression plant at 6 weeks after sowing is still more, the leaves are smaller than that of the control plant, the number of branches is increased, and the meristematic capacity of the BrWUS 3578 overexpression plant is enhanced. For T₂The observation of the generation plant root system shows that the difference between the root growth vigor of the control plant sown in the same culture dish and the root growth vigor of the BrWUS1 overexpression plant is very large, and the length of the primary root of the BrWUS1 overexpression plant is obviously shorter than that of the control plant at the 7 th day after sowing (figure 6). The pollen viability detection result of the BrWUS1 heterologous expression Arabidopsis plants shows that the pollen abortion rate of the BrWUS1 overexpression plants is about 40 percent and is obviously higher than that of the control plants (figure 7). Heterologous expression of Arabidopsis T in BrWUS1₁The growth vigor of the plants is weaker, the leaves are sparse, the stems are thin and weak, the plants are lodging compared with the control plants when the plants are observed in the reproductive development period, in addition, the stems of the BrWUS1 heterologously expressed Arabidopsis plants are abnormally bent, and ectopic flower organ primordial-like organs appear on the stems (figure 8).

Example 4 Chinese cabbage BrWUS1 spatiotemporal expression Pattern analysis

1. Construction of BrWUS1 subcellular localization vector

Amplifying gene segments by taking cabbage flower cDNA as a template, recovering the segments by adopting gel (primers are shown in table 4), connecting a PFGC vector digested by Bam H I and Xba I by utilizing a homologous recombinase, transforming escherichia coli competence DH5 alpha, verifying the gene segments and connecting correctly by bacterial liquid PCR and sequencing, extracting vector plasmids, and storing at-20 ℃ for later use. The subcellular localization vector plasmid (figure 2B) which is verified and compared successfully is transformed into the agrobacterium-infected GV3101 by a freeze-thaw method, spots are picked after single bacteria grow out for bacteria liquid PCR (primers are shown in Table 4), and bacteria liquid which is verified successfully stores the strains and is stored at 4 ℃ for later use.

TABLE 4 primers for subcellular localization vector construction and detection

Primer name	Primer sequence (5 '-3')
		BrWUS1-subc-F	GCTGTACAAGGGATCCATGGAGCCACCGCAACAT(SEQ ID No.10)
BrWUS1-subc-R	TAATTAACTCTCTAGATTAATCCTGTGTGACGCC(SEQ ID No.11)

2. Subcellular localization for tobacco transient expression experiment observation

Streaking the agrobacterium strains on a solid LB culture medium containing 50mg/mL of Rif, Str and Kan antibiotics, picking single colonies after spots grow out and shaking the strains for PCR detection, adding 100 mu L of activated agrobacterium strains into 30mL of liquid LB culture medium containing 50mg/mL of Rif, Str and Kan, and shaking the strains by a shaking table at 28 ℃ for overnight. Waiting for bacteriaCulturing in liquid until OD600 is about 1.0, centrifuging at 5000rpm for 15min, and discarding the supernatant. With an equal volume of resuspension (10mmol/L MES, 10mmol/L MgCl)₂150 mu mol/L acetosyringone) and standing at room temperature for 3 h.

Selecting strong tobacco with 4 weeks of age, and selecting 3 flat leaves for each plant. And injecting the bacterial liquid into the leaves by using a disposable 1mL syringe on the back of the leaves, avoiding the vein position, and diffusing the bacterial liquid to 2/3 leaves in the leaves to be marked. After the tobacco after injection is normally cultured for 38h, 1cm square leaves near the needle hole are cut, the back surface of the leaf is upward, and the leaf is sliced, and fluorescence signals and distribution are observed under a laser confocal microscope.

3. Construction of fusion expression vector of BrWUS1 promoter and GUS

Specific primers are designed at a position of about 3000bp on BrWUS1, Chinese cabbage DNA is used as a template to amplify a promoter fragment (the primers are shown in Table 5), homologous recombinase is utilized to be connected into a pCAMBIA1300-GUS vector digested by Hind III and Xba I, escherichia coli competence DH5 alpha is transformed, bacterial liquid PCR verification and sequencing are carried out to prove that a gene fragment and connection are correct, and a vector plasmid is extracted and stored at-20 ℃ for later use. The heterologous expression vector plasmid (figure 2C) which is verified and compared successfully is transformed into the agrobacterium-infected GV3101 by a freeze-thaw method, spots are picked after single bacteria grow out for bacteria liquid PCR (primers are shown in Table 5), and bacteria liquid which is verified successfully stores strains and is stored at 4 ℃ for later use.

4. Promoter fusion GUS vector floral dip method for transforming arabidopsis thaliana and screening positive transformant

Culturing with Agrobacterium liquid to OD₆₀₀Approximately 1.0, the suspension was resuspended in an equal volume of resuspension solution (5% sucrose, 200. mu.L/L Silwet L-77). Removing siliques and open flowers from wild Arabidopsis thaliana, immersing inflorescences in the bacterial liquid for about 30s, taking out, drying excess bacterial liquid by using absorbent paper, preserving moisture and culturing in the dark for 24h, and then putting the culture box for normal culture. After one week, the flower soaking is repeated once to obtain more transgenic seeds. Transgenic seeds were screened with hygromycin medium followed by PCR identification (primers see Table 5).

Primers for amplification of the promoters and detection of the fusion vectors of Table 5

5. Histochemical staining and visualization

The GUS gene is a very common reporter gene at present, and an expression product beta-Glucuronidase (GUS) of the GUS gene can decompose 5-bromo-4-chloro-3-indole-beta-glucoside acid ester (X-Gluc) into a blue substance, so that the observation is simple and convenient. Melting the X-Gluc solvent at room temperature, adding the melted X-Gluc solvent into the X-Gluc dry powder, and uniformly mixing and dissolving to obtain a concentrated solution of 50 XGUS staining. 0.1mL of the concentrated GUS staining solution and 0.4mL of methanol were added to 4.5mL of GUS staining buffer (Triton-100100. mu.L, EDTA (pH 8.0, 0.5M)2mL, and K₃[Fe(CN)₆]16.5g，K₄[Fe(CN)₆]21.1g，NaH₂PO₄·2H₂O 0.78g，Na₂HPO₄ 0.71g，dd H₂Dissolving O and fixing the volume to 88mL) to prepare 5mL of GUS staining solution.

The inflorescence, the silique and the leaf of the prepared arabidopsis positive plant are soaked in GUS staining solution and cultured overnight at 37 ℃. Decolorizing with 70% ethanol solution for 3 times until chlorophyll is removed and plant background turns white. The images were observed under a microscope and photographed for recording.

The results show that in subcellular localization, BrWUS1 was observed to act mainly in the nucleus, with distribution in the cell membrane and cytoplasm as well (fig. 3). Histochemical staining of GUS plants pBrWUS1:: GUS plants observed that BrWUS1 promoter fusion GUS expression first appeared in the receptacle region and the signals of the receptacle region were strong throughout flower development, with the GUS signal increasing gradually in anthers with the maturation of stamens, and in addition, expression was observed in the inflorescence branches and in the position of the petiole, both the original receptacle, and staining of rosette leaf leaves showed pBrWUS1:: GUS signals in the leaf tips and epidermal hair (FIG. 4). The morphological observation and pollen activity detection results show that the expression part of BrWUS1 is consistent with the function of BrWUS1, and BrWUS1 expresses in leaves and stamens to play the function of BrWUS 1.

The foregoing is a preferred embodiment of the present invention, but it will be apparent to any person skilled in the art that improvements or modifications may be made thereto. Therefore, such modifications and improvements based on the present invention are intended to be within the scope of the claims.

Sequence listing

<110> Zhejiang university

WUXI DIMODE BIOLOGICAL SEED INDUSTRY TECHNOLOGY Co.,Ltd.

<120> cabbage stem cell determination related gene BrWUS1 and application thereof

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 909

<212> DNA

<213> Brassica rapa

<400> 1

atggagccac cgcaacatca tcatcaagcc gaccaagaaa acggcaacaa caacaagtcc 60

ggctctggta gttatacgtg tcgtcaaacg agcacaagat ggacaccaac aacggagcaa 120

atcagaatcc taaaagatct ttactacaac aacggagtcc gatcaccaac ggccgaccag 180

attcagaaga tctctgcaag gctgagactg tatgggaaaa tcgagggtaa aaacgtcttt 240

tactggttcc agaaccataa ggctcgtgag cgacagaaga agagattcaa cggcacagtc 300

atgaccactc cgacgtcttc atctcctaac tcggttatga tggctagtga tcattattat 360

aaccatcatc ctcttcttca ccatcctcag caaggtgtta ccatgcacag acctgcttca 420

gtaaacgtta agcttgacca agaaaatcat ctgcttcagg aaaacagatc atatcctagc 480

ttcaataacg gtacaggcac tgaatgtggt gctcttaatg cgtcttctaa tggctacatg 540

aatagccatc tctatggatc tattgaacaa gattgttcaa tgagctacaa caacgtaggt 600

ggagagtgga caaacatgga tcataatcat cattactcgg ctccagctta caacttcttc 660

gatagaccaa agcctatgta tgaactagaa gttcatgaag aagaaggaga ctatggtggc 720

gatgcttatc tggaacatag acgtaccctt cctctttttc ctatgcacgg tgaggatcac 780

atcaacggcg gtggtggtgt catctggaag cacggacaat cggacggtcg tgatcgttat 840

ggtagaggcc cttgtgcttc tctaaagcta tgcctgaact cccacgccgc cggcgtcaca 900

caggattaa 909

<210> 2

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gggcgcgccg gtaccatgga gccaccgcaa cat 33

<210> 3

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atagtccatg gatccatcct gtgtgacgcc 30

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

aaacctcctc ggattccatt g 21

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aggcgtctcg catatctcat t 21

<210> 6

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ggaactggaa tggtgaaggc tg 22

<210> 7

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cgattggata cttcagagtg agga 24

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

acaacgtagg tggagagtgg 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

agcatcgcca ccatagtctc 20

<210> 10

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gctgtacaag ggatccatgg agccaccgca acat 34

<210> 11

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

taattaactc tctagattaa tcctgtgtga cgcc 34

<210> 12

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

aacgacggcc agtgccaagc ttcaccaaga gtagttccag tt 42

<210> 13

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

atggtaccgt ggatcctcta gacttcaaga tgaagatgaa gatgaag 47

<210> 14

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gtcatcttgt tgtaacgccc c 21

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gtgacctatc gcctatcggg 20

Claims

1. Chinese cabbage stem cell determinant geneBrWUS1Use in stimulating meristematic activity in plants, in particular comprising the overexpression of a said cabbage stem cell determinantBrWUS1The leaf blade of the plant is reduced and the number of branches is increased, the root length of the primary root is shortened, and the cabbage stem cell determining geneBrWUS1The nucleotide sequence of (A) is shown in SEQ ID No. 1.

2. Chinese cabbage stem cell determinant geneBrWUS1The application of the composition in stimulating the male abortion of plants is characterized in that the application specifically comprises the following steps: over-expressing the cabbage stem cell determinant geneBrWUS1Rendering plant pollen abortive, said cabbage stem cell determinantBrWUS1The nucleotide sequence of (A) is shown in SEQ ID No. 1.

3. Chinese cabbage stem cell determinant geneBrWUS1The application in the improvement of plant germplasm resources specifically comprises the over-expression of the cabbage stem cell determinant geneBrWUS1The leaf blade of the plant is reduced and the number of branches is increased, the root length of the primary root is shortened, and the cabbage stem cell determining geneBrWUS1The nucleotide sequence of (A) is shown in SEQ ID No. 1.