CN113136460A

CN113136460A - H5N6 double-fluorescence quantitative RT-PCR detection kit

Info

Publication number: CN113136460A
Application number: CN202110524921.8A
Authority: CN
Inventors: 袭细毛
Original assignee: Guangzhou Boshi Biotechnology Co ltd
Current assignee: Guangzhou Boshi Biotechnology Co ltd
Priority date: 2021-05-13
Filing date: 2021-05-13
Publication date: 2021-07-20

Abstract

The invention relates to a H5N6 dual fluorescence quantitative detection kit, which comprises: 2 × BIOG^HSC S uper MultiProbe Mix，BIOG^HSCSuper Enzyme Mix, H5-F, H5-R, N6-F, N6-R primer, H5-P, N6-P probe, RT-PCR Enhancer, RNase-free ddH₂O, 50 XROX Reference Dye, T aq enzyme protection, 2 XBIOG^HSCSuper Probe Master mix, positive control and negative control, wherein the positive control is a linear plasmid containing H5 and N6 gene fragments, and the negative control is PBS; the invention has the beneficial effect of providing the detection kit which has better specificity, stability and sensitivity and is used for detecting the H5N6 subtype avian influenza virus.

Description

H5N6 double-fluorescence quantitative RT-PCR detection kit

Technical Field

The invention belongs to the technical field of biology, and particularly relates to an H5N6 double-fluorescence quantitative RT-PCR detection kit.

Background

Influenza virus is a common respiratory infectious disease pathogen, is also a single-strand negative-strand RNA virus with an envelope, belongs to the family of orthomyxoviridae, and is classified into A, B, C, D types according to the antigenicity and gene evolution relationship of Nucleoprotein (NP) and Matrix protein (Matrix protein), wherein the influenza A virus has the greatest harm, has wide hosts, can infect human, poultry, horses, pigs, dogs, cats, mink, tiger, seal and whales, has strong infectivity, high propagation speed and easy variation, is difficult to prevent and control, often causes interpersonal pandemics and farm epidemics, and brings serious loss to human health and world economy. Avian Influenza Virus (AIV) belongs to influenza a virus, HA and NA are two main antigens on the surface of influenza virus, HA mainly functions to specifically recognize a receptor on the surface of a host cell, HA is a main antigen of an influenza virus stimulating an organism to produce an antibody, NA HAs sialidase activity, plays an important role in the release stage after the virus completes intracellular help, and cuts off the adhesion of progeny virus and the host cell to further infect other host cells. Influenza a viruses are classified into H1-H18 HA subtypes and N1-N11 NA subtypes according to differences in antigenicity of their surface antigens HA and NA, and currently, the predominant subtypes that prevail are H1N1, H2N 2, and H3N2, and recently, it HAs been found that influenza viruses of subtypes such as H5N1, H9N2, and H7N7 can also infect humans, and the predominant subtypes that circulate in birds are H5N1, H5N6, H7N7, H9N2, H6N6, H5N8, H10N8, and H5N 6.

In 1975, H5N6 subtype avian influenza virus was first isolated from green-head ducks in North America, in the past, H5N6 virus has the characteristic of low pathogenicity, is mainly popular in birds in America, Germany and Sweden, rarely produces symptoms, has little influence on human health and poultry farming industry, however, in recent years, in Asian countries, a series of H5N6 epidemic situations are developed, the fatality rate is extremely high, the characteristic of high pathogenicity is presented, severe loss is brought to poultry farming industry, symptoms such as fever and sore throat occur in 5 year old girls in 2 months in 2014, Hunan Changsha, and the like, are diagnosed to be positive in H5N6, which shows that the H5N6 subtype avian influenza virus can cross species to infect people, and various forms of gene recombination can cause brand new H5N6 to be generated, and in the process, part of H5N6 obtains receptor binding specificity adaptive to people, and enhances replication capacity, Virulence and drug resistance ultimately lead to the development of human infectious cases.

Fluorescent quantitative Real-time reverse transcription-polymerase chain reaction (RT-PCR) can distinguish subtypes of AIV. The double real-time fluorescent RT-PCR method aiming at the HA gene of H5 subtype and the NA gene of N6 subtype can improve the working efficiency, but at present, a primer pair and a probe which have high specificity, stability and sensitivity and are used for detecting the H5N6 subtype of the avian influenza virus are lacked.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide a primer pair and a probe for detecting avian influenza virus H5N6 subtype, which have strong specificity, stability and sensitivity.

The specific primer sequences of the invention are shown in Table 1:

TABLE 1 primers and probes

The 5 'end of the H5 probe is labeled by FAM, and the 3' end is labeled by BHQ 1; the 5 'end of the N6 probe was labeled with HEX, and the 3' end was labeled with BHQ 1.

The kit of the present invention comprises: 2 × BIOG^HSC Super MultiProbe Mix，BIOG^HSCSuper Enzyme Mix, H5-F, H5-R, N6-F, N6-R primer, H5-P, N6-P probe, RT-PCR Enhancer, RNase-free ddH₂O, 50 XROX Reference Dye, Taq enzyme protection solution, 2 XBIOG^HSCSuper Probe Master mix, positive control and negative control.

The positive control is a linear plasmid containing HA and NA gene fragments, and the negative control is PBS.

The invention also relates to an avian influenza virus H5N6 subtype real-time fluorescence RT-PCR detection method, which is characterized by comprising the following steps:

1. extracting RNA of a sample to be detected;

2. preparing a fluorescent quantitative PCR reaction system, wherein the system is as follows:

2×BIOG^HSC Super MultiProbe Mix 10μl，BIOG^HSC0.5. mu.l of Super Enzyme Mix, 0.5. mu.l of RT-PCR Enhancer, 0.5. mu.l of H5, 0.5. mu.l of N6 upstream primer (10. mu.M), 0.5. mu.l of H5, N6 downstream primer (10. mu.M), 0.5. mu.l of probe (20. mu.M), RNase-free ddH₂O3.5. mu.l, template H5N6 nucleic acid 4. mu.l;

the application method of the H5N6 dual fluorescent quantitative RT-PCR detection kit comprises the following reaction conditions of real-time fluorescent quantitative PCR: 40 cycles of 42 ℃ 20min, 95 ℃ 10min, (95 ℃ 15s, 55 ℃ 35s, 72 ℃ 45 s). 10min at 72 ℃;

3. a linear plasmid containing an H5N6 gene fragment diluted by a 10-fold gradient is used as a standard substance to carry out real-time fluorescence quantitative PCR, and the PCR system is as follows:

2×BIOG ^HSC10 ul of Super Probe Master Mix, 0.5 ul of H5 and N6 upstream primer (10 uM), 0.5 ul of H5 and N6 downstream primer (10 uM), 2 ul of linear plasmid template, 0.5 ul of Probe, 0.4 ul of 50 XROX Reference Dye, 0.2 ul of Taq enzyme protection solution, and ddH₂And (3) carrying out reaction for 40 cycles of O5.9 mul, wherein the reaction program is 95 ℃ for 10min, (95 ℃ for 15s, 55 ℃ for 35s and 72 ℃ for 45s), the reaction program is 72 ℃ for 10min, a standard curve is established by taking the Log value of the copy number of the plasmid as the abscissa and the Ct value as the ordinate, and then the real-time fluorescence quantitative PCR detection result of the sample to be detected is compared with the standard curve to obtain the detection result.

The invention further analyzes the specificity, sensitivity and stability of the established H5N6 dual-fluorescence quantitative RT-PCR detection kit, wherein:

and (3) specific detection: the kit is used for carrying out fluorescence quantitative RT-PCR detection by taking RNA (ribonucleic acid) of H2N3, H5N5, H5N6, H5N1, H7N2, H8N4, H10N3, H1N7, H11N9, H7N9, H3N2, H6N6, H9N6 and H9N2 as templates.

And (3) sensitivity detection: constructing pcDNA3.1-H5-N6 plasmid containing H5 gene fragment and N6 gene fragment, quantifying the plasmid by using a micro nucleic acid quantifier NanoDrop, and taking 10 and 10²、10³、10⁴、10⁵、10⁶、10⁷、10⁸And (3) taking the copied/mul recombinant plasmid as a standard template, respectively adding the standard template into the system for amplification, and constructing a standard curve according to the Ct value and the Log value of the template concentration for calculating the minimum detection limit of the detection system.

And (3) stability detection: in the same experiment, in the same PCR plate, according to 10-fold gradient dilution, three dilution gradients are set, double real-time fluorescence RT-PCR detection is carried out on the H5N6 avian influenza virus positive nucleic acid, each sample is carried out with three repetitions, in addition, the three repetitions are carried out on different PCR plates, and the coefficient of variation of the Ct value obtained by the three repeated reactions of each dilution sample is calculated.

The invention has the beneficial effects that:

provides a detection kit with better specificity, stability and sensitivity for detecting the H5N6 subtype avian influenza virus.

Drawings

FIG. 1 shows the amplification results of the H5N6 gene in FAM and HEX channels

FIG. 2 amplification results of H5N5 and H5N1 genes in FAM channel

FIG. 3 shows the results of the HEX channel amplification of H6N6 and H9N6 genes

FIG. 4 Standard Curve

Detailed Description

The present invention will be described in further detail with reference to the following examples, which are provided only for illustrating the present invention and are not intended to limit the scope of the present invention.

Example 1

1. Primary reagent

H2N3, H5N5, H5N6, H5N1, H7N2, H8N4, H10N3 RNA were given by Hongkong university, H1N7, H11N9 RNA were given by Pennsylvania university, H7N9, H3N2, H6N6, H9N6, H9N2RNA were given by Guangxi autonomous region disease control center, QIAamp Viral RNA extraction kit was purchased from QIAGEN, BIOG, Germany^HSCSuper MuhiProbe One Step Kit and BIOG^HSCThe Super Probe Kit is purchased from Bai generation organisms in Changzhou, the gel recovery Kit is purchased from Axygen company, and the pcDNA3.1 vector is purchased from Shanghai Solebao Biotech Co., Ltd;

2. main instrument equipment

ABI7300 fast real-time fluorescent PCR instrument was purchased from Thermo fisher, USA, AB104-N electronic analytical balance was purchased from Mettler-Torledo Shanghai, Inc., Sigma 3K-15 high-speed refrigerated centrifuge was purchased from Sigma, Germany, and MilliQ Integrated ultrapure water instrument was purchased from Millipore, USA;

searching HA gene sequences (MG220416.1, SEQ ID NO.7) and NA gene sequences (MK779125.1 and SEQ ID NO.8) of the H5N6 avian influenza virus strain from NCBI, and designing specific primers and TaqMan probe sequences aiming at conserved regions by using Primer Epress 3.0.1 software, wherein the Primer sequences are shown in Table 1, H5-P fluorescence emission groups are FAM, N6-P fluorescence emission groups are HEX, and quenching groups are BHQ-1;

3. preparing a fluorescent RT-PCR detection system according to the specification, wherein the specific preparation system is shown in table 2, and the RT-PCR reaction program is shown in table 3;

TABLE 2 RT-PCR reaction System

Composition (I)	Volume (μ l)
		2×BIOG^HSC Super MultiProbe Mix	10
BIOG^HSC Super Enzyme Mix	0.5
		RT-PCR Enhancer	0.5
H5, N6 upstream primer (10. mu.M)	0.5
		H5, N6 downstream primer (10. mu.M)	0.5
Probe (20 μ M)	0.5
		Rnase-free ddH₂O	3.5
Template H5N6 nucleic acid	4

TABLE 3 RT-PCR reaction procedure

Temperature of	Time	Number of cycles
			42℃	20min	-
95℃	10min	-
			95℃	15s	40
55℃	35s					40
			72℃	45s			40
72℃	10min	-

The result judgment standard is as follows: the Ct value is less than or equal to 33, and the test piece is judged to be positive; the Ct value is more than or equal to 35, and the judgment is negative; ct values were suspect between 33-35 and were repeated once, and positive if Ct values were still between 33-35, three replicates per sample were set.

Example 2 specificity verification

The experimental procedure was the same as in example 1, and fluorescence quantitative RT-PCR amplification was carried out using the kit, using H2N3, H5N5, H5N6, H5N1, H7N2, H8N4, H10N3, H1N7, H11N9, H7N9, H3N2, H6N6, H9N6, and H9N2 RNAs as templates, respectively.

As can be seen from FIG. 1, only H5N6 avian influenza virus nucleic acid shows corresponding specific fluorescence amplification curves in both FAM detection channel and HEX detection channel, as can be seen from FIG. 2, H5N5 and H5N1 contain H5 gene, thus showing amplification curve in FAM detection channel, while HEX detection channel shows no amplification curve, as can be seen from FIG. 3, H6N6 and H9N6 contain N6 gene, thus showing that amplification curve in HEX detection channel, FAM detection channel shows no amplification curve, and both fluorescence channels of other influenza virus show no amplification curve, thus indicating that the method has strong specificity.

Example 3 sensitivity verification

Construction and identification of HA gene and NA gene positive plasmids of H5N6 avian influenza virus, common PCR amplification is carried out by using HA gene and NA gene specific primers aiming at H5N6 avian influenza virus, HA gene primer sequences are shown as SEQ ID NO.9 and SEQ ID NO.10, NA gene primer sequences are shown as SEQ ID NO.11 and SEQ ID NO.12, the amplification range comprises a fluorescent quantitative RT-PCR amplification area, after the HA gene and NA gene PCR reaction is finished, mixing, adding 20 mul of Cloning Enhancer into a PCR system, incubating for 15min at 37 ℃, incubating for 15min at 80 ℃, adopting AflII and BamH I to carry out enzyme digestion on pcDNA3.1 plasmid, after 0.75% agarose gel electrophoresis, recovering enzyme digestion products, dissolving In sterilized double distilled water, mixing the PCR products with purified linear vectors uniformly, adding In-Fusion enzyme, reacting for 15min at 50 ℃, converting E.coli positive DH5 alpha, picking up and Cloning, sequencing by a biological company, carrying out amplification culture on correctly identified plasmids, extracting the plasmids, carrying out enzyme digestion on the recombinant plasmids by using BssHII to obtain linearized plasmid DNA serving as a positive plasmid for constructing a standard curve and named pcDNA3.1-H5-N6.

pcDNA3.1-H5-N6 positiveThe plasmid was quantified by NanoDrop using a nucleic acid minimeter, and 10 were taken²、10³、10⁴、10⁵、10⁶、10⁷、10⁸Taking the copied/microliter recombinant plasmid as a standard template to perform PCR amplification, wherein the amplification system is as follows:

2×BIOG ^HSC10 ul of Super Probe Master Mix, 0.5 ul of H5 and N6 upstream primer (10 uM), 0.5 ul of H5 and N6 downstream primer (10 uM), 2 ul of linear plasmid template, 0.5 ul of Probe, 0.4 ul of 50 XROX Reference Dye, 0.2 ul of Taq enzyme protection solution, and ddH₂And (3) O5.9 mul, wherein the reaction program is 95 ℃ for 10min, (95 ℃ for 15s, 55 ℃ for 35s, and 72 ℃ for 45s) for 40 cycles, and the reaction program is 72 ℃ for 10min, and a standard curve is constructed according to the Ct value and the Log value of the template concentration and is used for calculating the minimum detection limit of the detection system.

Experimental results show that the cycle threshold (Ct value) of a standard curve constructed by pcDNA3.1-H5-N6 positive plasmids has a good linear relation with a Log value of template concentration, the correlation coefficient is 0.997, and the sensitivity is 68 copies/mul.

Example 4 stability verification

In the same experiment, in the same PCR plate, according to 10-fold gradient dilution, three dilution gradients are set, double real-time fluorescence RT-PCR detection is carried out on the H5N6 avian influenza virus positive nucleic acid, the detection method is as in example 1, each sample is repeated three times (see table 3), and in addition, the samples are repeated three times on different PCR plates, and the variation coefficient of the Ct value obtained by three repeated reactions of each dilution sample is calculated (see table 4).

The test results show that the coefficient of variation of the same PCR plate is between 0.19 and 0.32 percent, and the coefficient of variation of different PCR plates is between 0.37 and 0.44 percent, which shows that the double RT-PCR detection method has small error and good repeatability, and can stably and reliably detect the H5N6 avian influenza virus.

TABLE 3 duplicate results of the H5N6 avian influenza Virus Dual fluorescent RT-PCR detection method in batches

TABLE 4 batch-to-batch repeat results of the H5N6 avian influenza Virus Dual fluorescent RT-PCR detection method

Sequence listing

<110> Guangzhou Bojii Biotechnology Ltd

<120> H5N6 double-fluorescence quantitative RT-PCR detection kit

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gggacatcaa cattaaacca gaga 24

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgcccgttta cttgggatct 20

<210> 3

<211> 14

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tggtgccaaa aata 14

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tgcgaatgga accatacatg a 21

<210> 5

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tgacccattt cccaacttat aagag 25

<210> 6

<211> 14

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aggagcccat ttcg 14

<210> 7

<211> 1751

<212> DNA

<213> Influenza A virus

<400> 7

ggttcaatct gtcaaaatgg agaaaatagt gcttcttctt gcagtgatta gccttgttaa 60

aagtgatcag atttgcattg gttaccatgc aaacaactcg acagagcagg ttgacacgat 120

aatggaaaaa aacgtcactg ttacacatgc ccaagacata ctggaaaaga cacacaacgg 180

gaggctctgc gatctgaatg gagtgaaacc tctgatttta aaggattgta gtgtagctgg 240

atggcttctt ggaaacccaa tgtgcgacga gttcatcaga gtgccggaat ggtcctacat 300

agtggaaagg gctaacccaa ccaatgacct ctgttaccca gggaatctca atgattacga 360

agaactgaaa cacttattga gcagaataaa tcattttgag aagactctga tcatccccaa 420

gagttcttgg cccaatcatg aaacatcatt gggggtgagc gcagcttgtc cataccaggg 480

aatgccctct tttttcagaa atgtggtatg gcttaccaag aagaacgatg catacccaac 540

aataaagatg agctacaata ataccaatag ggaagatctt ttgatactgt gggggattca 600

tcatcccaac aatgaagcag agcaaaaaag tatctataaa aatccaacca cctatgtttc 660

cgttgggaca tcaacattaa accagagatt ggtgccaaaa atagctacta gatcccaagt 720

aaacgggcaa cgtggaagaa tggatttctt ctggacaatt ttaaaaccga atgatgcaat 780

ccatttcgag agtaatggaa attttattgc tccagaatat gcatacaaaa ttgtcaagaa 840

aggggactca acaattatga aaagtgaaat ggaatacggc tactgcaaca ccaaatgtca 900

aactccaata ggggcgataa actctagtat gccattccac aatatacacc ctctcactat 960

cggggagtgc cccaaatacg tgaaatcaaa caaattagtc cttgcgactg ggctcagaaa 1020

tagtcctcta agagaaagaa gaagaaaaag agggctattt ggagctatag cagggtttat 1080

agagggagga tggcaaggaa tggtagatgg ttggtatggg tatcaccata gcaatgaaca 1140

ggggagtggg tacgctgcag acagagaatc cacccaaaag gcaatagatg gagttaccaa 1200

taaggtcaac tcgatcattg acaaaatgaa cactcaattt gaggccgttg gaagggaatt 1260

caataactta gaacggagaa tagaaaattt aaataagaaa atggaagacg gattcctaga 1320

tgtctggact tataatgctg aacttttagt tctcatggaa aatgagagaa cgctagattt 1380

ccatgactca aatgtcaaga acctttatga caaagtccga ctacagctta gggataatgc 1440

aaaggagctg ggtaacggtt gtttcgagtt ttatcacaaa tgtgataatg aatgtatgga 1500

aagtgtaaga aatgggacgt acgactaccc ccaatattca gaagaagcaa gattaaaaag 1560

ggaagaaata agcggagtga aactggaatc aataggaact taccaaatac tgtcaattta 1620

ttcaacagtg gcgagttccc taacactggc aatcatcttg gctggtctat ctttatggat 1680

gtgctccaat gggtcgttac aatgcagaat ttgcatttaa atttgtgagc tcaaattgta 1740

attaaaaaca c 1751

<210> 8

<211> 1432

<212> DNA

<213> Influenza A virus

<400> 8

agcaaaagca gggtgaaaat gaatccaaat caaaagataa catgcatttc agcaacagga 60

gtaacactat cagtagtaag cctgctaata ggaatcacca atttgggcct aaatattgga 120

ctacactaca aagtgagtga ttcaacaact ataaacattc caaacatgaa tgagactaac 180

ccaacaacaa caaacatcac taacattata atgaataaga acgaagaaag aacatttctt 240

aaattgacca agccactatg tgaagtcaac tcatggtaca ttctatcgaa agacaatgcg 300

ataagaatag gtgaggatgc tcatatactg gtcacaaggg aaccttacct gtcctgtgat 360

ccacaaggct gcagaatgtt tgctctgagt cagggcacaa cactcagagg gcaacatgcg 420

aatggaacca tacatgatag gagcccattt cgagctctta taagttggga aatgggtcag 480

gcacccagtc catacaatac tagggtcgaa tgcataggat ggtcaagcac gtcatgccat 540

gatggcatat caaggatgtc aatatgcata tcaggaccga ataacaatgc atcggcagtg 600

gtgtggtacc gggggagacc aataacagaa atcccatcat gggcagggaa cattcttagg 660

actcaagaat cagaatgtgt gtgccataaa ggaatctgcc cagtggtcat gacagatggt 720

ccagcaaaca acaaggcagc aactaagata atctacttca aagagggaaa gatacaaaaa 780

actgaagaat tgcaagggaa cgctcaacac atcgaagaat gttcatgcta cggagcagca 840

gggatgatca aatgtgtatg cagagacaac tggaaggggg caaatagacc agtaatcact 900

ataaatcccg aaatgatgac ccacacaagc aaatacttgt gttcgaaaat cttaaccgac 960

acaagtcgcc ctaatgatcc caccaatggg aactgtgacg caccaataaa aggagggagc 1020

ccagacccag gggtaaaagg gtttgcattc ctagatgggg agaattcatg gcttgggagg 1080

acaattagca aagactccag atcaggttac gaaatgttga aggtcccaaa tgcagaaatc 1140

gacactcaat cagggccaat ctcataccag ctgattgtca acaaccaaaa ttggtcaggg 1200

tactcagggg cattcataga ctactgggca aacaaggagt gcttcaatcc ttgtttttat 1260

gtggagctaa tcagggggag acccaaagag agtggtgtac tgtggacttc caatagcatg 1320

gtagctctct gtggatccag ggagcgattg ggatcatggt cctggcatga tggtgcagaa 1380

atcatctact ttaagtagaa gtgatttaag aaaaaacacc cttgtttcta ct 1432

<210> 9

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gatcagcggt ttaaacttaa gcaacaatga agcagagcaa aaaa 44

<210> 10

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

aggacaggta aggtgcagta gccgtattcc atttcac 37

<210> 11

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tactgcacct tacctgtcct gtgatccaca 30

<210> 12

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ccacactgga ctagtggatc cgcattgtta ttcggtcctg atatg 45

Claims

1. A H5N6 double fluorescence quantitative RT-PCR detection kit is characterized by comprising: 2 × BIOG^HSC Super MultiProbe Mix，BIOG^HSCSuper Enzyme Mix, H5-F, H5-R, N6-F, N6-R primer, H5-P, N6-P probe, RT-PCR Enhancer, RNase-free ddH₂O, 50 XROX reference Dye, Taq enzyme protection solution, 2 XBIOG^HSCSuper Probe Master mix, PositiveA control and a negative control, wherein the positive control is a linear plasmid containing H5 and N6 gene fragments, the negative control is PBS, and the H5-F sequence is as follows: GGGACATCAACATTAAACCAGAGA, the sequence of H5-R is: TGCCCGTTTACTTGGGATCT, the sequence of H5-P is: TGGTGCCAAAAATA, the sequence of N6-F is: TGCGAATGGAACCATACATGA, the sequence of N6-R is: TGACCCATTTCCCAACTTATAAGAG, the sequence of N6-P is AGGAGCCCATTTCG.

2. The use method of the H5N6 dual-fluorescence quantitative RT-PCR detection kit is characterized by comprising the following steps:

firstly, extracting sample RNA;

preparing a fluorescent quantitative PCR reaction system, wherein the system is as follows:

2×BIOG^HSC Super MultiProbe Mix 10μl，BIOG^HSC0.5. mu.l of Super Enzyme Mix, 0.5. mu.l of RT-PCR Enhancer, 0.5. mu.l of H5, 0.5. mu.l of N6 upstream primer (10. mu.M), 0.5. mu.l of H5, N6 downstream primer (10. mu.M), 0.5. mu.l of probe (20. mu.M), RNase-free ddH₂O3.5. mu.l, template nucleic acid 4. mu.l;

the real-time fluorescent quantitative PCR reaction conditions are as follows: 20min at 42 ℃, 10min at 95 ℃ (15 s at 95 ℃, 35s at 55 ℃ and 45s at 72 ℃) for 40 cycles, and 10min at 72 ℃;

using linear plasmid containing H5 and N6 gene fragments diluted by 10 times of gradient as standard substance to carry out real-time fluorescence quantitative PCR, wherein the system is as follows:

2×BIOG^HSC10 ul of Super Probe Master Mix, 0.5 ul of H5 and N6 upstream primer (10 uM), 0.5 ul of H5 and N6 downstream primer (10 uM), 2 ul of linear plasmid template, 0.5 ul of Probe, 0.4 ul of 50 XROX Reference dye, 0.2 ul of Taq enzyme protection solution, and ddH₂And (3) O5.9 mul, wherein the reaction program is 95 ℃ for 10min, (95 ℃ for 15s, 55 ℃ for 35s, and 72 ℃ for 45s) for 40 cycles, the reaction program is 72 ℃ for 10min, a standard curve is established by taking the Log value of the copy number of the plasmid as the abscissa and the Ct value as the ordinate, and then the real-time fluorescence quantitative PCR detection result of the sample to be detected is compared with the standard curve to obtain the detection result.