CN105950789A - Primer combination for identifying H5 subtype AIV (Avian Influenza Virus), N6 subtype AIV and AIV and application thereof - Google Patents

Primer combination for identifying H5 subtype AIV (Avian Influenza Virus), N6 subtype AIV and AIV and application thereof Download PDF

Info

Publication number
CN105950789A
CN105950789A CN201610554720.1A CN201610554720A CN105950789A CN 105950789 A CN105950789 A CN 105950789A CN 201610554720 A CN201610554720 A CN 201610554720A CN 105950789 A CN105950789 A CN 105950789A
Authority
CN
China
Prior art keywords
hypotype
aiv
sequence
dna
dna fragmentation
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610554720.1A
Other languages
Chinese (zh)
Inventor
谢芝勋
何莹
罗思思
李孟
谢志勤
谢丽基
黄莉
邓显文
黄娇玲
张艳芳
曾婷婷
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangxi Veterinary Research Institute
Original Assignee
Guangxi Veterinary Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangxi Veterinary Research Institute filed Critical Guangxi Veterinary Research Institute
Priority to CN201610554720.1A priority Critical patent/CN105950789A/en
Publication of CN105950789A publication Critical patent/CN105950789A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a primer combination for identifying H5 subtype AIV (Avian Influenza Virus), N6 subtype AIV and AIV and application of the primer combination. The primer combination is prepared from a primer pair I, a primer pair II and a primer pair III, wherein the primer pair I is prepared from a primer M-F and a primer M-R which are respectively as shown in sequence tables 1 and 2; the primer pair II is prepared from a primer H5-F and a primer H5-R which are respectively as shown in sequence tables 3 and 4; the primer pair III is prepared from a primer N6-F and a primer N6-R which are respectively as shown in sequence tables 5 and 6. The invention also discloses the application of the primer combination in identifying the H5 subtype AIV, the N6 subtype AIV and the AIV. A triplex PCR (Polymerase Chain Reaction) detection method of the H5 subtype AIV, the N6 subtype AIV and the AIV, established by the invention, has the characteristics of high specificity, high sensitivity and quickness and convenience, powerful technical support is provided for quickly diagnosing H5N6 subtype AIV, and reference basis is provided for early diagnosis and clinical detection.

Description

A kind of primer combination identifying H5 hypotype AIV, N6 hypotype AIV and AIV and application thereof
Technical field
The present invention relates to a kind of primer combination identifying H5 hypotype AIV, N6 hypotype AIV and AIV and application thereof.
Background technology
Bird flu virus (Avian influenza virus, AIV) belongs to orthomyxovirus section influenza A and belongs to, Can divide according to hemagglutinin (henmagglutinin, HA) and neural aminoacid (neuraminidase, NA) antigenic specificity For different subtype, 18 kinds of HA (H1-H18) hypotypes and 11 kinds of NA (N1-N11) are had now been found that.
Within 1975, H5N6 subtype virus is separated first in U.S.'s mallard body, it was reported that H5N6 hypotype was sick in the past Poison is the most popular birds (mainly duck class) with low pathogenic state, on aviculture the most significantly impact.2013 Year, Jiangsu Province of China finds H5N6 bird flu virus first in live-bird market monitorings, sends out after it is carried out gene analysis Existing, H5N6 bird flu virus is unexpectedly by two kinds of subtype avian influenza virus gene recombinaton of H5N1 and H6N6 and multiple Gene source is in H5N1 HPAI (High Pathogenic AI) virus so that it is possessed high pathogenic characteristic.2014, China Sichuan Save Nanchong City from the mankind, separate highly pathogenic H5N6 bird flu virus first.At present, 14 example mankind senses have been made a definite diagnosis Dye H5N6 hypotype AIV case, prompting AIV changes the most further from birds to the mankind, and H5N6 hypotype AIV is not only Provisions fowl industrial belt carrys out huge economic loss, it is also possible to crosses over host barrier direct infection people and endangers human security.
Summary of the invention
It is an object of the invention to provide a kind of primer combination identifying H5 hypotype AIV, N6 hypotype AIV and AIV and answer With.
The invention provides a kind of primer combination, primer, I II is made up of by I, primer by II and primer；
I is made up of by described primer primer M-F and primer M-R；
Described primer M-F is following (a1) or (a2)；
(a1) single strand dna shown in sequence 1 of sequence table；
(a2) sequence 1 through the replacement of one or several nucleotide and/or disappearance and/or interpolation and is had with sequence 1 There is the DNA molecular of identical function；
Described primer M-R is following (a3) or (a4)；
(a3) single strand dna shown in sequence 2 of sequence table；
(a4) sequence 2 through the replacement of one or several nucleotide and/or disappearance and/or interpolation and is had with sequence 2 There is the DNA molecular of identical function；
II is made up of by described primer primer H5-F and primer H5-R；
Described primer H5-F is following (a5) or (a6)；
(a5) single strand dna shown in sequence 3 of sequence table；
(a6) sequence 3 through the replacement of one or several nucleotide and/or disappearance and/or interpolation and is had with sequence 3 There is the DNA molecular of identical function；
Described primer H5-R is following (a7) or (a8)；
(a7) single strand dna shown in sequence 4 of sequence table；
(a8) sequence 4 through the replacement of one or several nucleotide and/or disappearance and/or interpolation and is had with sequence 4 There is the DNA molecular of identical function；
I II is made up of by described primer primer N6-F and primer N6-R；
Described primer N6-F is following (a9) or (a10)；
(a9) single strand dna shown in sequence 5 of sequence table；
(a10) by sequence 5 through the replacement of one or several nucleotide and/or disappearance and/or interpolation and with sequence 5 There is the DNA molecular of identical function；
Described primer N6-R is following (a11) or (a12)；
(a11) single strand dna shown in sequence 6 of sequence table；
(a12) by sequence 6 through the replacement of one or several nucleotide and/or disappearance and/or interpolation and with sequence 6 There is the DNA molecular of identical function.
The purposes of described primer combination is any one in following (b1) to (b6):
(b1) H5N6 hypotype AIV, H5 hypotype and AIV, N6 hypotype of non-N6 hypotype and non-H5 hypotype are differentiated AIV and non-H5 hypotype and the AIV of non-N6 hypotype；
(b2) preparation is for differentiating H5N6 hypotype AIV, H5 hypotype and AIV, N6 hypotype of non-N6 hypotype and non-H5 The AIV of hypotype and the test kit of the AIV of non-H5 hypotype and non-N6 hypotype；
(b3) identify whether virus to be measured is H5N6 hypotype AIV, H5 hypotype and AIV, N6 hypotype of non-N6 hypotype And AIV or the non-H5 hypotype of non-H5 hypotype and the AIV of non-N6 hypotype；
(b4) preparation for identify virus to be measured be whether H5N6 hypotype AIV, H5 hypotype and the AIV of non-N6 hypotype, AIV or the non-H5 hypotype of N6 hypotype and non-H5 hypotype and the test kit of the AIV of non-N6 hypotype；
(b5) whether detection sample to be tested contains H5N6 hypotype AIV and/or H5 hypotype and the AIV of non-N6 hypotype And/or N6 hypotype and the AIV of non-H5 hypotype and/or non-H5 hypotype and the AIV of non-N6 hypotype；
(b6) whether preparation detection sample to be tested contains H5N6 hypotype AIV and/or H5 hypotype and non-N6 hypotype The test kit of the AIV of AIV and/or N6 hypotype and the AIV of non-H5 hypotype and/or non-H5 hypotype and non-N6 hypotype.
The present invention also protects the application that described primer combines, for any one in following (b1) to (b6):
(b1) H5N6 hypotype AIV, H5 hypotype and AIV, N6 hypotype of non-N6 hypotype and non-H5 hypotype are differentiated AIV and non-H5 hypotype and the AIV of non-N6 hypotype；
(b2) preparation is for differentiating H5N6 hypotype AIV, H5 hypotype and AIV, N6 hypotype of non-N6 hypotype and non-H5 The AIV of hypotype and the test kit of the AIV of non-H5 hypotype and non-N6 hypotype；
(b3) identify whether virus to be measured is H5N6 hypotype AIV, H5 hypotype and AIV, N6 hypotype of non-N6 hypotype And AIV or the non-H5 hypotype of non-H5 hypotype and the AIV of non-N6 hypotype；
(b4) preparation for identify virus to be measured be whether H5N6 hypotype AIV, H5 hypotype and the AIV of non-N6 hypotype, AIV or the non-H5 hypotype of N6 hypotype and non-H5 hypotype and the test kit of the AIV of non-N6 hypotype；
(b5) whether detection sample to be tested contains H5N6 hypotype AIV and/or H5 hypotype and the AIV of non-N6 hypotype And/or N6 hypotype and the AIV of non-H5 hypotype and/or non-H5 hypotype and the AIV of non-N6 hypotype；
(b6) whether preparation detection sample to be tested contains H5N6 hypotype AIV and/or H5 hypotype and non-N6 hypotype The test kit of the AIV of AIV and/or N6 hypotype and the AIV of non-H5 hypotype and/or non-H5 hypotype and non-N6 hypotype.
The present invention also protects the test kit combined containing described primer；The purposes of described test kit is following (c1) or (c2) Or (c3):
(c1) H5N6 hypotype AIV, H5 hypotype and AIV, N6 hypotype of non-N6 hypotype and non-H5 hypotype are differentiated AIV and non-H5 hypotype and the AIV of non-N6 hypotype；
(c2) identify whether virus to be measured is H5N6 hypotype AIV, H5 hypotype and AIV, N6 hypotype of non-N6 hypotype And AIV or the non-H5 hypotype of non-H5 hypotype and the AIV of non-N6 hypotype；
(c3) whether detection sample to be tested contains H5N6 hypotype AIV and/or H5 hypotype and the AIV of non-N6 hypotype And/or N6 hypotype and the AIV of non-H5 hypotype and/or non-H5 hypotype and the AIV of non-N6 hypotype.
The present invention also protects the preparation method of described test kit, including the step individually packed by each bar primer.
The present invention also protects a kind of H5N6 hypotype AIV, H5 hypotype and AIV, N6 hypotype of non-N6 hypotype and non-of differentiating The AIV of H5 hypotype and the method for the AIV of non-H5 hypotype and non-N6 hypotype, comprise the steps (d1) or (d2):
(d1) RNA the reverse transcription of extracting virus to be measured are cDNA, with cDNA as template, use described primer sets Conjunction carries out PCR amplification, obtains pcr amplification product, if containing the DNA fragmentation of 332bp, 428bp in amplified production DNA fragmentation and the DNA fragmentation of 571bp, virus to be measured are or candidate is H5N6 hypotype AIV, if amplified production In containing the DNA fragmentation of 332bp and the DNA fragmentation of 571bp and do not contain the DNA fragmentation of 428bp, virus to be measured For or candidate be H5 hypotype and the AIV of non-N6 hypotype, if containing the DNA fragmentation of 428bp and 571bp in amplified production DNA fragmentation and do not contain the DNA fragmentation of 332bp, virus to be measured is or candidate is for N6 hypotype and non-H5 hypotype AIV, if the DNA fragmentation containing 571bp in amplified production and do not contain the DNA fragmentation of 332bp and 428bp DNA fragmentation, virus to be measured are or candidate is non-N6 hypotype and the AIV of non-H5 hypotype；
(d2) detect in the cDNA of virus to be measured whether containing sequence 10 in ordered list from 5 ' ends the 28th to 598 In DNA fragmentation shown in Wei, sequence table sequence 11 from 5 ' ends the 598th to 929 shown DNA fragmentation or Sequence 12 the 513rd to 940 shown DNA fragmentation from 5 ' ends in sequence table, then makes the following judgment: If simultaneously containing sequence 10 the 28th to 598 shown DNA from 5 ' ends in ordered list in described cDNA Sequence 11 sequence in the 598th to 929 shown DNA fragmentation and sequence table from 5 ' ends in fragment, sequence table 12 from 5 ' ends, the 513rd to 940 shown DNA fragmentation, virus to be measured are or candidate is H5N6 hypotype AIV, If simultaneously containing sequence 10 the 28th to 598 shown DNA sheet from 5 ' ends in ordered list in described cDNA Sequence 11 the 598th to 929 shown DNA fragmentation and not containing in sequence table from 5 ' ends in section and sequence table Sequence 12 the 513rd to 940 shown DNA fragmentation, virus to be measured from 5 ' ends are or candidate is H5 hypotype And the AIV of non-N6 hypotype, if in described cDNA simultaneously containing sequence 10 in ordered list from 5 ' ends the 28th To 598 shown DNA fragmentations and sequence 12 the 513rd to 940 shown DNA fragmentation and not from 5 ' ends The 598th to 929 shown DNA fragmentation, virus to be measured from 5 ' ends containing sequence in ordered list 11 is or waits Elect N6 hypotype and the AIV of non-H5 hypotype as, if in described cDNA containing sequence 10 in ordered list from 5 ' ends 28th to 598 shown DNA fragmentation and do not contain in sequence table sequence 11 from 5 ' ends the 598th to 929 DNA fragmentation shown in Wei and do not contain sequence 12 the 513rd to 940 shown DNA from 5 ' ends in sequence table Fragment, virus to be measured are or candidate is non-N6 hypotype and the AIV of non-H5 hypotype.
The present invention also protect a kind of identify virus to be measured be whether H5N6 hypotype AIV, H5 hypotype and the AIV of non-N6 hypotype, AIV or the non-H5 hypotype of N6 hypotype and non-H5 hypotype and the method for the AIV of non-N6 hypotype, comprise the steps (e1) Or (e2):
(e1) RNA the reverse transcription of extracting virus to be measured are cDNA, with cDNA as template, use described primer sets Conjunction carries out PCR amplification, obtains pcr amplification product, if containing the DNA fragmentation of 332bp, 428bp in amplified production DNA fragmentation and the DNA fragmentation of 571bp, virus to be measured are or candidate is H5N6 hypotype AIV, if amplified production In containing the DNA fragmentation of 332bp and the DNA fragmentation of 571bp and do not contain the DNA fragmentation of 428bp, virus to be measured For or candidate be H5 hypotype and the AIV of non-N6 hypotype, if containing the DNA fragmentation of 428bp and 571bp in amplified production DNA fragmentation and do not contain the DNA fragmentation of 332bp, virus to be measured is or candidate is for N6 hypotype and non-H5 hypotype AIV, if the DNA fragmentation containing 571bp in amplified production and do not contain the DNA fragmentation of 332bp and 428bp DNA fragmentation, virus to be measured are or candidate is non-N6 hypotype and the AIV of non-H5 hypotype, if do not contained in amplified production The DNA fragmentation of 571bp, the virus that virus to be measured is or candidate is non-AIV；
(e2) detect in the cDNA of virus to be measured whether containing sequence 10 in ordered list from 5 ' ends the 28th to 598 In DNA fragmentation shown in Wei, sequence table sequence 11 from 5 ' ends the 598th to 929 shown DNA fragmentation or Sequence 12 the 513rd to 940 shown DNA fragmentation from 5 ' ends in sequence table, then makes the following judgment: If simultaneously containing sequence 10 the 28th to 598 shown DNA from 5 ' ends in ordered list in described cDNA Sequence 11 sequence in the 598th to 929 shown DNA fragmentation and sequence table from 5 ' ends in fragment, sequence table 12 from 5 ' ends, the 513rd to 940 shown DNA fragmentation, virus to be measured are or candidate is H5N6 hypotype AIV, If simultaneously containing sequence 10 the 28th to 598 shown DNA sheet from 5 ' ends in ordered list in described cDNA Sequence 11 the 598th to 929 shown DNA fragmentation and not containing in sequence table from 5 ' ends in section and sequence table Sequence 12 the 513rd to 940 shown DNA fragmentation, virus to be measured from 5 ' ends are or candidate is H5 hypotype And the AIV of non-N6 hypotype, if in described cDNA simultaneously containing sequence 10 in ordered list from 5 ' ends the 28th To 598 shown DNA fragmentations and sequence 12 the 513rd to 940 shown DNA fragmentation and not from 5 ' ends The 598th to 929 shown DNA fragmentation, virus to be measured from 5 ' ends containing sequence in ordered list 11 is or waits Elect N6 hypotype and the AIV of non-H5 hypotype as, if in described cDNA containing sequence 10 in ordered list from 5 ' ends 28th to 598 shown DNA fragmentation and do not contain in sequence table sequence 11 from 5 ' ends the 598th to 929 DNA fragmentation shown in Wei and do not contain sequence 12 the 513rd to 940 shown DNA from 5 ' ends in sequence table Fragment, virus to be measured are or candidate is non-N6 hypotype and the AIV of non-H5 hypotype, if without in order in described cDNA In list, sequence 10 the 28th to 598 shown DNA fragmentation, virus to be measured from 5 ' ends are or candidate is for non- The virus of AIV.
The present invention also protects in a kind of detection sample to be tested whether contain H5N6 hypotype AIV and/or H5 hypotype and non-N6 AIV and/or the N6 hypotype of hypotype and the side of the AIV of the AIV of non-H5 hypotype and/or non-H5 hypotype and non-N6 hypotype Method, comprises the steps (f1) or (f2):
(f1) RNA the reverse transcription of extracting virus to be measured are cDNA, with cDNA as template, use described primer sets Conjunction carries out PCR amplification, obtains pcr amplification product, if containing the DNA fragmentation of 332bp, 428bp in amplified production DNA fragmentation and the DNA fragmentation of 571bp, sample to be tested be following (g1) or (g2): (g1) is doubtful containing H5N6 The sample to be tested of hypotype AIV；(g2) doubtful containing H5 hypotype AIV with the sample to be tested of N6 hypotype AIV, if expanded Increase production the DNA fragmentation and the DNA fragmentation of 571bp containing 332bp in thing and do not contain the DNA fragmentation of 428bp, treat This is the most doubtful containing H5 hypotype and the AIV of non-N6 hypotype for test sample, if the DNA fragmentation containing 428bp in amplified production With the DNA fragmentation of 571bp and not contain the DNA fragmentation of 332bp, sample to be tested doubtful containing N6 hypotype and non-H5 The AIV of hypotype, if the DNA fragmentation containing 571bp in amplified production and do not contain DNA fragmentation and the 428bp of 332bp DNA fragmentation, sample to be tested doubtful containing non-N6 hypotype and the AIV of non-H5 hypotype, if amplified production does not contains There is the doubtful virus not containing AIV of the DNA fragmentation of 571bp, sample to be tested；
(f2) in the cDNA of detection sample to be tested whether containing sequence 10 in ordered list from 5 ' ends the 28th to 598 In DNA fragmentation shown in Wei, sequence table sequence 11 from 5 ' ends the 598th to 929 shown DNA fragmentation or Sequence 12 the 513rd to 940 shown DNA fragmentation from 5 ' ends in sequence table, then makes the following judgment: If simultaneously containing sequence 10 the 28th to 598 shown DNA from 5 ' ends in ordered list in described cDNA Sequence 11 sequence in the 598th to 929 shown DNA fragmentation and sequence table from 5 ' ends in fragment, sequence table 12 from 5 ' ends the 513rd to 940 shown DNA fragmentation, sample to be tested be following (g1) or (g2): (g1) The doubtful sample to be tested containing H5N6 hypotype AIV；(g2) doubtful treating containing H5 hypotype AIV and N6 hypotype AIV Test sample this, if in described cDNA simultaneously containing sequence 10 in ordered list from 5 ' ends shown in the 28th to 598 DNA fragmentation and sequence table in sequence 11 the 598th to 929 shown DNA fragmentation and not containing from 5 ' ends In sequence table, sequence 12 the 513rd to 940 shown DNA fragmentation, sample to be tested from 5 ' ends are doubtful containing H5 Hypotype and the AIV of non-N6 hypotype, if in described cDNA simultaneously containing sequence 10 in ordered list from 5 ' ends the 28 to 598 shown DNA fragmentations and sequence 12 the 513rd to 940 shown DNA fragmentation from 5 ' ends And do not contain in sequence table sequence 11 the 598th to 929 shown DNA fragmentation, sample to be tested from 5 ' ends and doubt Like containing N6 hypotype and the AIV of non-H5 hypotype, if containing sequence 10 in ordered list from 5 ' ends in described cDNA Play the 28th to 598 shown DNA fragmentation and do not contain in sequence table sequence 11 from 5 ' ends the 598th to 929 DNA fragmentation shown in Wei and do not contain sequence 12 the 513rd to 940 shown DNA from 5 ' ends in sequence table Fragment, sample to be tested are doubtful containing non-N6 hypotype and the AIV of non-H5 hypotype, if without in order in described cDNA In list sequence 10 from 5 ' ends the 28th to 598 shown DNA fragmentation, sample to be tested is doubtful does not contains AIV Virus.
The present invention also protects described primer to I.
The present invention also protects the application to I of the described primer, for as follows (h1) or (h2):
(h1) identify whether virus to be measured is AIV；
(h2) identify whether sample to be tested has infected AIV.
The present invention also protects containing the described primer test kit to I；The purposes of described test kit is following (h1) or (h2):
(h1) identify whether virus to be measured is AIV；
(h2) identify whether sample to be tested has infected AIV.
The present invention also protects described primer to II.
The present invention also protects the application to II of the described primer, for as follows (h3) or (h4):
(h3) identify whether virus to be measured is H5 hypotype AIV；
(h4) identify whether sample to be tested has infected H5 hypotype AIV.
The present invention also protects containing the described primer test kit to II；The purposes of described test kit is following (h3) or (h4):
(h3) identify whether virus to be measured is H5 hypotype AIV；
(h4) identify whether sample to be tested has infected H5 hypotype AIV.
The present invention also protects described primer to I II.
The present invention also protects the application to I II of the described primer, for as follows (h5) or (h6):
(h5) identify whether virus to be measured is N6 hypotype AIV；
(h6) identify whether sample to be tested has infected N6 hypotype AIV.
The present invention also protects containing the described primer test kit to II；The purposes of described test kit is following (h5) or (h6):
(h5) identify whether virus to be measured is N6 hypotype AIV；
(h6) identify whether sample to be tested has infected N6 hypotype AIV.
Concretely H5N6 hypotype AIV of virus to be measured described in any of the above, H1N1 hypotype AIV, H2N3 hypotype AIV, H3N6 hypotype AIV, H4N6 hypotype AIV, H5N2 hypotype AIV, H6N6 hypotype AIV, H7N9 hypotype AIV, H8N4 Hypotype AIV, H9N2 hypotype AIV, H9N6 hypotype AIV, H10N3 hypotype AIV, H11 hypotype AIV, H12N5 hypotype AIV, H13N6 hypotype AIV, H15N9 hypotype AIV, H3N2 hypotype AIV, Avian pneumo-encephalitis virus (NDV), infectiousness are propped up Bronchitis virus (IBV) or infectious laryngotracheitis virus (ILTV).
Described in any of the above, the annealing temperature of PCR amplification is specially 53 DEG C.
In the reaction system of PCR amplification described in any of the above, the concentration of each bar primer in primer combination is as follows: M-F The concentration being 0.2pmol/ μ L, H5-F and H5-R with the concentration of M-R is 0.2pmol/ μ L, N6-F and N6-R Concentration be 0.4pmol/ μ L.
Described in any of the above PCR amplification reaction system (25 μ L) concretely: 2 × Easy Taq PCR 12.5 μ L, template 1 μ L, each 0.2 μ L of M-F, M-R, each 0.2 μ L of H5-F, H5-R, each 0.4 μ L of N6-F, N6-R, Finally complement to 25.0 μ L with ddH2O.
Described in any of the above PCR amplification response procedures concretely: 94 DEG C of denaturations 3min；94 DEG C of 30s, 53 DEG C move back Fire 30s, 72 DEG C of 1min, carry out 35 circulations；72 DEG C extend 10min；4 DEG C are terminated amplification.
The present invention establishes the triple PCR detection method of H5 hypotype AIV, N6 hypotype AIV and AIV.Sub-to H5N6 Type AIV only needs a tube reaction just can quickly differentiate, it is also possible to H5 hypotype and the single infection of N6 hypotype and other Hypotype AIV infects and identifies, and provides strong technical support for quick diagnosis H5N6 hypotype AIV.This research and establishment H5 hypotype AIV, N6 hypotype AIV and AIV triple PCR detection method have high specificity, highly sensitive, the most just Prompt feature, specific test is consistent with expected results with sensitivity tests amplified band, for early diagnosis and clinical inspection Survey and reference frame is provided.
Accompanying drawing explanation
Fig. 1 is the triple PCR amplification figure in embodiment 2.
Fig. 2 is specificity experiments triple PCR result figure in embodiment 4.
Fig. 3 is that embodiment 5 medium sensitivity tests triple PCR result figure.
Detailed description of the invention
Below example facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiment Method, if no special instructions, is conventional method.Test material used in following embodiment, if no special instructions, It is and is commercially available from routine biochemistry reagent shop.Quantitative test in following example, is respectively provided with three times and repeats in fact Test, results averaged.
PMD18-T carrier: precious biological engineering (Dalian) company limited.
H1N1 hypotype AIV strain: list of references: Yi P, Xie Z, Liu J, et al.Visual detection of H3 subtype avian influenza viruses by reverse transcription loop-mediated Isothermal amplification assay [J] .Virology Journal, 2011,8 (1): 1-10., H1N1 The hypotype AIV Strain entitled " A/Duck/Guangxi/030D/2009 (H1N1) " in list of references；The public can Obtain from Veterinary Institute of Guangxi Zhuang Autonomous Region.
H2N3 hypotype AIV strain: list of references: Yi P, Xie Z, Liu J, et al.Visual detection of H3 subtype avian influenza viruses by reverse transcription loop-mediated Isothermal amplification assay [J] .Viroloay Journal, 2011,8 (1): 1-10., H2N3 The hypotype AIV Strain entitled " A/Mallard/Alberta/77 (H2N3) " in list of references；The public can be from extensively Western Zhuang autonomous region veterinary institute obtains.
H3N6 hypotype AIV strain 1: list of references: Liu Tingting, Xie Zhixun, Song Degui, waits .H3 subtype avian influenza virus Separation with identify [J]. Chinese poultry resource, 2015,37 (19): 64-67.H3N6 hypotype AIV Strain are in list of references Entitled " A/Pigeon/Guangxi/020P/2009 (H3N6) "；The public can grind from Guangxi Zhuang Autonomous Region veterinary Study carefully and obtained.
H3N6 hypotype AIV strain 2: list of references: Liu Tingting, Xie Zhixun, Song Degui, waits .H3 subtype avian influenza virus Separation with identify [J]. Chinese poultry resource, 2015,37 (19): 64-67.H3N6 hypotype AIV Strain are in list of references Entitled " A/Duck/Guangxi/175D12/2014 (H3N6) "；The public can grind from Guangxi Zhuang Autonomous Region veterinary Study carefully and obtained.
H4N6 hypotype AIV strain: list of references: Luo S, Xie Z, Xie L, et al.Reverse-transcription, loop-mediated isothermal amplification assay for the sensitive and rapid Detection of H10 subtype avian influenza viruses [J] .Virology Journal, 2014, 12 (12): 1-7., the H4N6 hypotype AIV Strain entitled " A/Duck/Guangxi/070D/2010 in list of references (H4N6)”；The public can obtain from Veterinary Institute of Guangxi Zhuang Autonomous Region.
H5N2 hypotype AIV strain: list of references: Yi P, Xie Z, Liu J, et al.Visual detection of H3 subtype avian influenza viruses by reverse transcription loop-mediated Isothermal amplification assay [J] .Virology Journal, 2011,8 (1): 1-10., H5N2 The hypotype AIV Strain entitled " A/Turkey/GA/209092/02 (H5N2) " in list of references；The public can be from Veterinary Institute of Guangxi Zhuang Autonomous Region obtains.
H6N6 hypotype AIV strain: list of references: Luo S, Xie Z, Xie L, et al.Reverse-transcription, loop-mediated isothermal amplification assay for the sensitive and rapid Detection of H10 subtype avian influenza viruses [J] .Virology Journal, 2014, Entitled in list of references of 12 (12): 1-7., H6N6 hypotype AIV Strain “A/duck/Guangxi/GXd-4/2009(H6N6)”；The public can obtain from Veterinary Institute of Guangxi Zhuang Autonomous Region.
H7N9 hypotype AIV RNA: list of references: Luo Sisi etc.；H7 hypotype and N9 subtype avian influenza virus RT-LAMP The foundation of visible detection method. journal of animal science and veterinary medicine 2015,46 (7): 1176-1183.；H7N9 hypotype AIV RNA Entitled " H7N9 RNA " in list of references；The public can obtain from Veterinary Institute of Guangxi Zhuang Autonomous Region.
H8N4 hypotype AIV strain: list of references: Yi P, Xie Z, Liu J, et al.Visual detection of H3 subtype avian influenza viruses by reverse transcription loop-mediated Isothermal amplification assay [J] .Virology Journal, 2011,8 (1): 1-10., H8N4 The hypotype AIV Strain entitled " A/Turkey/Ontario/6118/67 (H8N4) " in list of references；The public can Obtain from Veterinary Institute of Guangxi Zhuang Autonomous Region.
H9N2 hypotype AIV strain: list of references: Yi P, Xie Z, Liu J, et al.Visual detection of H3 subtype avian influenza viruses by reverse transcription loop-mediated Isothermal amplification assay [J] .Virology Journal, 2011,8 (1): 1-10., H9N2 The hypotype AIV Strain entitled " A/Duck/Guangxi/RX/09 (H9N2) " in list of references；The public can be from extensively Western Zhuang autonomous region veterinary institute obtains.
H9N6 hypotype AIV strain: list of references: Xie Z, Pang Y S, Liu J, et al.A multiplex RT-PCR for detection of type a influenza virus and differentiation of avian H5.H7 And H9 hemagglutinin subtypes [J] .Mol Cell Probes, 2006,20 (3-4): 245-249. The H9N6 hypotype AIV Strain entitled " Duck/HK/147/77 " in list of references；The public can from Zhuang nationality in Guangxi certainly Control district's veterinary institute to obtain.
H10N3 hypotype AIV strain: list of references: Xie Z, PangYS, Liu J, et al.A multiplex RT-PCR for detection of type a influenza virus and differentiation of avian H5.H7 And H9 hemagglutinin subtypes [J] .Mol Cell Probes, 2006,20 (3-4): 245-249., The H10N3 hypotype AIV Strain entitled " Duck/HK/876/80 " in list of references；The public can from Zhuang nationality in Guangxi certainly Control district's veterinary institute to obtain.
H11 hypotype AIV strain: list of references: Yi P, Xie Z, Liu J, et al.Visual detection of H3 subtype avian influenza viruses by reverse transcription loop-mediated Isothermal amplification assay [J] .Virology Journal, 2011,8 (1): 1-10., H11 The hypotype AIV Strain entitled " A/Chicken/Guangxi/43C/09 (H11) " in list of references；The public can Obtain from Veterinary Institute of Guangxi Zhuang Autonomous Region.
H12N5 hypotype AIV strain: list of references: Yi P, Xie Z, Liu J, et al.Visual detection of H3 subtype avian influenza viruses by reverse transcription loop-mediated Isothermal amplification assay [J] .Virology Journal, 2011,8 (1): 1-10., H12N5 The hypotype AIV Strain entitled " A/Duck/Alberta/60/76 (H12N5) " in list of references；The public can be from extensively Western Zhuang autonomous region veterinary institute obtains
H13N6 hypotype AIV strain: list of references: Yi P, Xie Z, Liu J, et al.Visual detection of H3subtype avian influenza viruses by reverse transcription loop-mediated Isothermal amplification assay [J] .Virology Journal, 2011,8 (1): 1-10., H13N6 The hypotype AIV Strain entitled " A/Gull/MD/704/77 (H13N6) " in list of references；The public can be from Guangxi Zhuang autonomous region veterinary institute obtains.
H15N9 hypotype AIV strain: list of references: Luo S, Xie Z, Xie L, et al. Reverse-transcription, loop-mediated isothermal amplification assay for the sensitive and rapid detection of H10 subtype avian influenza viruses[J]. Virology Journal, entitled in list of references of 2014,12 (12): 1-7., H15N9 hypotype AIV Strain “A/wedge-tgiled shearwater/Western Australia/2576/1979(H15N9)”；The public can be from Veterinary Institute of Guangxi Zhuang Autonomous Region obtains.
H3N2 hypotype AIV strain: list of references: Yi P, Xie Z, Liu J, et al.Visual detection of H3 subtype avian influenza viruses by reverse transcription loop-mediated Isothermal amplification assay [J] .Virology Journal, 2011,8 (1): 1-10., H3N2 The hypotype AIV Strain entitled " A/Duck/Guangxi/N42/2009 (H3N2) " in list of references；The public can Obtain from Veterinary Institute of Guangxi Zhuang Autonomous Region.
Avian pneumo-encephalitis virus (NDV): list of references: Yi P, Xie Z, Liu J, et al.Visual detection 0f H3 subtype avian influenza viruses by reverse transcription loop-mediated Isothermal amplification assay [J] .Virology Journal, 2011,8 (1): 1-10., new city Epidemic disease poison (NDV) entitled " Newcastle disease virus (Lasota) " in list of references；The public Can obtain from Veterinary Institute of Guangxi Zhuang Autonomous Region.
Infectious bronchitis virus (IBV): list of references: Yi P, Xie Z, Liu J, et al.Visual detection of H3 subtype avian influenza viruses by reverse transcription Loop-mediated isothermal amplification assay [J] .Virology Journal, 2011, 8 (1): 1-10., the infectious bronchitis virus (IBV) entitled " Infectious in list of references bronchitis virus(M41)”；The public can obtain from Veterinary Institute of Guangxi Zhuang Autonomous Region.
Infectious laryngotracheitis virus (ILTV): list of references: Yi P, Xie Z, Liu J, et al.Visual detection of H3 subtype avian influenza viruses by reverse transcription Loop-mediated isothermal amplification assay [J] .Virology Journal, 2011, 8 (1): 1-10., the infectious laryngotracheitis virus (ILTV) entitled " Infectious in list of references Laryngotracheitis virus”；The public can obtain from Veterinary Institute of Guangxi Zhuang Autonomous Region.
Chicken virus mycoplasma (MG): list of references: Yi P, Xie Z, Liu J, et al.Visual detection of H3 subtype avian influenza viruses by reverse transcription loop-mediated Isothermal amplification assay [J] .Virology Journal, 2011,8 (1): 1-10., chicken poison The mycoplasma (MG) entitled " Mycoplasma gallisepticum (S6) " in list of references；The public can be from Veterinary Institute of Guangxi Zhuang Autonomous Region obtains.
Embodiment 1, design of primers
Carry out a large amount of sequence analysis, comparison obtains the some primers for identifying AIV, H5 hypotype AIV and N6 hypotype AIV. Each primer is carried out preliminary experiment, compares the performance such as sensitivity, specificity, finally give and draw for a pair for identify AIV Thing, for identifying the pair of primers of H5 hypotype AIV and for identifying the pair of primers of N6 hypotype AIV.
For identifying that the specific primer of AIV forms (5 ' → 3 ') by following two primers:
M-F (sequence 1 of sequence table): GAGTCTTCTAACCGAGGTCGAAA；
M-R (sequence 2 of sequence table): CTGCTCCATAGCCTTAGCTGTAG；
For identifying that the specific primer of H5 hypotype AIV forms (5 ' → 3 ') by following two primers:
H5-F (sequence 3 of sequence table): ACTGTGGGGGATTCACCATTC；
H5-R (sequence 4 of sequence table): TCGCCCCTATTGGAGTTTGAC；
For identifying that the specific primer of N6 hypotype AIV forms (5 ' → 3 ') by following two primers:
N6-F (sequence 5 of sequence table): AGTTGGGAAATGGGTCAAGCA；
N6-R (sequence 6 of sequence table): GGTCTATTTGCCCCCTTCCAA；
For identify the primer of AIV to named primer to I.
For identify the primer of H5 hypotype AIV to named primer to II.
For identify the primer of N6 hypotype AIV to named primer to I II.
I II is made up of by primer combination by I, primer by II and primer primer.
Embodiment 2, triple PCR reaction condition optimization
One, prepared by template
1, extracting the total serum IgE of H5N2 hypotype AIV, reverse transcription is cDNA.
2, extracting the total serum IgE of H13N6 hypotype AIV, reverse transcription is cDNA.
3, the cDNA obtained with step 1 is as template, uses primer M-1 and primer M-2 to carry out PCR amplification, obtains Amplified production (sequence 10 of sequence table), product reclaims and is connected with PMD18-T carrier after purification, obtains recombiant plasmid PMD18-T-M, concentration is 12.63 × 1016Copy/μ L.
M-1:5 '-AGCAAAAGCAGGATAG-3 '；
M-2:5 '-AGTAGAAACAAGGTAGTTTTT-3 '；
4, the cDNA obtained with step 1 is as template, uses primer HA-1 and primer HA-2 to carry out PCR amplification, To amplified production (sequence 11 of sequence table), product reclaims and is connected with PMD18-T carrier after purification, obtains matter of recombinating Grain PMD18-T-H5, concentration is 10.9 × 1015Copy/μ L.
HA-1:5 '-AGCAAAAGCAGGGG-3 '；
HA-2:5 '-AGTAGAAACAAGGGTGTTTT-3 '；
5, the cDNA obtained with step 2 is as template, uses primer NA-1 and primer NA-2 to carry out PCR amplification, To amplified production (sequence 12 of sequence table), product reclaims and is connected with PMD18-T carrier after purification, obtains matter of recombinating Grain PMD18-T-N6, concentration is 10.1 × 1015Copy/μ L.
NA-1:5 '-TATTCGTCTCAGGGAGCGAAAGCAGGGTGAAAATG-3 '；
NA-2:5 '-ATATCGTCTGTATTAGTAGAAACAAGGGTGTTTT-3 '；
6, by the dilutest to recombiant plasmid PMD18-T-M, recombiant plasmid PMD18-T-H5 and recombiant plasmid PMD18-T-N6 It is interpreted into 8.41 × 1010Copy/μ L, mixes according to copy number 1: 1: 1 ratio, obtains mixing plasmid DNA.
Two, primer concentration optimization
Take mixing plasmid DNA that step one obtains as template, use the primer combination of embodiment 1 preparation to carry out triple PCR。
The reaction system (25.0 μ L) of triple PCR: 2 × Easy Taq PCR 12.5 μ L, template 1 μ L (restructuring matter Grain PMD18-T-M, recombiant plasmid PMD18-T-H5 and recombiant plasmid PMD18-T-N6 is 8.41 × 1010Copy/μ L), each 0.2 μ L of M-F, M-R, each 0.2 μ L of H5-F, H5-R, each 0.4 μ L of N6-F, N6-R, finally use ddH2O Complement to 25.0 μ L.
Arranging different primer concentrations, method to set up is as shown in table 1, arranges 216 according to 3 factors shown in table 1 Individual process group.
Table 1 primer concentration in reaction system
The response procedures of triple PCR: 94 DEG C of denaturations 3min；94 DEG C of 30s, 53 DEG C of annealing 30s, 72 DEG C of 1min, Carry out 35 circulations；72 DEG C extend 10min；4 DEG C are terminated amplification.
The amplified production of triple PCR is carried out 1.0% agarose gel electrophoresis.
According to electrophoresis result, select the primer concentration that expanding effect is optimal: the preferred concentration of M-F and M-R is The preferred concentration of 0.2pmol/ μ L, H5-F and H5-R is the preferred concentration of 0.2pmol/ μ L, N6-F and N6-R It is 0.4pmol/ μ L.
Three, annealing temperature optimization
Take mixing plasmid DNA that step one obtains as template, use the primer combination of embodiment 1 preparation to carry out triple PCR。
The reaction system (25.0 μ L) of triple PCR: 2 × Easy Taq PCR 12.5 μ L, template 1 μ L (restructuring matter Grain PMD18-T-M, recombiant plasmid PMD18-T-H5 and recombiant plasmid PMD18-T-N6 is 8.41 × 1010Copy/μ L), each 0.2 μ L of M-F, M-R, each 0.2 μ L of H5-F, H5-R, each 0.4 μ L of N6-F, N6-R, finally use ddH2O Complement to 25.0 μ L.In the reaction system of triple PCR, the concentration of M-F and M-R is 0.2pmol/ μ L, H5-F The concentration being 0.2pmol/ μ L, N6-F and N6-R with the concentration of H5-R is 0.4pmol/ μ L.
The response procedures of triple PCR: 94 DEG C of denaturations 3min；94 DEG C of 30s, annealing 30s, 72 DEG C of 1min, carried out 35 circulations；72 DEG C extend 10min；4 DEG C are terminated amplification.
It is respectively provided with following annealing temperature:
Annealing temperature I:52 DEG C；
Annealing temperature II:53 DEG C；
Annealing temperature I II: 54 DEG C；
Annealing temperature IV: 55 DEG C；
Annealing temperature V:56 DEG C；
Annealing temperature VI:57 DEG C；
Annealing temperature VII:58 DEG C；
The amplified production of triple PCR is carried out 1.0% agarose gel electrophoresis.
According to electrophoresis result, the annealing temperature selecting expanding effect optimal is 53 DEG C.
Combining step two and step 3, obtain as drawn a conclusion: in triple PCR reaction system, M-F's and M-R is preferred Concentration is the preferred concentration of 0.2pmol/ μ L, H5-F and H5-R and is 0.2pmol/ μ L, N6-F and N6-R Preferred concentration is 0.4pmol/ μ L；The preferred response procedures of triple PCR is: 94 DEG C of denaturations 3min；94℃30s、 53 DEG C of annealing 30s, 72 DEG C of 1min, carry out 35 circulations；72 DEG C extend 10min；4 DEG C are terminated amplification.
Four, optimal conditions checking
Sample to be tested is: the recombiant plasmid PMD18-T-M of step one preparation, the recombiant plasmid of step one preparation The recombiant plasmid PMD18-T-N6 of PMD18-T-H5, step one preparation.
1, recombiant plasmid PMD18-T-M, recombiant plasmid PMD18-T-H5 and recombiant plasmid PMD18-T-N6 are diluted respectively Become 8.41 × 1010Copy/μ L.
2, by the recombiant plasmid PMD18-T-M of step 1, recombiant plasmid PMD18-T-H5 and recombiant plasmid PMD18-T-N6 Mix according to copy number 1: 1: 1 ratio, obtain mixing plasmid DNA.
3, respectively using the mixing plasmid DNA of each plasmid DNA of step 1 and step 2 as template, embodiment is used The primer combination of 1 preparation carries out triple PCR.
The reaction system (25.0 μ L) of triple PCR: 2 × Easy Taq PCR 12.5 μ L, template l μ L, M-F, The each 0.2 μ L of M-R, each 0.2 μ L of H5-F, H5-R, each 0.4 μ L of N6-F, N6-R, finally use ddH2O complements to 25.0μL.In the reaction system of triple PCR, the concentration of M-F and M-R is 0.2pmol/ μ L, H5-F and H5-R Concentration be the concentration of 0.2pmol/ μ L, N6-F and N6-R and be 0.4pmol/ μ L.Arrange with equal-volume water generation Negative control for sample to be tested.
Template is the recombiant plasmid PMD18-T-M of step 1, recombiant plasmid PMD18-T-H5 or recombiant plasmid During PMD18-T-N6, in l μ L template, the concentration of recombinant plasmid dna is 8.41 × 1010Copy/μ L.
When template is the mixing plasmid DNA of step 2, the concentration mixing plasmid DNA in 1 μ L template is 8.41 × 1010Copy Shellfish/μ L.
The response procedures of triple PCR is: 94 DEG C of denaturations 3min；94 DEG C of 30s, 53 DEG C of annealing 30s, 72 DEG C of 1min, Carry out 35 circulations；72 DEG C extend 10min；4 DEG C are terminated amplification.
The amplified production of triple PCR is carried out 1.0% agarose gel electrophoresis.
Result is as shown in Figure 1.In Fig. 1, M is DL1000DNA Maker, and swimming lane 1 is negative control, and swimming lane 2 is mixing The amplified production of the triple PCR of plasmid DNA, swimming lane 3 is that the amplification of the triple PCR of recombiant plasmid PMD18-T-H5DNA is produced Thing, swimming lane 4 is the amplified production of the triple PCR of recombiant plasmid PMD18-T-N6DNA, and swimming lane 5 is recombiant plasmid The amplified production of the triple PCR of PMD18-T-M DNA.Use triple PCR special to mixing plasmid amplification appearance 3 Property band (strips A: 332bp, band B:428bp and band C:571bp)；Recombiant plasmid PMD18-T-H5 is expanded Increase result and 2 specific bands (strips A: 332bp and band C:571bp) occur；To recombiant plasmid PMD18-T-N6 There are 2 specific bands (band B:428bp and band C:571bp) in amplification, to recombiant plasmid PMD18-T-M There is 1 specific band (band C:571bp) in amplification.Amplified production is checked order, the sequencing result sequence that strips A is corresponding Row as shown in sequence 8, sequencing result sequence corresponding for band B as shown in sequence 9, sequencing result sequence corresponding for band C As shown in sequence 7.
Embodiment 3, triple PCR detection method are set up
One, according to the condition optimizing result of embodiment 2, the method establishing following detection virus to be measured:
1, extract the total serum IgE of virus to be measured, and reverse transcription becomes cDNA.
2, the cDNA obtained with step 1 is as template, uses the primer combination of embodiment 1 to carry out triple PCR amplification.
The reaction system (25.0 μ L) of triple PCR: 2 × Easy Taq PCR 12.5 μ L, template 1 μ L, M-F, The each 0.2 μ L of M-R, each 0.2 μ L of H5-F, H5-R, each 0.4 μ L of N6-F, N6-R, finally complement to ddH2O 25.0μL.In the reaction system of triple PCR, the concentration of M-F and M-R is 0.2pmol/ μ, H5-F and H5-R Concentration be the concentration of 0.2pmol/ μ L, N6-F and N6-R and be 0.4pmol/ μ L.
The response procedures of triple PCR is: 94 DEG C of denaturations 3min；94 DEG C of 30s, 53 DEG C of annealing 30s, 72 DEG C of 1min, Carry out 35 circulations；72 DEG C extend 10min；4 DEG C are terminated amplification.
3, the amplified production of triple PCR is carried out 1.0% agarose gel electrophoresis, judges according to electrophoresis result, Determination methods is as follows:
If containing the DNA fragmentation of 332bp, the DNA fragmentation of 428bp and the DNA fragmentation of 571bp in amplified production, Virus to be measured is or candidate is H5N6 hypotype AIV；
If containing the DNA fragmentation of 332bp and the DNA fragmentation of 571bp, the DNA not containing 428bp in amplified production Fragment, virus to be measured is or candidate is H5 hypotype and the AIV of non-N6 hypotype；
If containing the DNA fragmentation of 428bp and the DNA fragmentation of 571bp, the DNA not containing 332bp in amplified production Fragment, virus to be measured is or candidate is N6 hypotype and the AIV of non-H5 hypotype；
If in amplified production containing 571bp DNA fragmentation, do not contain the DNA fragmentation of 332bp and the DNA of 428bp Fragment, virus to be measured is or candidate is non-N6 hypotype and the AIV of non-H5 hypotype；
If amplified production not containing the DNA fragmentation of 571bp, the virus that virus to be measured is or candidate is non-AIV.
Two, according to the condition optimizing result of embodiment 2, the method establishing following detection sample to be tested:
1, extract the total serum IgE of sample to be tested, and reverse transcription becomes cDNA.
2, the cDNA obtained with step 1 is as template, uses the primer combination of embodiment 1 to carry out triple PCR amplification.
The reaction system (25.0 μ L) of triple PCR: 2 × Easy Taq PCR 12.5 μ L, template 1 μ L, M-F, The each 0.2 μ L of M-R, each 0.2 μ L of H5-F, H5-R, each 0.4 μ L of N6-F, N6-R, finally complement to ddH2O 25.0μL.In the reaction system of triple PCR, the concentration of M-F and M-R is 0.2pmol/ μ L, H5-F and H5-R Concentration be the concentration of 0.2pmol/ μ L, N6-F and N6-R and be 0.4pmol/ μ L.
The response procedures of triple PCR is: 94 DEG C of denaturations 3min；94 DEG C of 30s, 53 DEG C of annealing 30s, 72 DEG C of 1min, Carry out 35 circulations；72 DEG C extend 10min；4 DEG C are terminated amplification.
3, the amplified production of triple PCR is carried out 1.0% agarose gel electrophoresis, judges according to electrophoresis result, Determination methods is as follows:
If containing the DNA fragmentation of 332bp, the DNA fragmentation of 428bp and the DNA fragmentation of 571bp in amplified production, Sample to be tested is following (1) or (2): (1) doubtful sample to be tested containing H5N6 hypotype AIV；(2) doubtful contain There are H5 hypotype AIV and the sample to be tested of N6 hypotype AIV；
If containing the DNA fragmentation of 332bp and the DNA fragmentation of 571bp, the DNA not containing 428bp in amplified production Fragment, sample to be tested is doubtful containing H5 hypotype and the AIV of non-N6 hypotype；
If containing the DNA fragmentation of 428bp and the DNA fragmentation of 571bp, the DNA not containing 332bp in amplified production Fragment, sample to be tested is doubtful containing N6 hypotype and the AIV of non-H5 hypotype；
If in amplified production containing 571bp DNA fragmentation, do not contain the DNA fragmentation of 332bp and the DNA of 428bp Fragment, sample to be tested is doubtful containing non-N6 hypotype and the AIV of non-H5 hypotype；
If not containing the DNA fragmentation of 571bp in amplified production, sample to be tested is doubtful does not contains AIV.
Embodiment 4, specificity
Sample to be tested is: sample to be tested is: H1N1 hypotype AIV strain, H2N3 hypotype AIV strain, H3N6 hypotype AIV strain 1, H4N6 hypotype AIV strain, H5N2 hypotype AIV strain, H6N6 hypotype AIV strain, H7N9 hypotype AIV RNA, H8N4 hypotype AIV strain, H9N2 hypotype AIV strain, H9N6 hypotype AIV strain, H10N3 hypotype AIV strain, H11 hypotype AIV strain, H12N5 hypotype AIV strain, H13N6 hypotype AIV strain, H3N6 hypotype AIV strain 2, H15N9 hypotype AIV strain, H3N2 hypotype AIV strain, Avian pneumo-encephalitis virus (NDV), infectiousness are propped up Bronchitis virus (IBV), infectious laryngotracheitis virus (ILTV), chicken virus mycoplasma (MG).
1, the genomic DNA of sample to be tested is extracted.Sample to be tested be respectively as follows: infectious laryngotracheitis virus (ILTV), Chicken virus mycoplasma (MG).
2, extract the total serum IgE of sample to be tested, and reverse transcription becomes cDNA.Sample to be tested is respectively as follows: H1N1 hypotype AIV Strain, H2N3 hypotype AIV strain, H3N6 hypotype AIV strain 1, H4N6 hypotype AIV strain, H5N2 hypotype AIV Strain, H6N6 hypotype AIV strain, H8N4 hypotype AIV strain, H9N2 hypotype AIV strain, H9N6 hypotype AIV Strain, H10N3 hypotype AIV strain, H11 hypotype AIV strain, H12N5 hypotype AIV strain, H13N6 hypotype AIV Strain, H3N6 hypotype AIV strain 2, H15N9 hypotype AIV strain, H3N2 hypotype AIV strain, Avian pneumo-encephalitis virus (NDV), infectious bronchitis virus (IBV).
3, H7N9 hypotype AIV RNA reverse transcription is become cDNA.
4, each cDNA sample and step that each genomic DNA sample of step 1 being obtained respectively, step 2 obtain Rapid 3 cDNA obtained, as template, use the primer combination of embodiment 1 preparation to carry out triple PCR.
The reaction system (25.0 μ L) of triple PCR: 2 × Easy Taq PCR 12.5 μ L, template 1 μ L, M-F, The each 0.2 μ L of M-R, each 0.2 μ L of H5-F, H5-R, each 0.4 μ L of N6-F, N6-R, finally complement to ddH2O 25.0μL.In the reaction system of triple PCR, the concentration of M-F and M-R is 0.2pmol/ μ L, H5-F and H5-R Concentration be the concentration of 0.2pmol/ μ L, N6-F and N6-R and be 0.4pmol/ μ L.Arrange and use H5N2 hypotype AIV strain cDNA and H13N6 hypotype AIV strain cDNA replaces treating according to the mixture that copy number 1: 1 ratio mixes Test sample positive control A originally, is arranged with recombiant plasmid PMD18-T-H5 and recombiant plasmid PMD18-T-N6 according to copy The mixture of several 1: 1 ratio mixing replaces the positive control B of sample to be tested.Arrange and replace sample to be tested with equal-volume water Negative control.
When template is the genomic DNA of infectious laryngotracheitis virus (ILTV), the DNA content in 1 μ L template is 890μg；
When template is the genomic DNA of chicken virus mycoplasma (MG), the DNA content in 1 μ L template is 924 μ g；
When template is the cDNA of H1N1 hypotype AIV strain, the DNA content in 1 μ L template is 1055 μ g；
When template is the cDNA of H2N3 hypotype AIV strain, the DNA content in 1 μ L template is 1060 μ g；
When template is the cDNA of H3N2 hypotype AIV strain, the DNA content in 1 μ L template is 1054 μ g；
When template is the cDNA of H3N6 hypotype AIV strain 1, the DNA content in 1 μ L template is 1067 μ g；
When template is the cDNA of H4N6 hypotype AIV strain, the DNA content in 1 μ L template is 1046 μ g；
When template is the cDNA of H5N2 hypotype AIV strain, the DNA content in 1 μ L template is 1078 μ g；
When template is the cDNA of H6N6 hypotype AIV strain, the DNA content in 1 μ L template is 1068 μ g；
When template is the cDNA of H7N9 hypotype AIV, the DNA content in 1 μ L template is 1070 μ g；
When template is the cDNA of H8N4 hypotype AIV strain, the DNA content in 1 μ L template is 1056 μ g；
When template is the cDNA of H9N2 hypotype AIV strain, the DNA content in 1 μ L template is 1069 μ g；
When template is the cDNA of H9N6 hypotype AIV strain, the DNA content in 1 μ L template is 1087 μ g；
When template is the cDNA of H10N3 hypotype AIV strain, the DNA content in 1 μ L template is 1060 μ g；
When template is the eDNA of H11 hypotype AIV strain, the DNA content in 1 μ L template is 1053 μ g；
When template is the cDNA of H12N5 hypotype AIV strain, the DNA content in 1 μ L template is 1063 μ g；
When template is the eDNA of H13N6 hypotype AIV strain, the DNA content in 1 μ L template is 1065 μ g；
When template is the cDNA of H3N6 hypotype AIV strain 2, the DNA content in 1 μ L template is 1068 μ g；
When template is the cDNA of H15N9 hypotype AIV strain, the DNA content in 1 μ L template is 1063 μ g；
When template is the cDNA of Avian pneumo-encephalitis virus (NDV), the DNA content in 1 μ L template is 1080 μ g；
DNA content 1083 μ g when template is the cDNA of infectious bronchitis virus (IBV), in 1 μ L template；
The response procedures of triple PCR is: 94 DEG C of denaturations 3min；94 DEG C of 30s, 53 DEG C of annealing 30s, 72 DEG C of 1min, Carry out 35 circulations；72 DEG C extend 10min；4 DEG C are terminated amplification.
The amplified production of triple PCR is carried out 1.0% agarose gel electrophoresis and takes pictures.
Result is shown in Fig. 2.In Fig. 2, M is DL1000DNA Maker, and swimming lane 1 is the expansion of positive control A triple PCR Volume increase thing, swimming lane B is the amplified production of positive control B triple PCR, and swimming lane 3 is H1N1 hypotype AIV strain cDNA The amplified production of triple PCR, swimming lane 4 is the amplified production of the triple PCR of H2N3 hypotype AIV strain cDNA, Swimming lane 5 is the amplified production of the triple PCR of H3N6 hypotype AIV strain 1cDNA, and swimming lane 6 is H4N6 hypotype AIV The amplified production of the triple PCR of strain cDNA, swimming lane 7 is the expansion of the triple PCR of H5N2 hypotype AIV strain cDNA Volume increase thing, swimming lane 8 is the amplified production of the triple PCR of H6N6 hypotype AIV strain cDNA, and swimming lane 9 is H7N9 The amplified production of the triple PCR of hypotype AIV cDNA, swimming lane 10 is the triple PCR of H8N4 hypotype AIV strain cDNA Amplified production, swimming lane 11 is the amplified production of the triple PCR of H9N6 hypotype AIV strain cDNA, and swimming lane 12 is The amplified production of the triple PCR of H10N3 hypotype AIV strain cDNA, swimming lane 13 is H11 hypotype AIV strain cDNA The amplified production of triple PCR, swimming lane 14 is the amplified production of the triple PCR of H12N5 hypotype AIV strain cDNA, Swimming lane 15 is the amplified production of the triple PCR of H13N6 hypotype AIV strain cDNA, and swimming lane 16 is H3N6 hypotype AIV The amplified production of the triple PCR of strain 2cDNA, swimming lane 17 is the triple PCR of H15N9 hypotype AIV strain cDNA Amplified production, swimming lane 18 is the amplified production of the triple PCR of H3N2 hypotype AIV strain cDNA, and swimming lane 19 is The amplified production of the triple PCR of H9N2 hypotype AIV strain cDNA, swimming lane 20 is the triple of Avian pneumo-encephalitis virus cDNA The amplified production of PCR, swimming lane 21 is the amplified production of the triple PCR of infectious bronchitis virus cDNA, swimming lane 22 is the amplified production of the triple PCR of infectious laryngotracheitis viral genome group DNA, and swimming lane 23 is chicken virus mycoplasma The amplified production of the triple PCR of genomic DNA, swimming lane 24 is negative control.Result shows, uses triple PCR There are 3 specific bands (332bp, 428bp and 571bp) in positive control A and positive control B amplification； There are 2 specific bands (332bp and 571bp) in H5N2 hypotype AIV amplification；To H3N6, H4N6, There are 2 specific bands (428bp and 571bp) in H6N6, H9N6, H13N6 hypotype AIV amplification, to other There is 1 specific band (571bp) in the amplification of hypotype AIV；Amplification to common poultry disease virus does not all occur Band, and are there is not band in other viruses and mycoplasma.
Embodiment 5, sensitivity
1, plasmid DNA is mixed according to the method preparation of the step one of embodiment 2.
2, ddH is used2The mixing plasmid DNA that 10 times of gradient dilution steps 1 of O obtain, obtains each diluent.
3, each diluent obtained using step 2 is as template, uses the primer combination of embodiment 1 preparation to carry out triple PCR。
The reaction system (25.0 μ L) of triple PCR: 2 × Easy Taq PCR 12.5 μ L, template 1 μ L, M-F, The each 0.2 μ L of M-R, each 0.2 μ L of H5-F, H5-R, each 0.4 μ L of N6-F, N6-R, finally complement to ddH2O 25.0μL.In the reaction system of triple PCR, the concentration of M-F and M-R is 0.2pmol/ μ L, H5-F and H5-R Concentration be the concentration of 0.2pmol/ μ L, N6-F and N6-R and be 0.4pmol/ μ L.Arrange with equal-volume water generation Negative control for sample to be tested.
Diluent owing to using is different, forms the most different reaction systems:
In reaction system 1, in mixing plasmid DNA, the initial concentration of every kind of plasmid DNA is: 2 × 107Copy/μ L；
In reaction system 2, in mixing plasmid DNA, the initial concentration of every kind of plasmid DNA is: 2 × 106Copy/μ L；
In reaction system 3, in mixing plasmid DNA, the initial concentration of every kind of plasmid DNA is: 2 × 105Copy/μ L；
In reaction system 4, in mixing plasmid DNA, the initial concentration of every kind of plasmid DNA is: 2 × 104 copy/μ L；
In reaction system 5, in mixing plasmid DNA, the initial concentration of every kind of plasmid DNA is: 2 × 103Copy/μ L；
In reaction system 6, in mixing plasmid DNA, the initial concentration of every kind of plasmid DNA is: 2 × 102Copy/μ L；
In reaction system 7, in mixing plasmid DNA, the initial concentration of every kind of plasmid DNA is: 20 copy/μ L；
The response procedures of triple PCR is: 94 DEG C of denaturations 3min；94 DEG C of 30s, 53 DEG C of annealing 30s, 72 DEG C of 1min, Carry out 35 circulations；72 DEG C extend 10min；4 DEG C are terminated amplification.
The amplified production of triple PCR is carried out 1.0% agarose gel electrophoresis and takes pictures.
Result is shown in Fig. 3.In Fig. 3, M is DL1000DNA Maker, and swimming lane 1-7 is corresponding in turn to use reaction system The amplified production of triple PCR during 1-7, swimming lane 8 is negative control.Result shows, uses triple PCR detection AIV Time, the minimum template content needed for detection is 2 × 103Individual copy；Use AIV and N6 of triple PCR detection H5 hypotype During the AIV of hypotype, the minimum template content needed for detection is 2 × 102Individual copy.

Claims (10)

1. primer combination, is made up of III II and primer I, primer primer；
I is made up of by described primer primer M-F and primer M-R；
Described primer M-F is following (a1) or (a2)；
(a1) single strand dna shown in sequence 1 of sequence table；
(a2) sequence 1 through the replacement of one or several nucleotide and/or disappearance and/or interpolation and is had with sequence 1 There is the DNA molecular of identical function；
Described primer M-R is following (a3) or (a4)；
(a3) single strand dna shown in sequence 2 of sequence table；
(a4) sequence 2 through the replacement of one or several nucleotide and/or disappearance and/or interpolation and is had with sequence 2 There is the DNA molecular of identical function；
II is made up of by described primer primer H5-F and primer H5-R；
Described primer H5-F is following (a5) or (a6)；
(a5) single strand dna shown in sequence 3 of sequence table；
(a6) sequence 3 through the replacement of one or several nucleotide and/or disappearance and/or interpolation and is had with sequence 3 There is the DNA molecular of identical function；
Described primer H5-R is following (a7) or (a8)；
(a7) single strand dna shown in sequence 4 of sequence table；
(a8) sequence 4 through the replacement of one or several nucleotide and/or disappearance and/or interpolation and is had with sequence 4 There is the DNA molecular of identical function；
III is made up of by described primer primer N6-F and primer N6-R；
Described primer N6-F is following (a9) or (a10)；
(a9) single strand dna shown in sequence 5 of sequence table；
(a10) by sequence 5 through the replacement of one or several nucleotide and/or disappearance and/or interpolation and with sequence 5 There is the DNA molecular of identical function；
Described primer N6-R is following (a11) or (a12)；
(a11) single strand dna shown in sequence 6 of sequence table；
(a12) by sequence 6 through the replacement of one or several nucleotide and/or disappearance and/or interpolation and with sequence 6 There is the DNA molecular of identical function.
2. the application of primer combination described in claim 1, for any one in following (b1) to (b6):
(b1) H5N6 hypotype AIV, H5 hypotype and AIV, N6 hypotype of non-N6 hypotype and non-H5 hypotype are differentiated AIV and non-H5 hypotype and the AIV of non-N6 hypotype；
(b2) preparation is for differentiating H5N6 hypotype AIV, H5 hypotype and AIV, N6 hypotype of non-N6 hypotype and non-H5 The AIV of hypotype and the test kit of the AIV of non-H5 hypotype and non-N6 hypotype；
(b3) identify whether virus to be measured is H5N6 hypotype AIV, H5 hypotype and AIV, N6 hypotype of non-N6 hypotype And AIV or the non-H5 hypotype of non-H5 hypotype and the AIV of non-N6 hypotype；
(b4) preparation for identify virus to be measured be whether H5N6 hypotype AIV, H5 hypotype and the AIV of non-N6 hypotype, AIV or the non-H5 hypotype of N6 hypotype and non-H5 hypotype and the test kit of the AIV of non-N6 hypotype；
(b5) whether detection sample to be tested contains H5N6 hypotype AIV and/or H5 hypotype and the AIV of non-N6 hypotype And/or N6 hypotype and the AIV of non-H5 hypotype and/or non-H5 hypotype and the AIV of non-N6 hypotype；
(b6) whether preparation detection sample to be tested contains H5N6 hypotype AIV and/or H5 hypotype and non-N6 hypotype The test kit of the AIV of AIV and/or N6 hypotype and the AIV of non-H5 hypotype and/or non-H5 hypotype and non-N6 hypotype.
3. contain the test kit of primer combination described in claim 1；The purposes of described test kit is following (c1) or (c2) Or (c3):
(c1) H5N6 hypotype AIV, H5 hypotype and AIV, N6 hypotype of non-N6 hypotype and non-H5 hypotype are differentiated AIV and non-H5 hypotype and the AIV of non-N6 hypotype；
(c2) identify whether virus to be measured is H5N6 hypotype AIV, H5 hypotype and AIV, N6 hypotype of non-N6 hypotype And AIV or the non-H5 hypotype of non-H5 hypotype and the AIV of non-N6 hypotype；
(c3) whether detection sample to be tested contains H5N6 hypotype AIV and/or H5 hypotype and the AIV of non-N6 hypotype And/or N6 hypotype and the AIV of non-H5 hypotype and/or non-H5 hypotype and the AIV of non-N6 hypotype.
4. the preparation method of test kit described in claim 3, including the step individually packed by each bar primer.
5. one kind differentiates H5N6 hypotype AIV, H5 hypotype and AIV, N6 hypotype of non-N6 hypotype and non-H5 hypotype The method of the AIV of AIV and non-H5 hypotype and non-N6 hypotype, comprises the steps (d1) or (d2):
(d1) RNA the reverse transcription of extracting virus to be measured are cDNA, with cDNA as template, use claim 1 The combination of described primer carries out PCR amplification, obtains pcr amplification product, if the DNA containing 332bp in amplified production Fragment, the DNA fragmentation of 428bp and the DNA fragmentation of 571bp, virus to be measured are or candidate is H5N6 hypotype AIV, If containing the DNA fragmentation of 332bp and the DNA fragmentation of 571bp and the DNA sheet not containing 428bp in amplified production Section, virus to be measured are or candidate is H5 hypotype and the AIV of non-N6 hypotype, if containing 428bp's in amplified production DNA fragmentation and the DNA fragmentation of 571bp and do not contain the DNA fragmentation of 332bp, virus to be measured for or candidate sub-for N6 Type and the AIV of non-H5 hypotype, if the DNA fragmentation containing 571bp in amplified production and do not contain the DNA of 332bp Fragment and the DNA fragmentation of 428bp, virus to be measured are or candidate is non-N6 hypotype and the AIV of non-H5 hypotype；
(d2) detect in the cDNA of virus to be measured whether containing sequence 10 in ordered list from 5 ' ends the 28th to 598 In DNA fragmentation shown in Wei, sequence table sequence 11 from 5 ' ends the 598th to 929 shown DNA fragmentation or Sequence 12 the 513rd to 940 shown DNA fragmentation from 5 ' ends in sequence table, then makes the following judgment: If simultaneously containing sequence 10 the 28th to 598 shown DNA from 5 ' ends in ordered list in described cDNA Sequence 11 sequence in the 598th to 929 shown DNA fragmentation and sequence table from 5 ' ends in fragment, sequence table 12 from 5 ' ends, the 513rd to 940 shown DNA fragmentation, virus to be measured are or candidate is H5N6 hypotype AIV, If simultaneously containing sequence 10 the 28th to 598 shown DNA sheet from 5 ' ends in ordered list in described cDNA Sequence 11 the 598th to 929 shown DNA fragmentation and not containing in sequence table from 5 ' ends in section and sequence table Sequence 12 the 513rd to 940 shown DNA fragmentation, virus to be measured from 5 ' ends are or candidate is H5 hypotype And the AIV of non-N6 hypotype, if in described cDNA simultaneously containing sequence 10 in ordered list from 5 ' ends the 28th To 598 shown DNA fragmentations and sequence 12 the 513rd to 940 shown DNA fragmentation and not from 5 ' ends The 598th to 929 shown DNA fragmentation, virus to be measured from 5 ' ends containing sequence in ordered list 11 is or waits Elect N6 hypotype and the AIV of non-H5 hypotype as, if in described cDNA containing sequence 10 in ordered list from 5 ' ends 28th to 598 shown DNA fragmentation and do not contain in sequence table sequence 11 from 5 ' ends the 598th to 929 DNA fragmentation shown in Wei and do not contain sequence 12 the 513rd to 940 shown DNA from 5 ' ends in sequence table Fragment, virus to be measured are or candidate is non-N6 hypotype and the AIV of non-H5 hypotype.
6. identify whether virus to be measured is H5N6 hypotype AIV, H5 hypotype and AIV, N6 hypotype of non-N6 hypotype for one kind And the method for the AIV of AIV or the non-H5 hypotype of non-H5 hypotype and non-N6 hypotype, comprise the steps (e1) or (e2):
(e1) RNA the reverse transcription of extracting virus to be measured are cDNA, with cDNA as template, use claim 1 The combination of described primer carries out PCR amplification, obtains pcr amplification product, if the DNA containing 332bp in amplified production Fragment, the DNA fragmentation of 428bp and the DNA fragmentation of 571bp, virus to be measured are or candidate is H5N6 hypotype AIV, If containing the DNA fragmentation of 332bp and the DNA fragmentation of 571bp and the DNA sheet not containing 428bp in amplified production Section, virus to be measured are or candidate is H5 hypotype and the AIV of non-N6 hypotype, if containing 428bp's in amplified production DNA fragmentation and the DNA fragmentation of 571bp and do not contain the DNA fragmentation of 332bp, virus to be measured for or candidate sub-for N6 Type and the AIV of non-H5 hypotype, if the DNA fragmentation containing 571bp in amplified production and do not contain the DNA of 332bp Fragment and the DNA fragmentation of 428bp, virus to be measured are or candidate is non-N6 hypotype and the AIV of non-H5 hypotype, if Amplified production does not contains the DNA fragmentation of 571bp, virus to be measured is or candidate is non-AIV virus；
(e2) detect in the cDNA of virus to be measured whether containing sequence 10 in ordered list from 5 ' ends the 28th to 598 In DNA fragmentation shown in Wei, sequence table sequence 11 from 5 ' ends the 598th to 929 shown DNA fragmentation or Sequence 12 the 513rd to 940 shown DNA fragmentation from 5 ' ends in sequence table, then makes the following judgment: If simultaneously containing sequence 10 the 28th to 598 shown DNA from 5 ' ends in ordered list in described cDNA Sequence 11 sequence in the 598th to 929 shown DNA fragmentation and sequence table from 5 ' ends in fragment, sequence table 12 from 5 ' ends, the 513rd to 940 shown DNA fragmentation, virus to be measured are or candidate is H5N6 hypotype AIV, If simultaneously containing sequence 10 the 28th to 598 shown DNA sheet from 5 ' ends in ordered list in described cDNA Sequence 11 the 598th to 929 shown DNA fragmentation and not containing in sequence table from 5 ' ends in section and sequence table Sequence 12 the 513rd to 940 shown DNA fragmentation, virus to be measured from 5 ' ends are or candidate is H5 hypotype And the AIV of non-N6 hypotype, if in described cDNA simultaneously containing sequence 10 in ordered list from 5 ' ends the 28th To 598 shown DNA fragmentations and sequence 12 the 513rd to 940 shown DNA fragmentation and not from 5 ' ends The 598th to 929 shown DNA fragmentation, virus to be measured from 5 ' ends containing sequence in ordered list 11 is or waits Elect N6 hypotype and the AIV of non-H5 hypotype as, if in described cDNA containing sequence 10 in ordered list from 5 ' ends 28th to 598 shown DNA fragmentation and do not contain in sequence table sequence 11 from 5 ' ends the 598th to 929 DNA fragmentation shown in Wei and do not contain sequence 12 the 513rd to 940 shown DNA from 5 ' ends in sequence table Fragment, virus to be measured are or candidate is non-N6 hypotype and the AIV of non-H5 hypotype, if without in order in described cDNA In list, sequence 10 the 28th to 598 shown DNA fragmentation, virus to be measured from 5 ' ends are or candidate is for non- The virus of AIV.
7. one kind is detected whether contain H5N6 hypotype AIV and/or H5 hypotype and the AIV of non-N6 hypotype in sample to be tested And/or the method for the AIV of N6 hypotype and the AIV of non-H5 hypotype and/or non-H5 hypotype and non-N6 hypotype, including such as Lower step (f1) or (f2):
(f1) RNA the reverse transcription of extracting virus to be measured are cDNA, with cDNA as template, use claim 1 The combination of described primer carries out PCR amplification, obtains pcr amplification product, if the DNA containing 332bp in amplified production Fragment, the DNA fragmentation of 428bp and the DNA fragmentation of 571bp, sample to be tested are following (g1) or (g2): (g1) The doubtful sample to be tested containing H5N6 hypotype AIV；(g2) doubtful treating containing H5 hypotype AIV and N6 hypotype AIV Test sample this, if containing the DNA fragmentation of 332bp and the DNA fragmentation of 571bp and do not contain 428bp in amplified production DNA fragmentation, sample to be tested doubtful containing H5 hypotype and the AIV of non-N6 hypotype, if containing 428bp in amplified production DNA fragmentation and the DNA fragmentation of 571bp and not contain the DNA fragmentation of 332bp, sample to be tested doubtful containing N6 Hypotype and the AIV of non-H5 hypotype, if the DNA fragmentation containing 571bp in amplified production and do not contain the DNA of 332bp Fragment and the DNA fragmentation of 428bp, sample to be tested are doubtful containing non-N6 hypotype and the AIV of non-H5 hypotype, if expanded Volume increase thing does not contains the DNA fragmentation of 571bp, the doubtful virus not containing AIV of sample to be tested；
(f2) in the cDNA of detection sample to be tested whether containing sequence 10 in ordered list from 5 ' ends the 28th to 598 In DNA fragmentation shown in Wei, sequence table sequence 11 from 5 ' ends the 598th to 929 shown DNA fragmentation or Sequence 12 the 513rd to 940 shown DNA fragmentation from 5 ' ends in sequence table, then makes the following judgment: If simultaneously containing sequence 10 the 28th to 598 shown DNA from 5 ' ends in ordered list in described cDNA Sequence 11 sequence in the 598th to 929 shown DNA fragmentation and sequence table from 5 ' ends in fragment, sequence table 12 from 5 ' ends the 513rd to 940 shown DNA fragmentation, sample to be tested be following (g1) or (g2): (g1) The doubtful sample to be tested containing H5N6 hypotype AIV；(g2) doubtful treating containing H5 hypotype AIV and N6 hypotype AIV Test sample this, if in described cDNA simultaneously containing sequence 10 in ordered list from 5 ' ends shown in the 28th to 598 DNA fragmentation and sequence table in sequence 11 the 598th to 929 shown DNA fragmentation and not containing from 5 ' ends In sequence table, sequence 12 the 513rd to 940 shown DNA fragmentation, sample to be tested from 5 ' ends are doubtful containing H5 Hypotype and the AIV of non-N6 hypotype, if in described cDNA simultaneously containing sequence 10 in ordered list from 5 ' ends the 28 to 598 shown DNA fragmentations and sequence 12 the 513rd to 940 shown DNA fragmentation from 5 ' ends And do not contain in sequence table sequence 11 the 598th to 929 shown DNA fragmentation, sample to be tested from 5 ' ends and doubt Like containing N6 hypotype and the AIV of non-H5 hypotype, if containing sequence 10 in ordered list from 5 ' ends in described cDNA Play the 28th to 598 shown DNA fragmentation and do not contain in sequence table sequence 11 from 5 ' ends the 598th to 929 DNA fragmentation shown in Wei and do not contain sequence 12 the 513rd to 940 shown DNA from 5 ' ends in sequence table Fragment, sample to be tested are doubtful containing non-N6 hypotype and the AIV of non-H5 hypotype, if without in order in described cDNA In list sequence 10 from 5 ' ends the 28th to 598 shown DNA fragmentation, sample to be tested is doubtful does not contains AIV Virus.
8. primer to I or primer to II or primer to III:
I is made up of by described primer primer M-F and primer M-R；
Described primer M-F is following (a1) or (a2)；
(a1) single strand dna shown in sequence 1 of sequence table；
(a2) sequence 1 through the replacement of one or several nucleotide and/or disappearance and/or interpolation and is had with sequence 1 There is the DNA molecular of identical function；
Described primer M-R is following (a3) or (a4)；
(a3) single strand dna shown in sequence 2 of sequence table；
(a4) sequence 2 through the replacement of one or several nucleotide and/or disappearance and/or interpolation and is had with sequence 2 There is the DNA molecular of identical function；
II is made up of by described primer primer H5-F and primer H5-R；
Described primer H5-F is following (a5) or (a6)；
(a5) single strand dna shown in sequence 3 of sequence table；
(a6) sequence 3 through the replacement of one or several nucleotide and/or disappearance and/or interpolation and is had with sequence 3 There is the DNA molecular of identical function；
Described primer H5-R is following (a7) or (a8)；
(a7) single strand dna shown in sequence 4 of sequence table；
(a8) sequence 4 through the replacement of one or several nucleotide and/or disappearance and/or interpolation and is had with sequence 4 There is the DNA molecular of identical function；
III is made up of by described primer primer N6-F and primer N6-R；
Described primer N6-F is following (a9) or (a10)；
(a9) single strand dna shown in sequence 5 of sequence table；
(a10) by sequence 5 through the replacement of one or several nucleotide and/or disappearance and/or interpolation and with sequence 5 There is the DNA molecular of identical function；
Described primer N6-F is following (a11) or (a12)；
(a11) single strand dna shown in sequence 6 of sequence table；
(a12) by sequence 6 through the replacement of one or several nucleotide and/or disappearance and/or interpolation and with sequence 6 There is the DNA molecular of identical function.
9. primer described in claim 8 is to I application in preparing test kit first, or, described primer to II in preparation Application in test kit second, or, described primer is to III application in preparing test kit third；
The purposes of described test kit first is following (h1) or (h2):
(h1) identify whether virus to be measured is AIV；
(h2) identify whether sample to be tested has infected AIV；
The purposes of described test kit second is following (h3) or (h4):
(h3) identify whether virus to be measured is H5 hypotype AIV；
(h4) identify whether sample to be tested has infected H5 hypotype AIV；
The purposes of described test kit third is following (h5) or (h6):
(h5) identify whether virus to be measured is N6 hypotype AIV；
(h6) identify whether sample to be tested has infected N6 hypotype AIV.
10. contain the test kit first to I of the primer described in claim 8, or, containing primer pair described in claim 8 The test kit second of II, or, containing the test kit third to III of the primer described in claim 8；
The purposes of described test kit first is following (h1) or (h2):
(h1) identify whether virus to be measured is AIV；
(h2) identify whether sample to be tested has infected AIV；
The purposes of described test kit second is following (h3) or (h4):
(h3) identify whether virus to be measured is H5 hypotype AIV；
(h4) identify whether sample to be tested has infected H5 hypotype AIV；
The purposes of described test kit third is following (h5) or (h6):
(h5) identify whether virus to be measured is N6 hypotype AIV；
(h6) identify whether sample to be tested has infected N6 hypotype AIV.
CN201610554720.1A 2016-07-14 2016-07-14 Primer combination for identifying H5 subtype AIV (Avian Influenza Virus), N6 subtype AIV and AIV and application thereof Pending CN105950789A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610554720.1A CN105950789A (en) 2016-07-14 2016-07-14 Primer combination for identifying H5 subtype AIV (Avian Influenza Virus), N6 subtype AIV and AIV and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610554720.1A CN105950789A (en) 2016-07-14 2016-07-14 Primer combination for identifying H5 subtype AIV (Avian Influenza Virus), N6 subtype AIV and AIV and application thereof

Publications (1)

Publication Number Publication Date
CN105950789A true CN105950789A (en) 2016-09-21

Family

ID=56900726

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610554720.1A Pending CN105950789A (en) 2016-07-14 2016-07-14 Primer combination for identifying H5 subtype AIV (Avian Influenza Virus), N6 subtype AIV and AIV and application thereof

Country Status (1)

Country Link
CN (1) CN105950789A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106636473A (en) * 2017-01-20 2017-05-10 广西壮族自治区兽医研究所 Complete reagent and method for detecting H5 subtype avian influenza virus and chicken parvovirus
CN106636472A (en) * 2017-01-20 2017-05-10 广西壮族自治区兽医研究所 Reagent set and method for detecting avian influenza viruses and chicken parvoviruses
CN107760800A (en) * 2017-11-15 2018-03-06 福建省农业科学院畜牧兽医研究所 One group of visualization differentiates neuraminidase N6 genes whether there is the primer of missing

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102257135A (en) * 2008-12-16 2011-11-23 巴克斯特国际公司 Production of viral vaccine
CN104498626A (en) * 2014-12-04 2015-04-08 广州维伯鑫生物科技有限公司 Avian influenza H5N6 subtype two-color fluorescence quantitative PCR detection kit and detection method thereof
CN105441586A (en) * 2015-11-28 2016-03-30 长沙市疾病预防控制中心 A-type H5N6 subtype avian influenza virus dual-channel real-time fluorescence PCR (polymerase chain reaction) detection kit and detection method

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102257135A (en) * 2008-12-16 2011-11-23 巴克斯特国际公司 Production of viral vaccine
CN104498626A (en) * 2014-12-04 2015-04-08 广州维伯鑫生物科技有限公司 Avian influenza H5N6 subtype two-color fluorescence quantitative PCR detection kit and detection method thereof
CN105441586A (en) * 2015-11-28 2016-03-30 长沙市疾病预防控制中心 A-type H5N6 subtype avian influenza virus dual-channel real-time fluorescence PCR (polymerase chain reaction) detection kit and detection method

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
刘婷婷,等: "H3N2亚型禽流感病毒双重实时荧光定量RT-PCR检测方法的建立", 《动物医学进展》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106636473A (en) * 2017-01-20 2017-05-10 广西壮族自治区兽医研究所 Complete reagent and method for detecting H5 subtype avian influenza virus and chicken parvovirus
CN106636472A (en) * 2017-01-20 2017-05-10 广西壮族自治区兽医研究所 Reagent set and method for detecting avian influenza viruses and chicken parvoviruses
CN107760800A (en) * 2017-11-15 2018-03-06 福建省农业科学院畜牧兽医研究所 One group of visualization differentiates neuraminidase N6 genes whether there is the primer of missing

Similar Documents

Publication Publication Date Title
CN101058833B (en) Primer system and method for detecting and analyzing avian influenza virus
CN106435024B (en) Fluorescent quantitative PCR primer, probe, kit and detection method for detecting avian influenza virus subtype
US10415103B2 (en) GeXP rapid detection primer set for simultaneously identifying gene HA of eight different human-infected subtypes of avian influenza virus, kit and use thereof
CN105543414B (en) A kind of Respiratory Syncytial Virus(RSV) A/B hypotype multiple fluorescence quantitative PCR detection primer group and probe groups and its kit and preparation method
CN106636472B (en) Complete set of reagent and method for detecting avian influenza virus and chicken parvovirus
CN105200049B (en) Differentiate the GeXP rapid detection kit of H5 subtype avian influenza virus and its four kinds of difference NA hypotypes simultaneously
CN105950789A (en) Primer combination for identifying H5 subtype AIV (Avian Influenza Virus), N6 subtype AIV and AIV and application thereof
CN104498629A (en) Duplex real-time fluorescence quantitative PCR (polymerase chain reaction) detection kit for H3N2 subtype avian influenza virus (AIV)
CN106191306A (en) A kind of primer combination identifying H5 hypotype AIV and N6 hypotype AIV and application thereof
CN104498627A (en) One-step process real-time fluorescence quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection kit for H3N8 subtype avian influenza virus (AIV)
CN106435036B (en) Fluorescent PCR (polymerase chain reaction) primer and probe for detecting influenza D virus and detection method
CN105950785A (en) Ternary fluorescence RT-PCR detection kit of avian influenza virus, new castle disease virus and infectious bronchitis virus, primers and probes
CN101020930A (en) Gene chip for detection and typing of bird flu virus
CN106636473B (en) Complete set of reagents and method for detecting H5 subtype avian influenza virus and chicken parvovirus
CN104531899B (en) The GeXP rapid detection kit of avian influenza virus and its H6 hypotypes and N1 hypotypes
CN111518954A (en) Primer group, kit and method for double nano PCR detection of H5 and N8 subtype avian influenza virus
CN105316430B (en) Differentiate the quick detection primer groups of the GeXP of H5N1 and H9N2 subtype avian influenza virus, kit and its application simultaneously
CN110669872A (en) Triple RT-PCR (reverse transcription-polymerase chain reaction) detection primer group, kit and method for H9 and H10 subtype avian influenza viruses
CN108998575B (en) Establishment of double PCR detection method for chicken parvovirus and chicken newcastle disease virus
CN103320530A (en) H1N1/H5N1 type avian influenza virus detection kit and application thereof
CN107043829B (en) Influenza virus rRT-PCR detection primer and probe and method for detecting H7N9 subtype influenza virus
CN105349698B (en) GeXP rapid detection primer group and kit for identifying main epidemic subtypes of avian influenza at the same time and application of primer group and kit
CN102304591B (en) PCR (polymerase chain reaction) primer pair for identifying H3 subtype avian influenza virus and application thereof
CN108866245B (en) Establishment of triple PCR detection method for chicken parvovirus, avian influenza virus and newcastle disease virus
CN111518953A (en) Primer group, kit and method for double nano PCR detection of H7 and N2 subtype avian influenza virus

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20160921