CN113106078B - Leucine dehydrogenase mutant, encoding gene thereof, gene engineering bacterium and application of leucine dehydrogenase mutant in preparation of L-tert-leucine - Google Patents

Abstract

The invention provides a leucine dehydrogenase mutant, a coding gene thereof, a genetic engineering bacterium and application thereof in preparing L-tertiary leucine, wherein the mutant comprises the following components: mutant obtained by mutating 153 th amino acid residue into asparagine N with wild leucine dehydrogenase shown in SEQ ID NO.1 as template; mutation of 191 th amino acid residue into asparagine N to obtain mutant; the 153 th amino acid residue is mutated into asparagine N, and the 191 th amino acid residue is mutated into asparagine N. The invention obviously improves the molecular modification of the LaLeuDH to the trimethylpyruvic acid and the coenzyme NADH/NAD ⁺ The catalytic activity of the method solves the problem of strong coenzyme dependence in the process of preparing high-concentration L-tert-leucine by a reductive amination method, can successfully convert 1.5M substrate without adding exogenous coenzyme during whole-cell catalysis, and has great industrial application value.

Description

Leucine dehydrogenase mutant, encoding gene thereof, gene engineering bacterium and application of leucine dehydrogenase mutant in preparation of L-tert-leucine

Technical Field

The invention relates to the technical field of protein engineering, and in particular relates to a leucine dehydrogenase mutant, a coding gene thereof, a genetic engineering bacterium and application thereof in preparation of L-tert-leucine.

Background

Optically pure non-proteinogenic amino acids are widely used in the pharmaceutical industry as important chiral building blocks. L-tert-leucine is probably one of the most representative pharmaceutically active ingredients and is a chiral intermediate of many drugs, such as telaprevir, asunaprevir, atazanavir and the like.

Compared with a chemical method, the enzyme catalysis method is a green chiral molecular synthesis method with strong selectivity, and has high yield and good optical purity. A number of enzymes have been developed for the preparation of chirally pure L-tert-leucine, such as nitrilases, hydrolases, penicillin acylases, lipases and amino acid oxidases, etc., however, these resolution processes are mostly limited by a maximum theoretical yield of 50%. Enzymatic asymmetric reductive amination of keto acids is an attractive, desirable green and mild reaction for the pharmaceutical industry. The amino acid dehydrogenase or aminotransferase asymmetrically synthesizes a plurality of L-amino acids using a keto acid as a substrate. The asymmetric synthesis of L-tert-leucine by utilizing leucine dehydrogenase (EC 1.4.1.9) is an ideal synthetic path, the reaction advantage of the process is obvious, ammonium ions are used as amine donors in the reaction process, the atom economy is high, and the cost of an NADH coenzyme regeneration system is low. To date, amino acid dehydrogenases reported in the literature to be capable of efficiently synthesizing L-tert-leucine include: bacillus cereus LeuDH, Exiguobacterium albicicum LeuDH and Lysinibacillus sphaericus LeuDH. Among them, Lysinibacillus sphaericus LeuDH, which is the most preferable catalytic level, can increase the substrate final concentration to 1.5M by the continuous fed-batch strategy, but these enzymes cannot efficiently perform the substrate catalysis when the substrate concentration of the single-batch reaction system is higher than 0.75M. Even with substrate activity pocket engineering, higher substrate concentration tolerance is not achieved.

Substrate inhibition is mainly due to the high concentration of substrate disrupting the normal enzymatic processes: the effective water activity near enzyme molecules is reduced, and the diffusivity of the molecules is influenced; the substrate accumulates in the substrate binding domain, disrupting the original interaction force of the enzyme. As an organic solvent, high concentrations of TMP may scavenge available water and disrupt the stability of the substrate binding domain, including disrupting original hydrogen bonding and hydrophobic interactions. Meanwhile, studies have shown that The stability of enzymes depends mainly on The rigidity of The structure, which can be enhanced by increasing The number of polar amino acid residues on The surface of The enzyme in The aqueous phase (aC. N. pace, S. Trevio, E.Prabohakaran, J.M.Scholtz, Phospodopathic Transactions of The Royal Society BBiological information 2004,359, 1225-1234; discission 1234-1225; bB.S.der, C.Kluwen, A.E.Miklos, R.Jacak, S.lysov, J.J.Gray, G.Georgi, A.D.Ellington, B.Kuhlman, Plos One 2013,8,59-59, and C.N.Pedersen, Y.ZHou, Z.Zong, B.20159-Biotechnology and 9. Biotechnisc. E.9). The protein surface consists of an alpha-helix, a beta-chain and a loop secondary structure. loop is the most flexible, active moiety that both participates in the formation of the substrate catalytic pocket and maintains stability of the enzyme in solution, possibly collapsing first in the presence of high concentrations of organic solvents. Leucine dehydrogenase is an octamer, and the single subunit of leucine dehydrogenase is generally composed of two domains: domain I (substrate binding Domain) and Domain II (coenzyme binding Domain). In this case, the loop structure of the substrate binding domain may require a higher proportion of charged residues to maintain its structural stability and catalytic activity. Therefore, leucine dehydrogenase enzymes with corresponding loop structural features may be able to tolerate high concentrations of trimethylpyruvic acid.

Although LaLeuDH can efficiently synthesize high-concentration L-tert-leucine in the reaction catalysis process, the enzyme has high dependence on coenzyme, and coenzyme needs to be additionally added into the reaction system. Although the cost of the coenzyme can be reduced by regenerating the system, maintaining a higher concentration of the coenzyme in the system still accounts for higher material cost. The reaction mediated by leucine dehydrogenase requires at least 0.1mM NADH even when a highly efficient coenzyme circulation system is used, and the production cost is high. Although the cost of the coenzyme can be reduced by regenerating the system, maintaining a higher concentration of the coenzyme in the system still accounts for higher material cost.

Therefore, in order to further improve the reaction catalytic efficiency and realize the efficient synthesis of L-tert-leucine by whole cells in a system without additional coenzyme, the utilization efficiency of NADH (coenzyme by LaLeuDH) needs to be improved.

Disclosure of Invention

The invention aims to provide a leucine dehydrogenase mutant, a coding gene thereof, a genetic engineering bacterium and application thereof in preparation of L-tertiary leucine, so as to solve the problems that in the prior art, the leucine dehydrogenase has low substrate feeding in the process of asymmetrically catalyzing trimethylpyruvic acid, and the production cost of the L-tertiary leucine is high due to the need of additionally adding coenzyme, and the industrial requirements cannot be met.

In order to solve the technical problems, the invention adopts the following technical scheme:

according to a first aspect of the present invention, there is provided a leucine dehydrogenase mutant with increased activity, comprising: using a wild-type leucine dehydrogenase LaLeuDH (Labrenzia aggregata IAM 12614) shown in SEQ ID NO.1 as a template, mutating the aspartic acid D at the 153 th position into a leucine dehydrogenase mutant D153N of asparagine N, wherein the amino acid sequence of the mutant is shown in SEQ ID NO. 2; taking wild leucine dehydrogenase LaLeuDH shown in SEQ ID NO.1 as a template, mutating histidine H at the 191 th position into leucine dehydrogenase mutant H191N of asparagine N, wherein the amino acid sequence of the mutant is shown in SEQ ID NO. 3; the mutant D153N/H191N of leucine dehydrogenase with mutant D153N of the leucine dehydrogenase shown in SEQ ID NO.2 as a template and the mutation of histidine H at the 191 th amino acid residue into asparagine N has the amino acid sequence shown in SEQ ID NO. 4.

According to a second aspect of the present invention, there is provided a gene encoding the leucine dehydrogenase mutant as described above.

According to a third aspect of the present invention, there is provided a recombinant vector and a genetically engineered bacterium comprising a gene encoding the leucine dehydrogenase mutant as described above. According to a preferred embodiment of the present invention, the host bacterium is Escherichia coli.

According to a fourth aspect of the present invention, there is provided a use of the leucine dehydrogenase mutant as described above for catalyzing trimethylpyruvic acid to produce L-tert-leucine.

According to the present invention, a leucine dehydrogenase mutant that can tolerate high concentrations of trimethylpyruvic acid is provided, which is obtained by a structure-directed gene mining technique, which is achieved by substrate tolerance and specific sequence-structure prediction. The specific method comprises the following steps:

in the first step, a protein sequence set containing leucine dehydrogenase or Glu/Leu/Phe/Val dehydrogenase is established, and multiple sequence alignment is carried out. The protein sequence of leucine dehydrogenase or Glu/Leu/Phe/Val dehydrogenase can be obtained from the Uniprot database.

In the second step, structural sequence alignment of leucine dehydrogenase Bacillus sphaericus (PDB:1LEH), Sporosarcina pseudochryse (PDB:3VPX) and Geobacillus stearothermophilus (PDB:6ACF) having crystal structures was performed for identifying specific loop structures of the hinge region and substrate binding Domain (Domain I) of leucine dehydrogenase.

And thirdly, counting the number of charged amino acids on all specific loop structures in the multiple sequence comparison obtained in the first step, and taking the most numerous charged amino acids as candidate sequences capable of tolerating high-concentration substrates.

In the fourth step, in order to determine a substrate binding pocket capable of efficiently catalyzing TMP, a structure and sequence analysis of leucine dehydrogenase having high activity on TMP reported in the literature was performed.

And a fifth step of screening out the leucine dehydrogenase required to be able to catalyze the substrate at a high concentration efficiently from the candidate sequence based on the analysis result obtained in the fourth step.

In order to improve the utilization efficiency of the coenzyme of the target sequence, the leucine dehydrogenase LaLeuDH gene from Labrenzia aggregatate is selected as a template, the amino acid sequence of the leucine dehydrogenase LaLeuDH is shown as SEQ ID NO.1, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 6.

Aiming at the problems that the wild LaLeuDH has low affinity to coenzyme NADH, the reaction coenzyme dosage is reduced, and the reaction time is obviously prolonged, the invention adopts a rational directed evolution means to improve the affinity of LaLeuDH to coenzyme NADH. The structural characteristics of the coenzyme binding domain of LaLeuDH are determined by referring to the crystal structures of BsLeuDH and RsPheDH, and the structural characteristics are compared with leucine dehydrogenase with the advantage of coenzyme catalytic structure, such as Bacillus stearothermophilus, Thermoactinomyces intermedia, Bacillus cereus, Exiguobacterium sibiricum and Lysinibacillus sphaericus, and the 153 th amino acid residue and the 191 th amino acid residue which play a key role in the coenzyme catalytic efficiency of the leucine dehydrogenase LaLeuDH are determined by combining molecular dynamics simulation. Site-directed mutagenesis was performed on them, and the catalytic reductive amination activity of each mutant was determined. To analyze the synergistic effect between them, the mutants with greatly improved activity were combined to determine the best double-site mutant LaLeuDH-D153N/H191N, i.e., the 153 th amino acid residue and the 191 th amino acid residue were mutated at the same time. Through these protein engineering strategies, a plurality of mutants with improved leucine dehydrogenase activity are obtained, and the obtaining of the mutants is very beneficial to industrial production.

Therefore, the wild-type amino acid dehydrogenase shown in SEQ ID NO.1 is taken as a template, and amino acid sites which play a key role in activity are analyzed and determined to obtain the following leucine dehydrogenase mutants, including: p at position 130 is replaced with V to form mutant P130V; substitution of D at position 153 with N to form mutant D153N; substitution of H to N at position 191 to form mutant H191N; the 153 th and 91 th combined mutation form mutant D153N/H191N.

Furthermore, the leucine dehydrogenase mutant is applied to asymmetric reduction of amine to synthesize chiral amino acid. The wild type leucine dehydrogenase LaLeuDH discovered by the invention can be in the range of 0.1mM NADH/NAD ⁺ In the presence of the L-tert-leucine, 1.5M trimethylpyruvic acid is converted into L-tert-leucine in 14H, and the discovered leucine dehydrogenase LaLeuDH is transformed through protein engineering to obtain a plurality of mutants with improved catalytic performance of the leucine dehydrogenase, wherein the activities of three mutants LaLeuDH-D153N, LaLeuDH-H191N and LaLeuDH-D153N/H191N with the largest activity improvement range are respectively improved from 556.6U/mg of wild-type LaLeuDH to 914.2U/mg, 915.7U/mg and 1102.4U/mg. The leucine dehydrogenase double-site mutant LaLeuDH-D153N/H191N with the highest activity is used for catalyzing 1.5M trimethylpyruvic acid, and when the addition amount of coenzyme NADH is 0.1mM, the L-tert-leucine can be completely converted and generated within 3H; when the addition amount of coenzyme NADH is 0mM, the L-tert-leucine can be completely converted into L-tert-leucine within 18h, and the ee value reaches 99.9 percent.

In some embodiments, the enzymatic catalytic system further comprises a coenzyme cycling system selected from at least one of the following: 1) formate dehydrogenase coenzyme circulation system: including formate dehydrogenase, formate and coenzymes; 2) glucose dehydrogenase coenzyme circulation system: including glucose dehydrogenase, glucose and coenzymes; 3) alcohol dehydrogenase coenzyme cycling system: including alcohol dehydrogenases, isopropanol and coenzymes.

In some preferred embodiments, the coenzyme is NADH.

In conclusion, the leucine dehydrogenase provided by the invention can keep higher catalytic activity in a high-concentration trimethylpyruvic acid reaction system, and has high enantioselectivity; according to the multiple leucine dehydrogenase mutants provided by the invention, the problem that expensive coenzyme is additionally added in the process of synthesizing high-concentration L-tertiary leucine through reductive amination is successfully solved, and the multiple leucine dehydrogenase mutants have great industrial application value.

It is to be understood that the capital letters of the invention represent amino acids as are well known to those skilled in the art and, according to the application, represent the corresponding amino acid residues herein.

The experimental methods in the present invention are conventional methods unless otherwise specified, and the gene cloning procedures can be specifically described in molecular cloning protocols, compiled by J. Sambruka et al.

Description of the sequence listing:

SEQ ID NO.1 is the amino acid sequence annotated as leucine dehydrogenase (LaLeuDH) derived from Labrenzia aggregatate IAM 12614;

SEQ ID NO.2 is the amino acid sequence of mutant D153N of LaLeuDH (LaLeuDH-D153N);

SEQ ID NO.3 is the amino acid sequence of mutant H191N of LaLeuDH (LaLeuDH-H191N);

SEQ ID NO.4 is the amino acid sequence of mutant D153N/H191N of LaLeuDH (LaLeuDH-D153N/H191N);

SEQ ID No.5 is the amino acid sequence annotated as leucine dehydrogenase (BbLeuDH) derived from Bacteroides bacterium OLB 10;

SEQ ID No.6 is a nucleotide sequence annotated as leucine dehydrogenase (LaLeuDH) derived from Labrenzia aggregatate IAM 12614;

SEQ ID NO.7 is the nucleotide sequence of mutant D153N of LaLeuDH (LaLeuDH-D153N);

SEQ ID NO.8 is the nucleotide sequence of mutant H191N of LaLeuDH (LaLeuDH-H191N);

SEQ ID NO.9 is the nucleotide sequence of mutant D153N/H191N of LaLeuDH (LaLeuDH-D153N/H191N);

SEQ ID No.10 is a nucleotide sequence annotated as leucine dehydrogenase (BbLeuDH) derived from Bacteroides bacterium OLB 10;

SEQ ID NO.11 is the nucleotide sequence of artificial sequence primer P130 VF;

SEQ ID NO.12 is the nucleotide sequence of artificial sequence primer P130 VR;

SEQ ID NO.13 is the nucleotide sequence of artificial sequence primer D153 NF;

SEQ ID No.14 is the nucleotide sequence of artificial sequence primer D153 NR;

SEQ ID NO.15 is the nucleotide sequence of artificial sequence primer H191 NF;

SEQ ID NO.16 is the nucleotide sequence of the artificial sequence primer H191 NR.

Compared with the prior art, the invention has the following beneficial effects:

1) according to the invention, a structure-oriented gene mining technology is utilized to obtain leucine dehydrogenase which can efficiently catalyze high-concentration (1.5M) trimethylpyruvic acid, and the tolerance of the leucine dehydrogenase to a high-concentration substrate is obviously improved.

2) The leucine dehydrogenase mutant LaLeuDH-D153N/H191N prepared by the invention is coenzyme NADH/NAD ⁺ Compared with the parent leucine dehydrogenase, the catalytic efficiency of the mutant is improved by 50 times, and the leucine dehydrogenase mutant has better industrial application prospect.

3) The leucine dehydrogenase mutant is used for producing L-tert-leucine, the substrate concentration is high, the reaction time is short, and the reaction time of catalyzing 1.5M substrate under the condition of not additionally adding coenzyme is only 18 hours, which shows that the leucine dehydrogenase mutant has good industrial application prospect.

Drawings

FIG. 1 shows exemplary SDS-PAGE protein gel electrophoresis patterns of wild-type leucine dehydrogenase LaLeuDH and glucose dehydrogenase BmGDH;

FIG. 2 schematically shows the reaction progress curve for the synthesis of L-tert-leucine by reductive amination of TMP with recombinant E.coli co-expression strain E.coli BL21(DE3)/pET-28a-LaLeuDH-BmGDH and mutants thereof;

FIG. 3 shows an example of a reaction scheme for the asymmetric synthesis of L-tert-leucine (glucose dehydrogenase coenzyme cycling system).

Detailed Description

The present invention will be further described with reference to the following specific examples. It should be understood that the following examples are illustrative only and are not intended to limit the scope of the present invention. The technical means used in the examples are conventional in the art, unless otherwise specified.

Materials and methods

Reagents used in upstream genetic engineering: the genome extraction kit, the plasmid extraction kit and the DNA purification and recovery kit used in the examples were purchased from Kangning Life sciences (Wujiang) Co., Ltd.; the one-step cloning kit was purchased from nuozokenza co ltd; coli BL21(DE3), plasmid pET-28a (+) and the like were purchased from Shanghai Xuan Guangzi Biotech development Co., Ltd; DNA markers, low molecular weight standard proteins, protein gels were purchased from GenStar, Beijing; the Clonexpress II One Step Cloning Kit seamless Cloning Kit was purchased from Nanjing Novophilia Biotech GmbH; the Dpn I endonuclease was purchased from Saimer Feishale science and technology (China) Co., Ltd.; primer synthesis and sequence sequencing are completed by Hangzhou Zhike catalpi biotechnology limited, and whole gene synthesis is completed by Hangzhou Zhike catalpi biotechnology limited. KOD-One point mutation kit was purchased from Toyobo, Japan. The method of using the above reagent is referred to the commercial specification.

The reagents trimethylpyruvic acid, L-tert-leucine and D-tert-leucine used in the downstream catalytic process are from Shanghai Maxin Biotechnology and technology company Limited, and other common reagents are from national medicine group chemical reagent company Limited.

In the examples, the progress of the reaction was detected by High Performance Liquid Chromatography (HPLC), and PPO was analyzed. The HPLC analysis method comprises the following steps: a chromatography column PBR; column temperature/30 ℃; flow rate/0.8 mL/min; detection wavelength/210 nm; mobile phase: 5mM NH ₄ H ₂ PO ₄ 。

Chiral fraction of tert-leucineEstablishment of the analysis method: performing pre-column derivatization detection, and using GITC (2, 3, 4, 6-tetraacetyl-beta-glucopyranose) as a derivatization reagent to perform derivatization on the tert-leucine. The derivatization was carried out using TEA (triethylamine) as catalyst. Firstly preparing a derivatization reaction solution: 30 μ L of TEA, 0.013gGITC, 1: 1 methanol/water make up system to 10 mL. Then taking 50ul of the derivatization reaction solution and the enzymatic reaction diluent or L (D) -tert-leucine standard solution to be mixed and diluted to 500ul respectively, oscillating for 2min by vortex, standing for 35min at room temperature, centrifuging, and taking 10ul of supernatant for sample injection. The liquid phase conditions were: SB-AQ column (4.6 mm. times.250 mm), detection wavelength 254nm, mobile phase 40% (0.1% phosphoric acid) water: 60% methanol, flow rate of 1ml/min, column temperature 25 ℃. ee value calculation method:

wherein L and D represent the detection peak area of L and D type tertiary leucine.

Example 1: construction of genetically engineered bacteria

The invention adopts a structure-oriented gene mining technology to obtain 4 potential leucine dehydrogenases capable of efficiently catalyzing high-concentration trimethylpyruvic acid, and the gene sequence synthesis, the construction of an expression plasmid pET-28a (+) and the plasmid transformation of a host escherichia coli E.coli BL21(DE3) are all completed by Hingchi Hingxi biotechnology Limited company, and the basic information is shown in Table 1. It should be understood that the synthesis of gene sequence, the construction of expression plasmid pET-28a (+) and the plasmid transformation of host E.coli BL21(DE3) are all conventional technical means in the art, and those skilled in the art can realize the synthesis of gene sequence, the construction of expression plasmid pET-28a (+) and the plasmid transformation of host E.coli BL21(DE3) according to the following gene information and the conventional technical means in the art. Through the operations, recombinant escherichia coli genetic engineering bacteria of LaLeuDH, BbLeuDH, TmLeuDH and LalLeuDH can be obtained respectively.

TABLE 1

Example 2: culture of engineered bacteria

Recombinant Escherichia coli genetically engineered bacteria of LaLeuDH, BbLeuDH, TmLeuDH and LalLeuDH and glucose dehydrogenase BmGDH (GenBank No.: WP-013055759.1) derived from Bacillus megaterium are respectively subjected to plate streak activation, then single colonies are selected and inoculated into 10mL of LB liquid culture medium containing 50 mu g/mL of kanamycin, and shake culture is carried out at 37 ℃ for 10 h. The cells were inoculated at 2% into 50mL of LB liquid medium containing 50. mu.g/mL of kanamycin, shake-cultured at 37 ℃ until OD600 reached about 0.8, and then IPTG was added thereto to a final concentration of 0.1mM, and shake-cultured at 25 ℃ for 12 hours. After the culture is finished, the culture solution is centrifuged for 10min at 8000rpm, the supernatant is discarded, and the thalli are collected and stored in an ultra-low temperature refrigerator at minus 80 ℃ for later use.

Example 3: screening for enzymes that tolerate high concentrations of TMP

The respective substrate tolerance levels were determined by the catalytic efficiency of the respective enzymes (LaLeuDH, BbLeuDH, TmLeuDH, LalLeuDH) obtained in example 2 at relatively high substrate concentrations. 20mL of the reaction system included: 10g/L leucine dehydrogenase lyophilized cells, 10g/L glucose dehydrogenase lyophilized cells, 1M TMP, 1.2M glucose, 0.5mM NADH, 100mM ammonium phosphate buffer. The reaction was mechanically stirred at 30 ℃ for 24h, maintaining the reaction system at pH 8.0 with aqueous ammonia. The samples were sampled at regular intervals, and the TMP concentration of the samples was measured by high performance liquid chromatography after diluting the samples to a certain concentration, and the conversion rate (in-process TMP concentration/initial TMP concentration × 100%) was determined, and the results are shown in table 2.

TABLE 2

From the results, LaLeuDH and BbLeuDH still maintain higher catalytic activity under 1M TMP compared with other enzymes, and particularly LaLeuDH shows the highest catalytic efficiency in a reaction system of 1M TMP.

Example 4: construction of co-expression gene engineering bacteria

The gene sequence BmGDH of glucose dehydrogenase BmGDH used in example 3 was ligated to leucine dehydrogenase LaLeuDH vector pET-28a-LaLeuDH via one-step cloning kit with Not I cleavage site to construct co-expression plasmid pET-28a-LaLeuDH-BmGDH, and the plasmid was transformed into strain e.coli BL21(DE3) to obtain co-expression strain e.coli BL21(DE3)/pET-28a-LaLeuDH-BmGDH, and the culture of bacterial gdh was performed according to example 2, and the protein expression of the co-expression strain is shown in fig. 1, wherein lane M is protein marker, lane 1 is the expression of laudh protein, lane 2 is the expression of BmGDH protein, and lane 3 is the co-expression strain e.coli BL21(DE3)/pET-28a-LaLeuDH-BmGDH protein.

Example 5: influence of coenzyme dosage on asymmetric synthesis of L-tert-leucine by co-expression strain

The procedure for culturing the cells of the coexpression strain was the same as in example 2.

The effect of different coenzyme dosages at higher substrate concentrations on the catalytic efficiency of co-expressed cells in example 4. 20mL of the reaction system included: 10g/L of the co-expression strain lyophilized cells, 1.5M TMP, 1.65M glucose, various concentrations of NADH, 100mM ammonium phosphate buffer. The reaction was mechanically stirred at 30 ℃ for 24h, maintaining the reaction system at pH 8.0 with aqueous ammonia. The samples were sampled at regular intervals, and the TMP concentration of the samples was measured by hplc to determine the conversion (i.e., in-process TMP concentration/initial TMP concentration × 100%), and the results are shown in table 3.

TABLE 3

The results show that at 1.5M substrate dosage, the catalytic reaction time is prolonged with the decrease of the coenzyme dosage; when no additional coenzyme was added, the conversion was only 43%.

Example 6: docking of substrates with LaLeuDH

To obtain structural information for leucine dehydrogenase LaLeuDH, wild-type leucine dehydrogenase LaLeuDH was modeled. Using SWISS-MODEL (http:// www.swissmodel.expasy.org /) for homology modeling, the crystal structure of phenylalanine dehydrogenase from Rhodococcus sp.M4(PDB:1C1D, holo form) was selected as a template, which showed 37.69% identity to leucine dehydrogenase LaLeuDH. After the model is optimized, the cofactor NADH is first docked into the model, and the substrate trimethylpyruvic acid is then docked with the complex of the enzyme molecule and NADH. And then screening and scoring the docking result, and selecting the optimal docking posture so as to perform subsequent analysis on key amino acid residues of the enzyme molecule coenzyme activity pocket.

Example 7: construction and screening of LaLeuDH mutant

Respectively culturing the engineering bacteria of the escherichia coli with the recombinant plasmids of pET-28a-LaLeuDH and pET-28a-LaLeuDH-BmGDH in an LB culture medium for 10-12h, and extracting the plasmids as templates for constructing subsequent mutants. The KOD-One point mutation kit of Toyobo Co., Japan was used for constructing a mutation library. The specific operation is as follows:

the primer design using the extracted plasmid as a template and introducing mutation residues as needed is shown in Table 4.

TABLE 4

Primer name	Sequence (5'-3')
		P130VF(SEQ ID NO.11)	ggcttccatgtcgtccactgacacgccgacatc
P130VR(SEQ ID NO.12)	gatgtcggcgtgtcagtggacgacatggaagcc
		D153NF(SEQ ID NO.13)	agggcgaggggttgccgaggccg
D153NR(SEQ ID NO.14)	cggcctcggcaacccctcgccct
		H191NF(SEQ ID NO.15)	cgtcaaagccgacgttgccgaggccctgc
H191NR(SEQ ID NO.16)	gcagggcctcggcaacgtcggctttgacg

Introducing point mutation by adopting high-fidelity KOD-One-enzyme through an inverse PCR method, wherein a PCR reaction system is as follows: 10 μ L KOD-One-enzyme, 1 μ L primer F, 1 μ L primer R, 1 μ L template, 7 μ L ddH ₂ O。

And (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 2 min; denaturation at 98 deg.C for 10s, annealing at 58 deg.C for 5s, and extension at 68 deg.C for 2min, wherein the cycle is 12 times; post-extension at 68 ℃ for 2 min; storing at 4 deg.C.

Digesting the template plasmid DNA by Dpn I after PCR amplification is finished, and carrying out 2h at 37 ℃; self-cyclization of PCR products is carried out for 3h at 16 ℃ by using T4 Polynucleotide Kinase and Ligation high in the kit, wherein the self-cyclization system is as follows: mu.L of digest, 5. mu.L of ligation solution, 1. mu. L T4 of polynucleotide kinase, 7. mu.L of ddH ₂ O。

Transforming, and introducing the obtained cyclization product into competent cells of escherichia coli BL21(DE 3); selecting a single colony, inoculating the single colony in 5mL LB culture medium, culturing overnight at 37 ℃, and sequencing the strain; obtaining mutants P130V, D153N, H191N and D153N/H191N, ensuring the correct sequence, performing induction expression on each mutant, harvesting thalli, preparing crude enzyme solution by ultrasonic disruption, or freeze-drying.

Example 8: purification of wild-type LaLeuDH and its mutants

The supernatant of the crude enzyme solution of wild-type LaLeuDH and its mutant obtained in example 7 was applied to Ni-NTA column, and 6 XHis-tagged protein was bound to the Ni-NTA column at a flow rate of 1ml/min, followed by elution with 20mM, 50mM, 100mM, 250mM, and 500mM imidazole at the same flow rate. The purity of the collected proteins was checked by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Fractions containing the protein of interest were collected and dialyzed against 20mM PB buffer (pH 8.0) for desalting, followed by concentrating the enzyme solution, adding 20% (v/v) glycerol, and storing at-80 ℃ for later use.

Example 9: kinetic parameters of wild-type LaLeuDH and its mutants

The kinetic parameters were measured for NADH and TMP in the direction of reductive amination. Kinetic analysis was performed at 30 ℃ and pH 8.0. Taking NADH as a substrate, and under the premise of certain concentration of TMP and ammonium radical, setting the concentration gradient of the substrate as follows: 0. 0.02, 0.04, 0.06, 0.08, 0.1, 0.2, 0.3, 0.4, 0.5, 1mM, substrate concentration as abscissa and specific activity as ordinate, curve fitting was performed according to the Michaelis-Menten equation: and y is (Vmax × x)/(Km + x), namely Vmax and Km can be obtained. TMP is used as a substrate, and the concentration gradient of the substrate is set as follows under the premise of certain concentration of NADH and ammonium radical: 0. 0.02, 0.04, 0.06, 0.08, 0.1, 0.2, 0.3, 0.4, 0.5, 1, 5, 10, 20mM, in the same manner as in the NADH parameter experiment. The results of the experiment are shown in Table 5.

TABLE 5

The results show that compared with the wild type (556.6U/mg), the enzyme activities of the mutants P130V, D153N, H191N and D153N/H191N respectively reach 989.4, 914.2, 915.7 and 1102.4U/mg, and are all greatly improved. In particular, the Mie constants (Km) of the mutants P130V, D153N, H191N and D153N/H191N to NADH were 0.05, 0.038, 0.072 and 0.017mM, respectively, which are significantly lower than the wild type (0.43 mM). Meanwhile, the catalytic efficiency (kcat/Km) of mutants P130V, D153N, H191N and D153N/H191N to coenzyme NADH is also obviously improved, and reaches 12348, 15013.2, 7936.1 and 40464.6mM/s which are respectively 15 times, 18 times, nearly 10 times and 50 times of wild type (807.7 mM/s). However, as a result of the kinetic parameters of substrate TMP, the Km value of mutant P130V for TMP increased from 0.096mM to 0.3mM, and the affinity for the substrate decreased to some extent. The D153N, H191N and D153N/H191N mutants have no substantial difference in Km value of TMP compared with the wild type.

Example 10: l-tert-leucine synthesis by co-expression strain of wild-type LaLeuDH and mutant D153N/H191N thereof

Co-expression strains capable of expressing LaLeuDH or its mutant D153N/H191N and BmGDH were constructed and cultured according to the methods of examples 2, 4 and 7, and bacterial cells were collected by centrifugation and lyophilized.

The effect of different coenzyme dosages at higher substrate concentrations on the catalytic efficiency of the co-expressed cells of wild type and mutant D153N/H191N. A20 mL reaction system included: 10g/L of the co-expression strain lyophilized cells, 1.5M TMP, 1.65M glucose, various concentrations of NADH, 100mM ammonium phosphate buffer. The reaction was mechanically stirred at 30 ℃ for 24h, maintaining the reaction system at pH 8.0 with aqueous ammonia. The samples were sampled at regular intervals, and the TMP concentration of the samples was measured by hplc to determine the conversion (i.e., in-process TMP concentration/initial TMP concentration × 100%), and the results are shown in fig. 2.

The results show that mutant D153N/H191N was able to achieve > 99% conversion in 3 hours in the presence of 0.1mM NADH; mutant D153N/H191N was able to convert 1.5M TMP to completion within 18 hours without additional coenzyme addition.

SEQUENCE LISTING

<110> university of east China's college of science

<120> leucine dehydrogenase mutant, encoding gene thereof, genetically engineered bacterium and method for preparing L-tert-leucine

In (1)

<160> 16

<170> PatentIn version 3.5

<210> 1

<211> 357

<212> PRT

<213> Labrenzia aggregate IAM 12614

<400> 1

Met Asn Ala Leu His Lys Ser Val His His Ser Ala Val Phe Asp His

1 5 10 15

Pro Glu Met Gly Asp His Glu Asp Ile Val Phe Val Gln Asp Lys Ala

20 25 30

Thr Gly Leu Lys Ala Ile Ile Ala Val His Asp Thr Thr Leu Gly Pro

35 40 45

Ala Leu Gly Gly Cys Arg Val Trp Pro Tyr Glu His Pro Ala Asp Ala

50 55 60

Leu Thr Asp Ala Leu Arg Leu Ser Arg Gly Met Thr Tyr Lys Asn Ala

65 70 75 80

Leu Ala Gly Leu Asp Leu Gly Gly Gly Lys Ala Val Ile Ile Ala Asp

85 90 95

Pro Arg Arg Asp Lys Ser Glu Ala Leu Met Glu Ala Phe Gly Arg His

100 105 110

Val Glu Arg Leu Ser Gly Thr Tyr Ile Thr Ala Glu Asp Val Gly Val

115 120 125

Ser Pro Asp Asp Met Glu Ala Val Ala Arg Gln Thr Asp His Val Arg

130 135 140

Gly Thr Lys Ala Thr Gly Leu Gly Asp Pro Ser Pro Tyr Thr Ala Leu

145 150 155 160

Gly Val Phe Glu Gly Ile Lys Ala Ser Ala Lys Phe Val Phe Gly Ser

165 170 175

Ser Asp Leu Ser Gly Lys Thr Val Ser Val Gln Gly Leu Gly His Val

180 185 190

Gly Phe Asp Val Ala Arg Gln Leu His Gln Ala Gly Ala Arg Leu Ile

195 200 205

Val Ser Asp Ile His Ala Pro Ala Val Leu Arg Ala Ile Asp Ala Phe

210 215 220

Gly Ala Thr Ala Val Asp Pro Ala Glu Ala His Arg Val Glu Ala Asp

225 230 235 240

Ile Phe Val Pro Cys Ala Leu Gly Ala Gly Leu Asn Ala Arg Thr Val

245 250 255

Pro Gln Ile Gln Ala Arg Ile Val Ala Gly Ala Ala Asn Asn Gln Leu

260 265 270

Gln Thr Pro Ala Asp Gly Ile Ala Leu Lys Lys Arg Gly Ile Leu Tyr

275 280 285

Ala Pro Asp Tyr Ala Ile Asn Ala Gly Gly Val Ile Ser Ile Ala Leu

290 295 300

Ala Thr Ala Asn Ser Gly Asp Asn Val Val Arg Asp Lys Thr Ile Ala

305 310 315 320

Ile Gly Glu Thr Leu Ala Lys Ile Phe Asp Arg Ala Ala His Glu Asp

325 330 335

Thr Thr Pro Glu His Val Ala Asp Thr Met Val Glu Glu Arg Leu Ala

340 345 350

Lys Ala Lys Ala Ala

355

<210> 2

<211> 357

<212> PRT

<213> Labrenzia aggregate IAM 12614

<400> 2

Met Asn Ala Leu His Lys Ser Val His His Ser Ala Val Phe Asp His

1 5 10 15

Pro Glu Met Gly Asp His Glu Asp Ile Val Phe Val Gln Asp Lys Ala

20 25 30

Thr Gly Leu Lys Ala Ile Ile Ala Val His Asp Thr Thr Leu Gly Pro

35 40 45

Ala Leu Gly Gly Cys Arg Val Trp Pro Tyr Glu His Pro Ala Asp Ala

50 55 60

Leu Thr Asp Ala Leu Arg Leu Ser Arg Gly Met Thr Tyr Lys Asn Ala

65 70 75 80

Leu Ala Gly Leu Asp Leu Gly Gly Gly Lys Ala Val Ile Ile Ala Asp

85 90 95

Pro Arg Arg Asp Lys Ser Glu Ala Leu Met Glu Ala Phe Gly Arg His

100 105 110

Val Glu Arg Leu Ser Gly Thr Tyr Ile Thr Ala Glu Asp Val Gly Val

115 120 125

Ser Pro Asp Asp Met Glu Ala Val Ala Arg Gln Thr Asp His Val Arg

130 135 140

Gly Thr Lys Ala Thr Gly Leu Gly Asn Pro Ser Pro Tyr Thr Ala Leu

145 150 155 160

Gly Val Phe Glu Gly Ile Lys Ala Ser Ala Lys Phe Val Phe Gly Ser

165 170 175

Ser Asp Leu Ser Gly Lys Thr Val Ser Val Gln Gly Leu Gly His Val

180 185 190

Gly Phe Asp Val Ala Arg Gln Leu His Gln Ala Gly Ala Arg Leu Ile

195 200 205

Val Ser Asp Ile His Ala Pro Ala Val Leu Arg Ala Ile Asp Ala Phe

210 215 220

Gly Ala Thr Ala Val Asp Pro Ala Glu Ala His Arg Val Glu Ala Asp

225 230 235 240

Ile Phe Val Pro Cys Ala Leu Gly Ala Gly Leu Asn Ala Arg Thr Val

245 250 255

Pro Gln Ile Gln Ala Arg Ile Val Ala Gly Ala Ala Asn Asn Gln Leu

260 265 270

Gln Thr Pro Ala Asp Gly Ile Ala Leu Lys Lys Arg Gly Ile Leu Tyr

275 280 285

Ala Pro Asp Tyr Ala Ile Asn Ala Gly Gly Val Ile Ser Ile Ala Leu

290 295 300

Ala Thr Ala Asn Ser Gly Asp Asn Val Val Arg Asp Lys Thr Ile Ala

305 310 315 320

Ile Gly Glu Thr Leu Ala Lys Ile Phe Asp Arg Ala Ala His Glu Asp

325 330 335

Thr Thr Pro Glu His Val Ala Asp Thr Met Val Glu Glu Arg Leu Ala

340 345 350

Lys Ala Lys Ala Ala

355

<210> 3

<211> 357

<212> PRT

<213> Labrenzia aggregate IAM 12614

<400> 3

Met Asn Ala Leu His Lys Ser Val His His Ser Ala Val Phe Asp His

1 5 10 15

Pro Glu Met Gly Asp His Glu Asp Ile Val Phe Val Gln Asp Lys Ala

20 25 30

Thr Gly Leu Lys Ala Ile Ile Ala Val His Asp Thr Thr Leu Gly Pro

35 40 45

Ala Leu Gly Gly Cys Arg Val Trp Pro Tyr Glu His Pro Ala Asp Ala

50 55 60

Leu Thr Asp Ala Leu Arg Leu Ser Arg Gly Met Thr Tyr Lys Asn Ala

65 70 75 80

Leu Ala Gly Leu Asp Leu Gly Gly Gly Lys Ala Val Ile Ile Ala Asp

85 90 95

Pro Arg Arg Asp Lys Ser Glu Ala Leu Met Glu Ala Phe Gly Arg His

100 105 110

Val Glu Arg Leu Ser Gly Thr Tyr Ile Thr Ala Glu Asp Val Gly Val

115 120 125

Ser Pro Asp Asp Met Glu Ala Val Ala Arg Gln Thr Asp His Val Arg

130 135 140

Gly Thr Lys Ala Thr Gly Leu Gly Asp Pro Ser Pro Tyr Thr Ala Leu

145 150 155 160

Gly Val Phe Glu Gly Ile Lys Ala Ser Ala Lys Phe Val Phe Gly Ser

165 170 175

Ser Asp Leu Ser Gly Lys Thr Val Ser Val Gln Gly Leu Gly Asn Val

180 185 190

Gly Phe Asp Val Ala Arg Gln Leu His Gln Ala Gly Ala Arg Leu Ile

195 200 205

Val Ser Asp Ile His Ala Pro Ala Val Leu Arg Ala Ile Asp Ala Phe

210 215 220

Gly Ala Thr Ala Val Asp Pro Ala Glu Ala His Arg Val Glu Ala Asp

225 230 235 240

Ile Phe Val Pro Cys Ala Leu Gly Ala Gly Leu Asn Ala Arg Thr Val

245 250 255

Pro Gln Ile Gln Ala Arg Ile Val Ala Gly Ala Ala Asn Asn Gln Leu

260 265 270

Gln Thr Pro Ala Asp Gly Ile Ala Leu Lys Lys Arg Gly Ile Leu Tyr

275 280 285

Ala Pro Asp Tyr Ala Ile Asn Ala Gly Gly Val Ile Ser Ile Ala Leu

290 295 300

Ala Thr Ala Asn Ser Gly Asp Asn Val Val Arg Asp Lys Thr Ile Ala

305 310 315 320

Ile Gly Glu Thr Leu Ala Lys Ile Phe Asp Arg Ala Ala His Glu Asp

325 330 335

Thr Thr Pro Glu His Val Ala Asp Thr Met Val Glu Glu Arg Leu Ala

340 345 350

Lys Ala Lys Ala Ala

355

<210> 4

<211> 357

<212> PRT

<213> Labrenzia aggregate IAM 12614

<400> 4

Met Asn Ala Leu His Lys Ser Val His His Ser Ala Val Phe Asp His

1 5 10 15

Pro Glu Met Gly Asp His Glu Asp Ile Val Phe Val Gln Asp Lys Ala

20 25 30

Thr Gly Leu Lys Ala Ile Ile Ala Val His Asp Thr Thr Leu Gly Pro

35 40 45

Ala Leu Gly Gly Cys Arg Val Trp Pro Tyr Glu His Pro Ala Asp Ala

50 55 60

Leu Thr Asp Ala Leu Arg Leu Ser Arg Gly Met Thr Tyr Lys Asn Ala

65 70 75 80

Leu Ala Gly Leu Asp Leu Gly Gly Gly Lys Ala Val Ile Ile Ala Asp

85 90 95

Pro Arg Arg Asp Lys Ser Glu Ala Leu Met Glu Ala Phe Gly Arg His

100 105 110

Val Glu Arg Leu Ser Gly Thr Tyr Ile Thr Ala Glu Asp Val Gly Val

115 120 125

Ser Pro Asp Asp Met Glu Ala Val Ala Arg Gln Thr Asp His Val Arg

130 135 140

Gly Thr Lys Ala Thr Gly Leu Gly Asn Pro Ser Pro Tyr Thr Ala Leu

145 150 155 160

Gly Val Phe Glu Gly Ile Lys Ala Ser Ala Lys Phe Val Phe Gly Ser

165 170 175

Ser Asp Leu Ser Gly Lys Thr Val Ser Val Gln Gly Leu Gly Asn Val

180 185 190

Gly Phe Asp Val Ala Arg Gln Leu His Gln Ala Gly Ala Arg Leu Ile

195 200 205

Val Ser Asp Ile His Ala Pro Ala Val Leu Arg Ala Ile Asp Ala Phe

210 215 220

Gly Ala Thr Ala Val Asp Pro Ala Glu Ala His Arg Val Glu Ala Asp

225 230 235 240

Ile Phe Val Pro Cys Ala Leu Gly Ala Gly Leu Asn Ala Arg Thr Val

245 250 255

Pro Gln Ile Gln Ala Arg Ile Val Ala Gly Ala Ala Asn Asn Gln Leu

260 265 270

Gln Thr Pro Ala Asp Gly Ile Ala Leu Lys Lys Arg Gly Ile Leu Tyr

275 280 285

Ala Pro Asp Tyr Ala Ile Asn Ala Gly Gly Val Ile Ser Ile Ala Leu

290 295 300

Ala Thr Ala Asn Ser Gly Asp Asn Val Val Arg Asp Lys Thr Ile Ala

305 310 315 320

Ile Gly Glu Thr Leu Ala Lys Ile Phe Asp Arg Ala Ala His Glu Asp

325 330 335

Thr Thr Pro Glu His Val Ala Asp Thr Met Val Glu Glu Arg Leu Ala

340 345 350

Lys Ala Lys Ala Ala

355

<210> 5

<211> 361

<212> PRT

<213> Bacteroidetes bacterium OLB10

<400> 5

Met Ile Glu Val Lys Glu Ile Lys Lys Ser Glu Ala Thr Ala Asn Ser

1 5 10 15

Ile Phe Ser Gln Ile Thr Ser Met Lys His Glu Gln Val Val Phe Cys

20 25 30

Tyr Asp His Glu Thr Gly Leu Lys Ala Ile Ile Ala Ile His Asn Thr

35 40 45

Asn Leu Gly Pro Ser Leu Gly Gly Thr Arg Met Trp Lys Tyr Asp Asn

50 55 60

Glu Asn Asp Ala Leu Thr Asp Val Leu Arg Leu Ser Arg Gly Met Thr

65 70 75 80

Tyr Lys Ala Ala Ile Ser Gly Leu Asn Leu Gly Gly Gly Lys Ala Val

85 90 95

Ile Ile Gly Asp Ser Arg Lys Asp Lys Asn Glu Ala Leu Ile Arg Ser

100 105 110

Phe Gly Arg Tyr Val Asn Ser Leu Ser Gly Arg Tyr Ile Thr Ala Glu

115 120 125

Asp Val Gly Thr Ser Thr Lys Asp Met Glu Tyr Ile Ala Lys Glu Thr

130 135 140

Lys His Val Thr Gly Leu Pro Val Ala Met Gly Gly Ser Gly Asp Pro

145 150 155 160

Ser Pro Val Thr Ala Tyr Gly Val Tyr Met Gly Met Lys Ala Ser Ala

165 170 175

Lys Glu Cys Trp Gly Asn Asp Ser Met Asn Gly Lys Lys Val Val Val

180 185 190

Gln Gly Val Gly His Val Gly Glu Ser Leu Val Lys Phe Leu Thr Glu

195 200 205

Glu Gly Ala Lys Val Tyr Val Thr Asp Ile Asn Gln Asp Ala Leu Asn

210 215 220

His Val Ala Ser Glu Phe Lys Ala Glu Ile Ile Asn Pro Glu Lys Val

225 230 235 240

Tyr Ala Met Asp Val Asp Val Tyr Ala Pro Cys Ala Leu Gly Ala Thr

245 250 255

Leu Asn Thr Ala Thr Ile Asn Gln Leu Lys Cys Ala Ile Val Ala Gly

260 265 270

Ser Ala Asn Asn Gln Leu Ala Asp Glu Asp Val His Gly Lys Met Leu

275 280 285

Met Glu Lys Gly Ile Leu Tyr Ala Pro Asp Phe Leu Ile Asn Ala Gly

290 295 300

Gly Leu Ile Asn Val Tyr Ser Glu Leu Lys Gly Tyr Asn His Ala Asp

305 310 315 320

Ala Met Lys Gln Thr Glu His Ile Tyr Asp Val Thr Leu Asp Ile Phe

325 330 335

Lys Lys Ser Lys Ala Glu Lys Ile Thr Thr Gln Gln Ala Ala Met Gln

340 345 350

Ile Ala Glu Lys Arg Ile Tyr Gly Lys

355 360

<210> 6

<211> 1074

<212> DNA

<213> Labrenzia aggregate IAM 12614

<400> 6

atgaacgcct tgcataaatc tgttcaccac agcgccgttt tcgatcatcc ggagatgggc 60

gatcacgaag acatcgtttt cgtccaggac aaggccacgg gcctgaaggc aatcatcgcc 120

gtccacgata ccacgcttgg tccagctctt ggcggctgcc gcgtctggcc ctacgaacat 180

cctgctgacg ccttgacgga tgccctgcgc ctgtctcgag gcatgaccta caagaacgcc 240

cttgctggcc tcgatctcgg tggcggcaag gctgtcatca tcgcggaccc gcgccgtgac 300

aagtccgagg ctctgatgga agcattcggc cgtcatgtgg agcgcctgtc cggcacttac 360

atcaccgcgg aagatgtcgg cgtgtcaccg gacgacatgg aagccgtcgc ccgtcagaca 420

gaccacgtgc gcggcacaaa ggcaaccggc ctcggcgacc cctcgcccta tacggctctc 480

ggtgttttcg aaggcatcaa ggcatccgcc aaatttgtct tcggcagcag cgatctgtcc 540

ggcaagaccg tttccgtgca gggcctcggc catgtcggct ttgacgttgc ccgccagctt 600

caccaagccg gcgcaaggct catcgtctcc gacattcacg caccggccgt gctgcgtgcc 660

attgatgcgt tcggcgccac cgcggtggat ccggccgaag cgcatagggt cgaggcagac 720

atctttgtgc cctgtgcgct tggagcaggt ctcaacgccc gcacggttcc gcaaatccag 780

gccaggatcg tggctggcgc tgccaacaac cagttgcaga ccccggcgga cggcatagcg 840

ctgaaaaagc gcggcatcct ctatgctccg gattatgcaa tcaacgccgg aggcgtgatt 900

tccatcgcgt tggcaaccgc aaacagcggc gacaacgtgg tccgggacaa aaccatcgcg 960

atcggtgaaa ccctggcaaa gatcttcgac cgggcagcgc acgaggacac cacgccggaa 1020

catgtggcgg acacgatggt ggaagagcgt ctggcgaagg caaaggcggc ctga 1074

<210> 7

<211> 1074

<212> DNA

<213> Labrenzia aggregate IAM 12614

<400> 7

atgaacgcct tgcataaatc tgttcaccac agcgccgttt tcgatcatcc ggagatgggc 60

gatcacgaag acatcgtttt cgtccaggac aaggccacgg gcctgaaggc aatcatcgcc 120

gtccacgata ccacgcttgg tccagctctt ggcggctgcc gcgtctggcc ctacgaacat 180

cctgctgacg ccttgacgga tgccctgcgc ctgtctcgag gcatgaccta caagaacgcc 240

cttgctggcc tcgatctcgg tggcggcaag gctgtcatca tcgcggaccc gcgccgtgac 300

aagtccgagg ctctgatgga agcattcggc cgtcatgtgg agcgcctgtc cggcacttac 360

atcaccgcgg aagatgtcgg cgtgtcaccg gacgacatgg aagccgtcgc ccgtcagaca 420

gaccacgtgc gcggcacaaa ggcaaccggc ctcggcaacc cctcgcccta tacggctctc 480

ggtgttttcg aaggcatcaa ggcatccgcc aaatttgtct tcggcagcag cgatctgtcc 540

ggcaagaccg tttccgtgca gggcctcggc catgtcggct ttgacgttgc ccgccagctt 600

caccaagccg gcgcaaggct catcgtctcc gacattcacg caccggccgt gctgcgtgcc 660

attgatgcgt tcggcgccac cgcggtggat ccggccgaag cgcatagggt cgaggcagac 720

atctttgtgc cctgtgcgct tggagcaggt ctcaacgccc gcacggttcc gcaaatccag 780

gccaggatcg tggctggcgc tgccaacaac cagttgcaga ccccggcgga cggcatagcg 840

ctgaaaaagc gcggcatcct ctatgctccg gattatgcaa tcaacgccgg aggcgtgatt 900

tccatcgcgt tggcaaccgc aaacagcggc gacaacgtgg tccgggacaa aaccatcgcg 960

atcggtgaaa ccctggcaaa gatcttcgac cgggcagcgc acgaggacac cacgccggaa 1020

catgtggcgg acacgatggt ggaagagcgt ctggcgaagg caaaggcggc ctga 1074

<210> 8

<211> 1074

<212> DNA

<213> Labrenzia aggregate IAM 12614

<400> 8

atgaacgcct tgcataaatc tgttcaccac agcgccgttt tcgatcatcc ggagatgggc 60

gatcacgaag acatcgtttt cgtccaggac aaggccacgg gcctgaaggc aatcatcgcc 120

gtccacgata ccacgcttgg tccagctctt ggcggctgcc gcgtctggcc ctacgaacat 180

cctgctgacg ccttgacgga tgccctgcgc ctgtctcgag gcatgaccta caagaacgcc 240

cttgctggcc tcgatctcgg tggcggcaag gctgtcatca tcgcggaccc gcgccgtgac 300

aagtccgagg ctctgatgga agcattcggc cgtcatgtgg agcgcctgtc cggcacttac 360

atcaccgcgg aagatgtcgg cgtgtcaccg gacgacatgg aagccgtcgc ccgtcagaca 420

gaccacgtgc gcggcacaaa ggcaaccggc ctcggcgacc cctcgcccta tacggctctc 480

ggtgttttcg aaggcatcaa ggcatccgcc aaatttgtct tcggcagcag cgatctgtcc 540

ggcaagaccg tttccgtgca gggcctcggc aacgtcggct ttgacgttgc ccgccagctt 600

caccaagccg gcgcaaggct catcgtctcc gacattcacg caccggccgt gctgcgtgcc 660

attgatgcgt tcggcgccac cgcggtggat ccggccgaag cgcatagggt cgaggcagac 720

atctttgtgc cctgtgcgct tggagcaggt ctcaacgccc gcacggttcc gcaaatccag 780

gccaggatcg tggctggcgc tgccaacaac cagttgcaga ccccggcgga cggcatagcg 840

ctgaaaaagc gcggcatcct ctatgctccg gattatgcaa tcaacgccgg aggcgtgatt 900

tccatcgcgt tggcaaccgc aaacagcggc gacaacgtgg tccgggacaa aaccatcgcg 960

atcggtgaaa ccctggcaaa gatcttcgac cgggcagcgc acgaggacac cacgccggaa 1020

catgtggcgg acacgatggt ggaagagcgt ctggcgaagg caaaggcggc ctga 1074

<210> 9

<211> 1074

<212> DNA

<213> Labrenzia aggregate IAM 12614

<400> 9

atgaacgcct tgcataaatc tgttcaccac agcgccgttt tcgatcatcc ggagatgggc 60

gatcacgaag acatcgtttt cgtccaggac aaggccacgg gcctgaaggc aatcatcgcc 120

gtccacgata ccacgcttgg tccagctctt ggcggctgcc gcgtctggcc ctacgaacat 180

cctgctgacg ccttgacgga tgccctgcgc ctgtctcgag gcatgaccta caagaacgcc 240

cttgctggcc tcgatctcgg tggcggcaag gctgtcatca tcgcggaccc gcgccgtgac 300

aagtccgagg ctctgatgga agcattcggc cgtcatgtgg agcgcctgtc cggcacttac 360

atcaccgcgg aagatgtcgg cgtgtcaccg gacgacatgg aagccgtcgc ccgtcagaca 420

gaccacgtgc gcggcacaaa ggcaaccggc ctcggcaacc cctcgcccta tacggctctc 480

ggtgttttcg aaggcatcaa ggcatccgcc aaatttgtct tcggcagcag cgatctgtcc 540

ggcaagaccg tttccgtgca gggcctcggc aacgtcggct ttgacgttgc ccgccagctt 600

caccaagccg gcgcaaggct catcgtctcc gacattcacg caccggccgt gctgcgtgcc 660

attgatgcgt tcggcgccac cgcggtggat ccggccgaag cgcatagggt cgaggcagac 720

atctttgtgc cctgtgcgct tggagcaggt ctcaacgccc gcacggttcc gcaaatccag 780

gccaggatcg tggctggcgc tgccaacaac cagttgcaga ccccggcgga cggcatagcg 840

ctgaaaaagc gcggcatcct ctatgctccg gattatgcaa tcaacgccgg aggcgtgatt 900

tccatcgcgt tggcaaccgc aaacagcggc gacaacgtgg tccgggacaa aaccatcgcg 960

atcggtgaaa ccctggcaaa gatcttcgac cgggcagcgc acgaggacac cacgccggaa 1020

catgtggcgg acacgatggt ggaagagcgt ctggcgaagg caaaggcggc ctga 1074

<210> 10

<211> 1086

<212> DNA

<213> Bacteroidetes bacterium OLB10

<400> 10

atgattgaag ttaaagagat taagaaatca gaagctacgg ctaattctat tttttcacaa 60

atcacatcca tgaagcatga gcaggtagta ttctgctacg atcatgaaac aggcttaaaa 120

gctataatcg ccattcataa caccaacctt ggaccttcac tcggaggtac acgtatgtgg 180

aagtacgaca atgaaaatga tgcacttaca gatgttttgc gtctttcacg cggtatgact 240

tacaaagcag ccatatcagg attaaattta ggtggaggaa aagcagtaat cattggcgac 300

agcagaaaag ataagaatga agcactcatc cgtagtttcg gaagatatgt aaactcactc 360

agcggcagat atatcactgc cgaagatgtg ggaacttcta ccaaggatat ggaatatatt 420

gctaaggaaa ccaagcatgt tacaggactg cctgtggcta tgggtggcag tggcgaccca 480

tcgcctgtga cagcttatgg tgtgtatatg ggcatgaaag catcagccaa agaatgttgg 540

ggaaatgaca gcatgaacgg taaaaaggtt gtggtgcagg gtgtagggca tgtaggtgaa 600

agccttgtga agtttcttac tgaagaaggt gcaaaggtat atgtaaccga tatcaatcag 660

gatgcattaa atcatgtggc ttcagaattt aaggccgaaa ttatcaatcc tgaaaaagta 720

tatgctatgg atgtggatgt gtatgctccc tgtgctcttg gagctacact caatactgcc 780

accatcaatc agcttaaatg tgcaattgtt gcagggtcgg ccaataatca attggcagat 840

gaagatgttc atggcaaaat gctgatggaa aaaggaattc tttatgcacc cgatttctta 900

atcaatgccg gtggacttat caatgtgtac agcgaattga aaggttacaa tcatgctgat 960

gcaatgaaac aaactgagca tatttatgat gtaacgcttg atatcttcaa aaaatcaaaa 1020

gctgaaaaaa taaccacaca gcaggctgca atgcagattg ctgagaagag aatctacggt 1080

aaataa 1086

<210> 11

<211> 33

<212> DNA

<213> Artificial sequence

<400> 11

ggcttccatg tcgtccactg acacgccgac atc 33

<210> 12

<211> 33

<212> DNA

<213> Artificial sequence

<400> 12

gatgtcggcg tgtcagtgga cgacatggaa gcc 33

<210> 13

<211> 23

<212> DNA

<213> Artificial sequence

<400> 13

agggcgaggg gttgccgagg ccg 23

<210> 14

<211> 23

<212> DNA

<213> Artificial sequence

<400> 14

cggcctcggc aacccctcgc cct 23

<210> 15

<211> 29

<212> DNA

<213> Artificial sequence

<400> 15

cgtcaaagcc gacgttgccg aggccctgc 29

<210> 16

<211> 29

<212> DNA

<213> Artificial sequence

<400> 16

gcagggcctc ggcaacgtcg gctttgacg 29

Claims (6)

1. A leucine dehydrogenase mutant with increased activity, comprising:

taking wild leucine dehydrogenase LaLeuDH shown in SEQ ID NO.1 as a template, mutating aspartic acid D at position 153 into leucine dehydrogenase mutant D153N of asparagine N, wherein the amino acid sequence of the mutant is shown in SEQ ID NO. 2;

taking wild leucine dehydrogenase LaLeuDH shown in SEQ ID NO.1 as a template, mutating histidine H at the 191 th position into leucine dehydrogenase mutant H191N of asparagine N, wherein the amino acid sequence of the mutant is shown in SEQ ID NO. 3;

the mutant D153N/H191N of leucine dehydrogenase with mutant D153N of the leucine dehydrogenase shown in SEQ ID NO.2 as a template and the mutation of histidine H at the 191 th amino acid residue into asparagine N has the amino acid sequence shown in SEQ ID NO. 4.

2. A gene encoding the leucine dehydrogenase mutant with increased activity of claim 1.

3. A recombinant vector and a genetically engineered bacterium comprising the gene encoding the leucine dehydrogenase mutant according to claim 2.

4. Use of the leucine dehydrogenase mutant of claim 1 for catalyzing trimethylpyruvic acid for the preparation of L-tertiary leucine.

5. The recombinant vector containing the leucine dehydrogenase mutant coding gene and the application of the genetic engineering bacteria in catalyzing trimethylpyruvic acid to prepare L-tert-leucine according to claim 3.

6. A process for the preparation of L-tert-leucine comprising the reduction of trimethylpyruvic acid to L-tert-leucine in the presence of an enzymatic catalytic system comprising a leucine dehydrogenase mutant according to claim 1 for the conversion of trimethylpyruvic acid to L-tert-leucine.

Images