CN113046353B

CN113046353B - Differential screening deoxyribozyme probe for specifically inducing triple negative breast cancer

Info

Publication number: CN113046353B
Application number: CN202110364792.0A
Authority: CN
Inventors: 顾宏周; 胡沁沁; 佟宗轩; 江一舟; 邵志敏; 刘西禹; 葛丽萍; 傅彤
Original assignee: Fudan University Shanghai Cancer Center
Current assignee: Fudan University Shanghai Cancer Center
Priority date: 2021-04-02
Filing date: 2021-04-02
Publication date: 2024-02-06
Anticipated expiration: 2041-04-02
Also published as: CN113046353A

Abstract

The invention discloses a deoxyribozyme probe for specifically inducing triple negative breast cancer and a screening method. According to the invention, through a differential screening strategy of 'counter-cancellation', a deoxyribozyme probe for specifically sensing extracellular metabolites of a TNBC cell line MDA-MB-231 is obtained under the condition that target molecules are unknown. The probe has the characteristics of high recognition speed and good specificity, and provides a new idea for the subsequent development of rapid diagnosis of triple negative breast cancer.

Description

Differential screening deoxyribozyme probe for specifically inducing triple negative breast cancer

Technical Field

The invention belongs to the technical field of deoxyribozyme probes, and particularly relates to a deoxyribozyme probe for specifically inducing triple negative breast cancer, which is obtained by a differential screening method.

Background

Triple-negative breast cancer (TNBC for short) is a type of breast cancer in which estrogen receptor, progestogen receptor and human EGF receptor 2 are all expressed as negative, and accounts for 15% -20% of the total breast cancer. TNBC has the characteristics of younger patients, strong tumor invasiveness, poor prognosis of radiotherapy and chemotherapy, distant metastasis in early disease stage, and the like, and is the breast cancer which is the most malignant at present. Because of the lack of definite markers (i.e., therapeutic targets), existing endocrine and targeted therapies have poor effects on TNBC, and conventional chemoradiotherapy can only benefit part of patients.

Deoxyribozymes (deoxyribozymes) are a class of single-stranded DNA with catalytic functions, with efficient catalytic activity and structural recognition capability, and are generally evolved from random single-stranded DNA libraries by the exponential enrichment ligand system evolution technique (Systematic Evolution ofLigands by Exponential Enrichment, SELEX). For unknown targets such as TNBC, a differential screening method of "counter-cancellation" may be used, i.e., positive screening with target cells and negative screening with control cells, to obtain a deoxyribose nucleic acid probe. The method has been used by researchers to obtain a deoxyribose nucleic acid probe which can specifically recognize the TNBC cell line MDA-MB-231 lysate and cut at a specific RNA base site, but the probe recognizes intracellular molecules, so that the cells need to be lysed in actual detection, and the method has a limitation in TNBC clinical diagnosis. Therefore, there is a need to develop a deoxyribose nucleic acid probe specifically inducing extracellular metabolites of TNBC, which provides a new idea for future clinical diagnosis of TNBC.

Disclosure of Invention

In order to overcome the technical problems, the invention obtains the deoxyribozyme probe for specifically sensing the extracellular metabolite of the TNBC cell line MDA-MB-231 under the condition of unknown target molecules through a differential screening strategy of 'counter-cancellation'.

In a first aspect of the invention, a deoxyribozyme probe for specifically inducing triple negative breast cancer cells is provided, wherein the nucleotide sequence of the deoxyribozyme probe is shown as SEQ ID NO. 1 or SEQ ID NO. 2.

4#：5′-GTAGCCTTCGCAT-R-TGAGACATCGCAACCGTGACGCAGGTTGCGATGTCATAATAGCGGA GGTAAAGCGTGATGCCATACGACACTGCATAGGTTGGGCGCGAAGGCTACATCACGCTAC-3' (SEQ ID NO: 1), wherein R represents a single inserted RNA base A (rA), the underlined part is the sequence evolved from the random pool after screening.

6#：5′-GTAGCCTTCGCAT-R-TGAGACATCGCAACCGTGACGCAGGTTGCGATGTCATAATAGCGGA GAGCTGCGGAGATGTATGCCGGGTCGAACGTGTGGCGGACGAAGGCTACATCACGCTAC-3' (SEQ ID NO: 2) wherein R represents a single inserted RNA base A (rA), the underlined part is the sequence evolved from the random pool after screening.

After the probe recognizes the target in the triple negative breast cancer cell, the conformation of the probe is changed, and the least stable RNA base in the cleavage sequence is hydrolyzed.

In certain embodiments, the cleavage rate constant k of the deoxyribose nucleic acid probe _obs 0.073 and 0.042min respectively ^-1 。

On the other hand, the invention also provides a screening method of the deoxyribozyme probe, which comprises the following steps of,

step S1, mixing a substrate chain, an enzyme chain and a connecting chain according to the mass ratio of 1:1:1, and placing the mixture in a T4 ligase reaction system to construct a DNA library;

step S2, placing the DNA library obtained in the step S1 into EMs of normal mammary epithelial cells MCF-10A and HMEC, incubating at room temperature, carrying out negative screening, and separating and purifying uncleaved DNA bands;

step S3, placing the DNA band obtained in the step S2 into EMs of the cell MDA-MB-231, incubating at room temperature, performing forward screening, and separating and purifying the cut DNA band;

step S4, performing PCR amplification by taking the DNA strip obtained in the step S3 as a template, and recovering a sense strand;

step S5, mixing the sense strand obtained in the step S4 with the substrate strand and the connecting strand in the step 1 according to the mass ratio of 1:1:1, and repeatedly screening according to the steps S1-S4;

and S6, calculating the cutting percentage (Clv%), and when the cutting percentage reaches the plateau phase, cloning and sequencing the PCR product, and selecting a sequence with high repeatability to obtain the deoxyribose nucleic acid probe for specifically sensing triple negative breast cancer.

In certain embodiments, the substrate strand sequence is shown in SEQ ID NO. 3, the enzyme strand sequence is shown in SEQ ID NO. 4, and the linker strand sequence is shown in SEQ ID NO. 5.

In certain embodiments, the incubation time in step S2 and step S3 is 1-1.5h.

In certain embodiments, the PCR amplified primers comprise an upstream primer having a sequence shown in SEQ ID NO. 6 and a downstream primer having a sequence shown in SEQ ID NO. 7.

In certain embodiments, the incubation time in the repeated screen is gradually reduced to 1min with increasing number of repetitions, the number of repetitions being 10-15.

By adopting the technical scheme, the deoxyribozyme probe with higher sensitivity and better specificity can be obtained, and the screening pressure is required to be continuously applied in the multi-round screening process, such as shortening the incubation time or introducing mutation PCR and the like. After each round of screening, the percentage of cleavage sequences (Clv%) was used to characterize the enrichment of the DNA library. Through 11 rounds of screening, interference of non-unique components in the EMs of MDA-MB-231 is gradually eliminated, and a deoxyribose nucleic acid probe which only specifically senses the EMs of MDA-MB-231 and cuts rA bases is obtained.

In certain embodiments, mutant PCR amplification is employed in the last 2-3 screens.

In a third aspect, the invention provides the use of a deoxyribozyme probe for specific cleavage of a triple negative breast cancer extracellular metabolite, wherein the triple negative breast cancer extracellular metabolite is the extracellular metabolite of the cell line MDA-MB-231.

In a fourth aspect, the invention provides the use of a deoxyribozyme probe for the manufacture of a device for the specific rapid detection of triple negative breast cancer cells. Such devices include, but are not limited to, detection kits, detection chips, and the like.

Compared with the prior art, the invention has the technical effects that:

1) The deoxyribozyme probe of the invention gradually increases the probe cleavage signal with the extension of time after the co-incubation with the EM of MDA-MB-231. Calculated cleavage rate constant k for the 4# and 6# probes _obs 0.073 and 0.042min respectively ^-1 。

2) The screening method obtains the deoxyribozyme probe of the extracellular metabolite of the specific induction TNBC cell line MDA-MB-231 under the condition of unknown target molecules through a differential screening strategy of 'counter-cancellation'.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments will be briefly described below.

FIG. 1 is a schematic diagram of DNA library construction and library sequence information.

FIG. 2 is a schematic flow chart of differential screening to obtain a specific inductive TNBC deoxyribozyme probe.

FIG. 3 is a statistical plot of the DNA library cleavage signals for each round.

FIG. 4 is a kinetic characterization of deoxyribozyme probes 4# and 6 #: FIG. 4a is sequence information for the 4# and 6# probes; FIG. 4b is a graph of kinetic gel of the co-incubation of the 4# and 6# probes with MDA-MB-231 and MCF-10A, HMEC, respectively; FIG. 4c is probe k for 4# and 6# _obs And (5) half-life characterization.

FIG. 5 is a graph of a 4# probe-specific characterization gel.

Detailed Description

Embodiments of the technical scheme of the present invention will be described in detail below. The following examples are only for more clearly illustrating the technical aspects of the present invention, and thus are merely examples, which should not be construed as limiting the scope of the present invention. It is noted that unless otherwise indicated, technical or scientific terms used herein should be given the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.

EXAMPLE 1 construction of DNA library

Mixing the synthesized substrate chain, enzyme chain and connecting chain according to a ratio of 1:1:1, incubating for 5min at 70 ℃, and then annealing for 10min at room temperature; t4 ligase was added and the reaction was carried out at room temperature for 2 hours. After the reaction, 3 times of 100% ethanol at-20℃and 3. Mu.L of 2.5mg/mL glycogen were added, and the mixture was frozen in a refrigerator at-80℃for 10 minutes. The frozen mixture was centrifuged at low temperature and high speed (4 ℃,15000rpm,30 min), the supernatant was removed, 20. Mu.L of ultra pure water was added after ethanol was evaporated for reconstitution, and the mixture was purified by 8% denaturing polyacrylamide gel electrophoresis (Denatured Polyacrylamide Gel Electrophoresis, dPAGE) and the successfully ligated bands (full length 119 nt) were recovered by a fluorescence imager and a rubber cutter. Adding a flush-soak buffer solution (200mM NaCl,10mM Tris-HCl pH 7.5,1mM EDTApH 8.0) into the recovered target strip, standing at 4 ℃ for overnight elution, settling by ethanol, and redissolving by ultrapure water to obtain the DNA library required by screening.

DNA library construction system:

substrate chain: 5'-GTAGCCTTCGCAT-R-TGAGACATCGCAACC-3' (SEQ ID NO: 3) wherein R represents a single inserted RNA base A (rA).

Enzyme chain:

5'-phos-GTGACGCAGGTTGCGATGTC-N-CGAAGGCTACATCACGCCTAC-3' (SEQ ID NO: 4) wherein N represents N ₅₀ 。

Connecting chain: 5'-AACCTGCGTCACGGTTGCGATGTCT-3' (SEQ ID NO: 5)

The chemically synthesized 3 DNA single strands, namely, substrate strand, linker strand and enzyme strand, were subjected to annealing, T4 ligase ligation and nucleic acid electrophoresis separation and purification to obtain a DNA screening library having a full length of 119nt, as shown in FIG. 1. The library comprises a rA base and a 50nt random sequence, and the specific sequence is as follows:

5'-GTAGCCTTCGCAT-R-TGAGACATCGCAACCGTGACGCAGGTTGCGATGTC-N50-CGAAGGCTACATCACGCTAC-3', wherein R represents a single inserted RNA base A (rA) and N50 is 50 random sequences.

Example 2 cell culture and extracellular metabolite (extracellular mixtures, EMs) extraction

As control cells, the typical TNBC subtype MCA-MB-231 (ATCC No. HTB-26) was selected as the target cell line, and the normal mammary gland cell lines MCF-10A (ATCC No. CRL-10317) and HMEC (ATCC No. PCS-600-010) were selected. The cells were cultured and passaged according to the ATCC recommended culture protocol. When the cells were cultured to about 80% confluency, washed 3 times with PBS and transferred into serum-free medium for 24 hours, cell debris was removed by centrifugation and filtered with a 0.22 μm membrane, protease inhibitor was added to the resulting supernatant, and stored at-80℃to obtain the EMs required for screening.

EXAMPLE 3 differential screening

As shown in FIG. 2, the differential screening is performed by the steps of negative screening, positive screening, PCR amplification, ligation into a pool, and the like. Clone sequencing was performed after 11 rounds of screening. The specific screening steps comprise:

1. negative selection

Dissolving the DNA library constructed in the example 1 with 75 mu L of buffer 1, heating in a metal bath at 70 ℃ for 5min, cooling to 37 ℃, adding 25 mu L of normal mammary epithelial cells MCF-10A and EMs of HMEC, and incubating at 37 ℃ for 5min; then 100. Mu.L of Mg-containing solution was added ²⁺ Is incubated at room temperature for 1h, and negative selection is performed. Finally, the reaction was stopped by adding an equal volume of 2 Xloading buffer (containing urea) and the uncleaved DNA bands, i.e.full length sequences, were separated and purified by 8% dPAGE and eluted overnight.

2. Forward screening

Centrifuging the elution of the full-length sequence obtained by negative selection, dissolving in 75 mu L of buffer solution 1, heating in a metal bath at 70 ℃ for 5min, cooling to 37 ℃, adding 25 mu L of MDA-MB-231 EMs, and incubating at 37 ℃ for 5min; then 100. Mu.L of Mg-containing solution was added ²⁺ Is incubated for 1h at room temperature, and forward screening is performed. Finally, an equal volume of 2 Xloading buffer (containing urea) was added to stop the reaction, and the cleaved DNA bands, i.e.cleavage sequences, were separated and purified by 8% dPAGE and eluted overnight.

3. PCR amplification

The sequence recovered by forward screening and subjected to cleavage is used as a template, and a forward Primer PrimerA modified by a phosphate group at the 5 'end and a reverse Primer Primer B modified by a space son at the 5' end are used as primers to amplify the screened sequence. The PCR products were separated and purified by 8% dPAGE. Since the reverse primer has a steric modification, a sense strand (90 nt) and an antisense strand (115 nt) with different lengths are obtained after PCR amplification, and the sense strand is recovered by cutting and the content is measured.

Primer A：5′-phos-GTGACGCAGGTTGCGATGTC-3′(SEQ ID NO:6)

Primer B：5′-A ₁₅ -/isp9/GTAGCGTGATGTAGCCTTCG-3′(SEQ ID NO:7)

The PCR reaction system is as follows:

PCR reaction conditions: pre-denaturation at 95℃for 2min, followed by denaturation at 95℃for 30s, annealing at 58℃for 30s, extension at 68℃for 20s per cycle, 25 cycles of amplification; finally, the extension is carried out at 68 ℃ for 5min.

4. Connected into a warehouse

Mixing the sense strand amplified by PCR with the substrate strand and the connecting strand according to the mass ratio of 1:1:1, incubating at 70 ℃ for 5min, and recovering to room temperature for 10min; t4 ligase was added and the reaction was carried out at room temperature for 2 hours. After the reaction is finished, the band which is successfully connected is separated and purified by 8% dPAGE, namely the DNA library screened in the next round.

In order to obtain a deoxyribozyme probe with higher sensitivity and better specificity in the screening process, the screening pressure needs to be continuously applied. As shown in FIG. 3, the Xu Tuoyang ribozyme screening time was allowed to be 1h in the 1-6 rounds of screening steps; in 7-9 rounds of screening, the screening time is reduced to 10min; in the 10 th to 11 th rounds of screening, the screening time was again reduced to 1min. In 1-7 rounds and 10-11 rounds of screening, performing common PCR amplification on the cut sequences after screening; in 8-9 rounds of screening, the cut sequences after screening were subjected to mutant PCR amplification.

Mutation PCR reaction system:

10 x mutation PCR buffer: 70mM MnCl ₂ 500mM KCl,100mM Tris (ph=8.3), 0.1% gelatin; 10 Xmutant PCR dNTP mix: 2mM dGTP and dATP;10mM dCTP and dTTP. Mutant PCR reaction conditions: each cycle was denatured at 95℃for 1min, annealed at 58℃for 1min, and extended at 68℃for 1min, amplified for 25 cycles. Without the steps of pre-denaturation and final extension.

The percent cut (Clv%) was calculated using the following formula to characterize the enrichment of the DNA library after each round of screening, as shown in fig. 3. After multiple rounds of screening, when the incubation time was shortened to 1min, clv% of the 10 th and 11 th rounds of screening were about 15% with no increasing trend, indicating that the enrichment of the DNA library was complete.

Where Clv% is the percent cut, clv is the amount of cut strips in the dPAGE gel and unClv is the amount of uncleaved strips in the dPAGE gel.

2 highly repetitive deoxyribose nucleic acid probes, designated as 4# and 6# probes, respectively, were selected by clonal sequencing. Sequence information for the random region (N50) of the 4# and 6# probes is as follows:

4#(51nt)：

5′-ATAATAGCGGAGGTAAAGCGTGATGCCATACGACACTGCATAGGTTGGGCG-3′(SEQ ID NO:8)

6#(50nt)：

5′-ATAATAGCGGAGAGCTGCGGAGATGTATGCCGGGTCGAACGTGTGGCGGA-3′(SEQ ID NO:9)

EXAMPLE 4 characterization of the deoxyribose nucleic acid probe Performance

The 4# and 6# probes were tested for cut rate. The percent cleavage (Clv%) at the various reaction time points was determined by running 8% dPAGE by co-incubating the 4# and 6# probes with EMs of MCF-10A/HMEC and MDA-MB-231, respectively, as shown in FIG. 4. After co-incubation with the EMs of MCF-10A and HMEC, no cleavage occurred for both the 4# and 6# probes; and MDA-MB-231, the cleavage signal of the probe No. 4 and 6 increases gradually with time. Calculated cleavage rate constant k for the 4# and 6# probes _obs 0.073 and 0.042min respectively ^-1 。

The deoxyribozyme probe is specifically characterized. Taking the example of the 4# probe, the probe was incubated with MDA-MB-231 and other non-target cell lines EMs for 1h, respectively, and after termination of the reaction, the probe specificity was characterized by running 8% dPAGE. As shown in FIG. 5, other TNBC cell subtypes EMs tested in the present invention have no apparent cleavage response to the 4# probe except that the EMs of the four MDA-MB-231-RR, MDA-MB-231-4175, MDA-MB-231-4173, and MDA-MB-231-GEM70 derived cell lines trigger cleavage of the 4# probe.

Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and not for limiting the same; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some or all of the technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit of the invention, and are intended to be included within the scope of the appended claims and description.

SEQUENCE LISTING

<110> Hospital for affiliated tumors at university of double denier

<120> differential screening of deoxyribozyme probes for specific induction of triple negative breast cancer

<130> 2021

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 120

<212> DNA

<213> Artificial sequence (artificial sequence)

<220>

<221> RNA base A (rA)

<222> (14)..(14)

<223> r represents RNA base A (rA)

<400> 1

gtagccttcg catrtgagac atcgcaaccg tgacgcaggt tgcgatgtca taatagcgga 60

ggtaaagcgt gatgccatac gacactgcat aggttgggcg cgaaggctac atcacgctac 120

<210> 2

<211> 119

<212> DNA

<213> Artificial sequence (artificial sequence)

<220>

<221> RNA base A (rA)

<222> (14)..(14)

<223> r is RNA base A (rA)

<400> 2

gtagccttcg catrtgagac atcgcaaccg tgacgcaggt tgcgatgtca taatagcgga 60

gagctgcgga gatgtatgcc gggtcgaacg tgtggcggac gaaggctaca tcacgctac 119

<210> 3

<211> 29

<212> DNA

<213> Artificial sequence (artificial sequence)

<220>

<221> RNA base A (rA)

<222> (14)..(14)

<223> r represents RNA base A (rA)

<400> 3

gtagccttcg catrtgagac atcgcaacc 29

<210> 4

<211> 42

<212> DNA

<213> Artificial sequence (artificial sequence)

<220>

<221> random sequence

<222> (21)..(21)

<223> n represents 50 random sequences

<220>

<221> misc_feature

<222> (21)..(21)

<223> n is a, c, g, or t

<400> 4

gtgacgcagg ttgcgatgtc ncgaaggcta catcacgcct ac 42

<210> 5

<211> 25

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 5

aacctgcgtc acggttgcga tgtct 25

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<220>

<221> phosphate modification

<222> (1)..(1)

<223> phos-phosphate modification

<400> 6

gtgacgcagg ttgcgatgtc 20

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<220>

<221> spatial sub-modification

<222> (1)..(1)

<223> A15-/isp 9/-modification

<400> 7

gtagcgtgat gtagccttcg 20

<210> 8

<211> 51

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 8

ataatagcgg aggtaaagcg tgatgccata cgacactgca taggttgggc g 51

<210> 9

<211> 50

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 9

ataatagcgg agagctgcgg agatgtatgc cgggtcgaac gtgtggcgga 50

Claims

1. A deoxyribozyme probe for specifically sensing triple negative breast cancer cells is characterized in that the nucleotide sequence of the deoxyribozyme probe is shown as SEQ ID NO. 1 or SEQ ID NO. 2.

2. The deoxyribonuclease probe of claim 1 wherein the deoxyribonuclease probe has a cleavage rate constant k _obs 0.073 and 0.042min respectively ^-1 。

3. Use of the deoxyribozyme probe according to claim 1 for preparing a device for specifically and rapidly detecting triple negative breast cancer cells.