CN113046353A

CN113046353A - Deoxyribozyme probe for differential screening of specific induction triple negative breast cancer

Info

Publication number: CN113046353A
Application number: CN202110364792.0A
Authority: CN
Inventors: 顾宏周; 胡沁沁; 佟宗轩; 江一舟; 邵志敏; 刘西禹; 葛丽萍; 傅彤
Original assignee: Fudan University Shanghai Cancer Center
Current assignee: Fudan University Shanghai Cancer Center
Priority date: 2021-04-02
Filing date: 2021-04-02
Publication date: 2021-06-29
Anticipated expiration: 2041-04-02
Also published as: CN113046353B

Abstract

The invention discloses a deoxyribozyme probe for specifically inducing triple negative breast cancer and a screening method thereof. According to the invention, through a differential screening strategy of 'hedging and counteracting', under the condition that a target molecule is unknown, a deoxyribozyme probe for specifically sensing an extracellular metabolite of a TNBC cell line MDA-MB-231 is obtained. The probe has the characteristics of high recognition speed and good specificity, and provides a new idea for the subsequent development of the rapid diagnosis of the triple negative breast cancer.

Description

Deoxyribozyme probe for differential screening of specific induction triple negative breast cancer

Technical Field

The invention belongs to the technical field of deoxyribozyme probes, and particularly relates to a deoxyribozyme probe for specifically inducing triple negative breast cancer, which is obtained by a differential screening method.

Background

Triple-negative breast cancers (TNBC for short) are breast cancers in which estrogen receptors, progesterone receptors and human epidermal growth factor receptors 2 are negative, and account for 15% -20% of the total breast cancers. TNBC has the characteristics of patient youthful appearance, strong tumor invasiveness, poor radiotherapy and chemotherapy prognosis, distant metastasis in early disease and the like, and is the most malignant breast cancer at present. Because of the lack of clear markers (i.e., therapeutic targets), existing endocrine and targeted therapies do not work well for TNBC, and conventional chemoradiotherapy can only benefit a subset of patients.

Deoxyribozymes (deoxyribozymes) are single-stranded DNAs with catalytic function, have high catalytic activity and structure recognition capability, and are generally obtained by Evolution from random single-stranded DNA libraries through the ligand Systematic Evolution technology (SELEX) of Exponential Enrichment. For unknown target molecules such as TNBC, a differential screening method of 'offset' can be used, namely, a target cell is used for positive screening, and a control cell is used for negative screening to obtain the deoxyribozyme probe. The existing researchers use the method to obtain the deoxyribozyme probe which can specifically recognize TNBC cell line MDA-MB-231 lysate and cut at a specific RNA base site, but the probe recognizes intracellular molecules, and the cells need to be cracked in actual detection, so the method has limitation in TNBC clinical diagnosis. Therefore, the development of a deoxyribozyme probe which specifically induces the extracellular metabolites of TNBC is urgently needed, and a new idea is provided for clinical diagnosis of TNBC in the future.

Disclosure of Invention

In order to overcome the technical problems, the invention obtains the deoxyribozyme probe specifically inducing the TNBC cell line MDA-MB-231 extracellular metabolite by a differential screening strategy of 'hedging counteraction' under the condition that a target molecule is unknown.

In the first aspect of the invention, a deoxyribozyme probe for specifically inducing triple negative breast cancer cells is provided, and the nucleotide sequence of the deoxyribozyme probe is shown as SEQ ID NO. 1 or SEQ ID NO. 2.

4#：5′-GTAGCCTTCGCAT-R-TGAGACATCGCAACCGTGACGCAGGTTGCGATGTCATAATAGCGGA GGTAAAGCGTGATGCCATACGACACTGCATAGGTTGGGCGCGAAGGCTACATCACGCTAC-3' (SEQ ID NO:1), where R represents a single inserted RNA base A (rA), and the underlined sequence is randomly pooled after screening.

6#：5′-GTAGCCTTCGCAT-R-TGAGACATCGCAACCGTGACGCAGGTTGCGATGTCATAATAGCGGA GAGCTGCGGAGATGTATGCCGGGTCGAACGTGTGGCGGACGAAGGCTACATCACGCTAC-3' (SEQ ID NO:2) where R represents a single inserted RNA base A (rA) and the underlined sequence is randomly pooled after screening.

After the probe identifies a target in a triple negative breast cancer cell, the conformation of the probe is changed, and the most unstable RNA base in a cleavage sequence is hydrolyzed.

In certain embodiments, the deoxyribozyme probe has a cleavage rate constant k_obs0.073 and 0.042min respectively^-1。

On the other hand, the invention also provides a screening method of the deoxyribozyme probe, which comprises the following steps,

step S1, mixing the substrate chain, the enzyme chain and the connecting chain according to the amount of the substance 1:1:1, and placing the mixture in a T4 ligase reaction system to construct a DNA library;

step S2, placing the DNA library obtained in the step S1 in EMs of normal mammary epithelial cells MCF-10A and HMEC, incubating at room temperature, carrying out negative screening, and separating and purifying uncut DNA bands;

step S3, placing the DNA band obtained in the step S2 in EMs of the cell MDA-MB-231, incubating at room temperature, carrying out forward screening, and separating and purifying the cut DNA band;

step S4, carrying out PCR amplification by using the DNA band obtained in step S3 as a template, and recovering a sense strand;

step S5, mixing the sense strand obtained in step S4 with the substrate strand and the connecting strand in step 1 according to the amount of the substance 1:1:1, and repeatedly screening according to steps S1-S4;

and step S6, calculating the cutting percentage (Clv%), when the cutting percentage reaches the plateau stage, carrying out clone sequencing on the PCR product, and selecting a sequence with high repeatability, namely the deoxyribozyme probe for specifically inducing the triple negative breast cancer.

In certain embodiments, the substrate strand sequence is set forth in SEQ ID NO 3, the polymerase chain sequence is set forth in SEQ ID NO 4, and the linker strand sequence is set forth in SEQ ID NO 5.

In certain embodiments, the incubation time in steps S2, S3 is 1-1.5 h.

In certain embodiments, the primers for PCR amplification include an upstream primer and a downstream primer, the upstream primer is represented by SEQ ID NO. 6, and the downstream primer is represented by SEQ ID NO. 7.

In certain embodiments, the incubation time in the repeated screening is reduced to 1min with increasing number of repetitions, which are 10-15.

By adopting the technical scheme, the deoxyribozyme probe with higher sensitivity and better specificity can be obtained, and the screening pressure is continuously applied in the multi-round screening process, such as shortening the incubation time or introducing mutation PCR and the like. After each round of screening, the enrichment of the DNA library was characterized by the percentage of cleaved sequence (Clv%). Through 11 rounds of screening, the interference of non-unique components in EMs of MDA-MB-231 is gradually eliminated, and the deoxyribozyme probe which only specifically induces the EMs of MDA-MB-231 and cuts rA base is obtained.

In certain embodiments, mutation PCR amplification is used in the last 2-3 screens.

In a third aspect, the invention provides an application of a deoxyribozyme probe in specific cleavage of a triple negative breast cancer extracellular metabolite, which is characterized in that the triple negative breast cancer extracellular metabolite is a cell line MDA-MB-231 extracellular metabolite.

In a fourth aspect, the invention provides an application of a deoxyribozyme probe in preparing a device for specifically and rapidly detecting triple-negative breast cancer cells. The device includes but is not limited to a detection kit, a detection chip, etc.

Compared with the prior art, the invention has the technical effects that:

1) the DNAzyme probes of the invention show a gradual increase in the cleavage signal of the probe over time after co-incubation with EM from MDA-MB-231. Calculated, cleavage Rate constants k for probes # 4 and # 6_obs0.073 and 0.042min respectively^-1。

2) The screening method provided by the invention obtains the deoxyribozyme probe for specifically sensing the TNBC cell line MDA-MB-231 extracellular metabolite by a differential screening strategy of 'hedging counteraction' under the condition that a target molecule is unknown.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments will be briefly described below.

FIG. 1 is a schematic diagram of DNA library construction and library sequence information.

FIG. 2 is a schematic flow chart of differential screening to obtain specific induction TNBC deoxyribozyme probe.

FIG. 3 is a statistical plot of the cleavage signals of the DNA library in each round.

FIG. 4 is a kinetic characterization of deoxyribozyme probes 4# and 6 #: FIG. 4a is the sequence information of probes # 4 and # 6; FIG. 4b is a kinetic gel of the co-incubation of probes # 4 and # 6 with EMs of MDA-MB-231 and MCF-10A, HMEC, respectively; FIG. 4c shows probe k Nos. 4# and 6#_obsAnd half-life characterization.

FIG. 5 is a gel diagram of the 4# probe specificity characterization.

Detailed Description

Hereinafter, embodiments of the present invention will be described in detail. The following examples are only for illustrating the technical solutions of the present invention more clearly, and therefore are only examples, and the protection scope of the present invention is not limited thereby. It is to be noted that, unless otherwise specified, technical or scientific terms used herein shall have the ordinary meaning as understood by those skilled in the art to which the invention pertains.

EXAMPLE 1 construction of DNA library

Mixing the synthesized substrate chain, the enzyme chain and the connecting chain according to the ratio of 1:1:1, incubating at 70 ℃ for 5min, and then annealing at room temperature for 10 min; t4 ligase was added thereto and the reaction was carried out at room temperature for 2 hours. After the reaction, 3 times the volume of 100% ethanol at-20 ℃ and 3. mu.L glycogen at 2.5mg/mL were added, and the mixture was frozen in a refrigerator at-80 ℃ for 10 min. The frozen mixture was centrifuged at low temperature and high speed (4 ℃, 15000rpm, 30min), the supernatant was removed, after ethanol was evaporated, 20. mu.L of ultrapure water was added for redissolution, purified by 8% modified Polyacrylamide Gel Electrophoresis (dPAGE), and the successfully ligated band (total length 119nt) was recovered by a fluorescence imager and a Gel cutter. Adding a crush-soak buffer solution (200mM NaCl, 10mM Tris-HCl pH 7.5 and 1mM EDTApH 8.0) into the recovered target band, placing the target band at 4 ℃ for overnight elution, and obtaining a DNA library required by screening after ethanol sedimentation and ultrapure water redissolution.

DNA library construction system:

substrate chain: 5 '-GTAGCCTTCGCAT-R-TGAGACATCGCAACC-3' (SEQ ID NO:3) wherein R represents a single inserted RNA base A (rA).

The enzyme chain:

5 '-phos-GTGACGCAGGTTGCGATGTC-N-CGAAGGCTACATCACGCCTAC-3' (SEQ ID NO:4) wherein N represents N₅₀。

Connecting chains: 5'-AACCTGCGTCACGGTTGCGATGTCT-3' (SEQ ID NO:5)

3 kinds of chemically synthesized DNA single strands, namely a substrate strand, a connecting strand and a enzyme chain, are subjected to annealing, T4 ligase connection and nucleic acid electrophoresis separation and purification to obtain a DNA screening library with the total length of 119nt, as shown in FIG. 1. The library comprises an rA base and a 50nt random sequence, and the specific sequence is as follows:

5 '-GTAGCCTTCGCAT-R-TGAGACATCGCAACCGTGACGCAGGTTGCGATGTC-N50-CGAAGGCTACATCACGCTAC-3', wherein R represents a single inserted RNA base A (rA) and N50 is 50 random sequences.

Example 2 cell culture and extraction of Extracellular Metabolites (EMs)

A typical TNBC subtype MCA-MB-231(ATCC No. HTB-26) was selected as a target cell line, and a normal mammary gland cell line MCF-10A (ATCC No. CRL-10317) and HMEC (ATCC No. PCS-600-010) were selected as control cells. The cells were cultured and passaged according to the ATCC recommended culture protocol. When the cells are cultured to about 80% fusion, the cells are washed for 3 times by PBS and then transferred into a serum-free medium for 24 hours, cell fragments are removed by centrifugation and filtered by a 0.22 mu m membrane, and a protease inhibitor is added into the obtained supernatant and stored at-80 ℃ to obtain the EMs required by screening.

Example 3 differential screening

As shown in FIG. 2, differential screening is performed by negative screening, positive screening, PCR amplification, ligation into a library, and the like. Clone sequencing was performed after 11 rounds of screening. The specific screening steps comprise:

1. negative screening

Dissolving the DNA library constructed in the embodiment 1 by using 75 mu L of buffer solution 1, heating the solution in a metal bath at 70 ℃ for 5min, cooling the solution to 37 ℃, adding 25 mu L of normal mammary epithelial cells MCF-10A and EMs of HMEC, and incubating the solution at 37 ℃ for 5 min; then 100. mu.L of Mg-containing solution was added²⁺And (3) incubating for 1h at room temperature in the buffer solution 2, and carrying out negative screening. The reaction was finally stopped by adding an equal volume of 2 Xloading buffer (containing urea) and the uncleaved DNA band, i.e.the full-length sequence, was separated and purified by 8% dPAGE and eluted overnight.

2. Forward screening

Eluting the full-length sequence obtained by negative screening, centrifuging, dissolving in 75 μ L buffer solution 1, heating in 70 deg.C metal bath for 5min, cooling to 37 deg.C, adding 25 μ L MDA-MB-231 EMs, and incubating at 37 deg.C for 5 min; then 100. mu.L of Mg-containing solution was added²⁺ OfWashing 2, incubating for 1h at room temperature, and carrying out forward screening. Finally, an equal volume of 2 Xloading buffer (containing urea) was added to stop the reaction and the cleaved DNA band, i.e., the cleavage sequence, was separated and purified by 8% dPAGE and eluted overnight.

3. PCR amplification

And (3) amplifying the sequence after screening by using the sequence which is recovered by forward screening and subjected to cutting as a template, and using a forward Primer PrimeRA with a phosphate group modification at the 5 'end and a reverse Primer PrimeR B with a spacer modification at the 5' end as primers. The PCR product was separated and purified by 8% dPAGE. Because the reverse primer carries a spacer modification, a sense strand (90nt) and an antisense strand (115nt) with different lengths are obtained after PCR amplification, the sense strand is recovered by gel cutting, and the content is determined.

Primer A：5′-phos-GTGACGCAGGTTGCGATGTC-3′(SEQ ID NO:6)

Primer B：5′-A₁₅-/isp9/GTAGCGTGATGTAGCCTTCG-3′(SEQ ID NO:7)

The PCR reaction system is as follows:

and (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 2min, followed by denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 68 ℃ for 20s, and amplification for 25 cycles per cycle; finally, final extension at 68 ℃ for 5 min.

4. Connected into a library

Mixing the sense strand, the substrate strand and the connecting strand after PCR amplification according to the amount of the substance of 1:1:1, incubating for 5min at 70 ℃, and then returning to room temperature for 10 min; t4 ligase was added and the reaction was carried out at room temperature for 2 hours. After the reaction is finished, the successfully connected bands are separated and purified by 8% dPAGE, and the bands are the DNA library screened in the next round.

In the screening process, in order to obtain the deoxyribozyme probe with higher sensitivity and better specificity, the screening pressure needs to be continuously applied. As shown in FIG. 3, the deoxyribozyme screening time was allowed to be 1h in the 1-6 rounds of the screening steps; in 7-9 rounds of screening, the screening time is reduced to 10 min; in rounds 10-11 of screening, the screening time was again reduced to 1 min. In the screening of 1-7 rounds and 10-11 rounds, common PCR amplification is carried out on the screened cutting sequences; in 8-9 rounds of selection, the selected cleavage sequences were subjected to mutation PCR amplification.

Mutation PCR reaction System:

10 × mutant PCR buffer: 70mM MnCl₂500mM KCl, 100mM Tris (pH 8.3), 0.1% gelatin; 10 × mutant PCR dNTP mix: 2mM dGTP and dATP; 10mM dCTP and dTTP. Mutation PCR reaction conditions: each cycle of denaturation at 95 ℃ for 1min, annealing at 58 ℃ for 1min, extension at 68 ℃ for 1min, and amplification for 25 cycles. Without pre-denaturation and final extension steps.

The percentage of cleavage (Clv%) was calculated using the following formula to characterize the degree of enrichment of the DNA library after each round of screening, as shown in FIG. 3. After multiple rounds of screening, when the incubation time is shortened to 1min, Clv% of the 10 th and 11 th rounds of screening is about 15% and has no increasing trend, which indicates that the enrichment of the DNA library is completed.

Wherein Clv% is the percent cut, Clv is the amount of cut band in the dPAGE gel plot, and unClv is the amount of uncut band in the dPAGE gel plot.

After clone sequencing, 2 highly repetitive deoxyribozyme probes were selected and named as probes # 4 and # 6, respectively. Sequence information of the random regions (N50) of probes # 4 and # 6 was as follows:

4#(51nt)：

5′-ATAATAGCGGAGGTAAAGCGTGATGCCATACGACACTGCATAGGTTGGGCG-3′(SEQ ID NO:8)

6#(50nt)：

5′-ATAATAGCGGAGAGCTGCGGAGATGTATGCCGGGTCGAACGTGTGGCGGA-3′(SEQ ID NO:9)

Example 4 characterization of deoxyribozyme Probe Performance

The 4# and 6# probes were subjected to the cleavage rate test. Probes # 4 and # 6 were incubated with EMs from MCF-10A/HMEC and MDA-MB-231, respectively, and the percent cleavage (Clv%) was determined at different reaction time points by running 8% dPAGE, as shown in FIG. 4. After the incubation with EMs of MCF-10A and HMEC, no cleavage occurred in the probes No. 4 and No. 6; whereas the cleavage signals of the 4# and 6# probes increased gradually with time after EM co-incubation with MDA-MB-231. Calculated, cleavage Rate constants k for probes # 4 and # 6_obs0.073 and 0.042min respectively^-1。

The deoxyribozyme probe was specifically characterized. Taking the # 4 probe as an example, the probe was incubated with MDA-MB-231 and other non-target cell lines EMs for 1h, and after terminating the reaction, the probe specificity was characterized by running 8% dPAGE. As shown in FIG. 5, the other TNBC cell subset EMs tested in the present invention have no significant cleavage response to the 4# probe, except that the EMs of the four MDA-MB-231-RR, MDA-MB-231-4175, MDA-MB-231-4173 and MDA-MB-231-GEM70 cell lines derived from MDA-MB-231 trigger 4# probe cleavage.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; such modifications and substitutions do not depart from the spirit and scope of the present invention, and they should be construed as being included in the following claims and description.

SEQUENCE LISTING

<110> affiliated tumor hospital of double-denier university

<120> differential screening of deoxyribozyme probe specifically inducing triple negative breast cancer

<130> 2021

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 120

<212> DNA

<213> Artificial sequence (artificial sequence)

<220>

<221> RNA base A (rA)

<222> (14)..(14)

<223> r represents RNA base A (rA)

<400> 1

gtagccttcg catrtgagac atcgcaaccg tgacgcaggt tgcgatgtca taatagcgga 60

ggtaaagcgt gatgccatac gacactgcat aggttgggcg cgaaggctac atcacgctac 120

<210> 2

<211> 119

<212> DNA

<213> Artificial sequence (artificial sequence)

<220>

<221> RNA base A (rA)

<222> (14)..(14)

<223> r is RNA base A (rA)

<400> 2

gtagccttcg catrtgagac atcgcaaccg tgacgcaggt tgcgatgtca taatagcgga 60

gagctgcgga gatgtatgcc gggtcgaacg tgtggcggac gaaggctaca tcacgctac 119

<210> 3

<211> 29

<212> DNA

<213> Artificial sequence (artificial sequence)

<220>

<221> RNA base A (rA)

<222> (14)..(14)

<223> r represents RNA base A (rA)

<400> 3

gtagccttcg catrtgagac atcgcaacc 29

<210> 4

<211> 42

<212> DNA

<213> Artificial sequence (artificial sequence)

<220>

<221> random sequence

<222> (21)..(21)

<223> n represents 50 random sequences

<220>

<221> misc_feature

<222> (21)..(21)

<223> n is a, c, g, or t

<400> 4

gtgacgcagg ttgcgatgtc ncgaaggcta catcacgcct ac 42

<210> 5

<211> 25

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 5

aacctgcgtc acggttgcga tgtct 25

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<220>

<221> phosphate modification

<222> (1)..(1)

<223> Pho-phosphate modification

<400> 6

gtgacgcagg ttgcgatgtc 20

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<220>

<221> steric modification

<222> (1)..(1)

<223> A15-/isp 9/-modification

<400> 7

gtagcgtgat gtagccttcg 20

<210> 8

<211> 51

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 8

ataatagcgg aggtaaagcg tgatgccata cgacactgca taggttgggc g 51

<210> 9

<211> 50

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 9

ataatagcgg agagctgcgg agatgtatgc cgggtcgaac gtgtggcgga 50

Claims

1. A deoxyribozyme probe for specifically inducing triple negative breast cancer cells is characterized in that the nucleotide sequence of the deoxyribozyme probe is shown as SEQ ID NO 1 or SEQ ID NO 2.

2. The dnazyme probe according to claim 1, wherein the dnazyme probe has a cleavage rate constant k_obs0.073 and 0.042min respectively^-1。

3. The method of screening for a dnazyme probe according to claim 1, comprising the steps of,

step S2, placing the DNA library obtained in the step S1 in normal mammary epithelial cells MCF-10A and Extracellular Metabolites (EMs) of HMEC, incubating at room temperature, performing negative screening, and separating and purifying uncut DNA bands;

4. The screening method according to claim 2, wherein the substrate strand sequence is shown as SEQ ID NO. 3, the polymerase chain sequence is shown as SEQ ID NO. 4, and the linker chain sequence is shown as SEQ ID NO. 5.

5. Screening method according to claim 1, wherein the incubation time in steps S2, S3 is 1-1.5 h.

6. The screen of claim 1, wherein the primers for PCR amplification comprise an upstream primer and a downstream primer, wherein the upstream primer has the sequence shown in SEQ ID NO. 6, and the downstream primer has the sequence shown in SEQ ID NO. 7.

7. The screening method according to claim 1, wherein the incubation time in the repeated screening is gradually reduced to 1min along with the increasing of the repeated times, and the repeated screening is performed 10-15 times.

8. The screening method according to claim 7, wherein mutation PCR amplification is used in the last 2-3 screens.

9. The use of the dnazyme probe of claim 1, for specifically cleaving a triple negative breast cancer extracellular metabolite, wherein said triple negative breast cancer extracellular metabolite is a cell line MDA-MB-231 extracellular metabolite.

10. Use of the dnazyme probe of claim 1 in the preparation of a device for the specific rapid detection of triple negative breast cancer cells.