CN112301020A - III-class deoxyribozyme mutant and preparation method and application thereof - Google Patents

Abstract

The invention provides a deoxyribozyme capable of rapidly hydrolyzing DNA. According to the invention, by introducing a special end structure, a DNA library with high cyclization efficiency is designed, an experiment for screening and inducing zinc ion cutting is carried out, and another class III deoxyribozyme is screened in vitro. Designing a corresponding degenerate library, and carrying out degenerate re-screening to obtain the III type deoxyribozyme mutant capable of rapidly hydrolyzing and cutting DNA, thereby meeting the requirements of different DNA hydrolysis reactions and obtaining the III type deoxyribozyme capable of sensing zinc ions and rapidly hydrolyzing DNA phosphodiester bonds.

Description

III-class deoxyribozyme mutant and preparation method and application thereof

Technical Field

The invention belongs to the fields of biochemistry and molecular biology, and particularly relates to a III-class deoxyribozyme mutant capable of rapidly hydrolyzing DNA, and a preparation method and application thereof.

Background

Deoxyribozymes (deoxyribozymes), also known as dnazymes, are artificially synthesized single-stranded DNA molecules with certain three-dimensional structures that have enzymatic activity obtained by in vitro screening strategies. The catalyst has good structure recognition capability and high-efficiency catalytic activity, and can catalyze various chemical reactions such as DNA phosphorylation, adenylation, RNA cutting, DNA connection and the like. In recent years, two types of induced zinc ions have been screened by researchersAnd a deoxyribozyme which hydrolyzes a DNA phosphodiester bond at a specific site. Wherein, the catalytic core of the class I deoxyribozyme dependent on zinc ions has only 15 conserved nucleotide sequences, and is flanked by 1 or 2 double-stranded substructures, and the rate constant of the hydrolytic cleavage of DNA is about 1.0min^-1. The type II deoxyribozyme with relatively slow reaction rate hydrolyzes DNA, and the rate constant is only 0.013min^-1. The hydrolysis rates of different dnazymes are different, and in order to meet the requirements of different DNA hydrolysis reactions, more dnazymes mutants capable of rapidly hydrolyzing DNA need to be discovered.

Disclosure of Invention

Based on the above, the invention aims to provide a deoxyribozyme mutant capable of rapidly hydrolyzing DNA, and a preparation method and application thereof.

In order to achieve the purpose, the specific technical scheme of the invention is as follows:

a III-type deoxyribozyme mutant has the structural general formula: p1- (N)_x-P2-P2′-(N)_w-P1' x, w are both positive integers, and (N)_wContains a cutting site, wherein the cutting site is between T/G;

wherein (N)_xContains at least one C, (N)_wThe sequence is selected from a sequence shown as SEQ ID NO. 14;

p1 is complementary paired with all or part of the nucleotide sequence of P1' to form subdomain 1;

p2 is complementary paired with all or part of the nucleotide sequence of P2' to form subdomain 2.

Another purpose of the invention is to provide a preparation method of deoxyribozyme capable of rapidly hydrolyzing DNA, the specific technical scheme is as follows:

an in vitro screening method of deoxyribozyme mutant comprises the following steps:

(1) two DNA single-strand libraries are constructed, primers are mutually used for performing polymerase chain reaction to obtain linear single-strand DNA: the sequences of the two single-stranded DNA libraries are shown as SEQ ID NO.1 and SEQ ID NO.2, and the complementary regions contained at the tail ends of the SEQ ID NO.1 and the SEQ ID NO. 2; and the end of SEQ ID NO.2 is modified by rC;

(2) carrying out a first cyclization reaction by taking the linear single-stranded DNA as a substrate;

(3) pre-screening, cyclization, PCR amplification and secondary cyclization; the primers for secondary cyclization are shown as SEQ ID NO.3 and SEQ ID NO. 4.

The invention also aims to provide an application of the deoxyribozyme capable of rapidly hydrolyzing DNA, and the specific technical scheme is as follows:

application of deoxyribozyme mutant in cutting long single-stranded DNA

Based on the technical scheme, the invention has the following beneficial effects:

according to the invention, by introducing a special end structure, a DNA library with high cyclization efficiency is designed, an experiment for screening and inducing zinc ion cutting is carried out, and another class III deoxyribozyme is screened in vitro. Designing a corresponding degenerate library, and carrying out degenerate re-screening to obtain the III type deoxyribozyme mutant capable of rapidly hydrolyzing and cutting DNA, thereby meeting the requirements of different DNA hydrolysis reactions and obtaining the III type deoxyribozyme capable of sensing zinc ions and rapidly hydrolyzing DNA phosphodiester bonds.

Drawings

FIG. 1 is a diagram showing the results of the single-stranded DNA library cyclization efficiency assay;

FIG. 2 is an in vitro screening procedure;

FIG. 3 is a sequence alignment of a group III deoxyribozyme and its mutant;

FIG. 4 is a diagram showing the sequence structure and cleavage site of Zn-III-R1;

FIG. 5 shows the kinetic test of the group III deoxyribozyme and its mutant at 37 ℃;

FIG. 6 observed cut Rate constants (k) of Zn-III-R3_obs) An image that varies with temperature;

FIG. 7 is an ion specificity test chart of Zn-III-R3;

FIG. 8 is a graph showing the pH dependence and the zinc ion concentration dependence of Zn-III-R3.

Detailed Description

In order that the invention may be more readily understood, reference will now be made to the following more particular description of the invention, examples of which are set forth below. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. These embodiments are provided so that this disclosure will be thorough and complete. It will be appreciated that the experimental procedures for the following examples, where specific conditions are not indicated, are generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. The various reagents used in the examples are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

A III-type deoxyribozyme mutant has the structural general formula: p1- (N)_x-P2-P2′-(N)_w-P1', a, b are positive integers, and (N)_wContains a cutting site, wherein the cutting site is between T/G;

wherein (N)_xContains at least one C, (N)_wThe sequence is selected from a sequence shown as SEQ ID NO. 14;

p1 is complementary paired with all or part of the nucleotide sequence of P1' to form subdomain 1;

p2 is complementary paired with all or part of the nucleotide sequence of P2' to form subdomain 2.

Preferably, said (N)_xIs selected from a sequence shown as SEQ ID NO. 16.

More preferably, said (N)_xIs selected from a sequence shown as SEQ ID NO.9 or a sequence shown as SEQ ID NO. 12.

Preferably, said (N)_wIs selected from the sequences shown in SEQ ID NO. 17.

More preferably, the formulaIn (N)_wIs selected from a sequence shown as SEQ ID NO.10 or a sequence shown as SEQ ID NO. 13.

In some of these embodiments, the dnazyme variants of the invention have the sequence: the sequence is shown as SEQ ID NO.15 or the sequence with homology of more than 75 percent with SEQ ID NO. 15. Preferably, the deoxyribozyme variant has a sequence homology of more than 80% with SEQ ID NO. 15. More preferably, the deoxyribozyme variant has a sequence homology of more than 85% with SEQ ID NO. 15. Further preferably, the deoxyribozyme variant has a sequence homology of more than 90% with SEQ ID NO. 15. For example: homology is greater than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.

Preferably, the P2 and the P2 'are complementary and paired in whole or in part to form a sub-domain 2, and a loop region with the length of 4-6nt is contained between the P2 and the P2'. Optionally, the loop region length is 4nt, 5nt, or 6 nt.

The in vitro screening method of the deoxyribozyme mutant comprises the following steps:

(1) two DNA single-strand libraries are constructed, primers are mutually used for performing polymerase chain reaction to obtain linear single-strand DNA: the sequences of the two single-stranded DNA libraries are shown as SEQ ID NO.1 and SEQ ID NO.2, and the complementary regions contained at the tail ends of the SEQ ID NO.1 and the SEQ ID NO. 2; and the end of SEQ ID NO.2 is modified by rC;

(2) carrying out a first cyclization reaction by taking the linear single-stranded DNA as a substrate;

(3) pre-screening, cyclization, PCR amplification and secondary cyclization; the primers for secondary cyclization are shown as SEQ ID NO.3 and SEQ ID NO. 4.

Preferably, the method further comprises the following steps: repeating the following steps a plurality of times after partial randomization of the bases of the product obtained in step (3) as defined in claim 15: the method comprises the following steps of first cyclization reaction, pre-screening, cyclization, PCR amplification and secondary cyclization.

More preferably, the prescreening is: separating and recovering the cyclized single-stranded DNA library by PAGE, adding piperidine and heating; separating and recovering through denaturing PAGE, and eluting at normal temperature; and/or

The screening is to denature circular DNA obtained by pre-screening in a buffer solution 1, place the circular DNA at room temperature, add a preheated buffer solution 2 with the same volume, incubate the circular DNA, and recover a linear DNA fragment subjected to cutting by denaturing PAGE; the components of the buffer solution 1 comprise HEPES and LiCl; the buffer solution 2 comprises the components of HEPES, LiCl and MgCl₂And ZnCl₂。

In the present invention, the definition of base symbols: n represents a random base, R represents purine and Y represents pyrimidine.

Different DNA molecules have, for evolutionary reasons, some commonality in that their nucleotide sequences have the same origin, as evidenced by the same or similar nucleotide residues at the corresponding sites. "homology" as referred to herein is defined as the percentage of candidate sequences that contain nucleotides that are identical to the nucleotides in the specified sequence. After aligning the sequences, any conservative substitutions are considered as part of the sequence identity.

Example 1 screening for repeated induction of Zinc ion cleavage

1.1 construction of DNA Single-stranded library

The end-hybridized structure is designed into the existing ssDNA library (Cur) (i.e., a complementary pairing region which can assist in ring formation is artificially designed at the end of the sequence), so that the linear DNA library can be more effectively connected into a ring by the CircLigase, and the effective enrichment of the hydrolytic cleavage sequence in the screening process is guaranteed (the ring formation efficiency of the existing library reaches 78%, which is far higher than the ring formation efficiency 32% when the ssDNA library with the end-hybridized structure is not artificially designed for screening, as shown in FIG. 1). A82 nt long single-stranded DNA library sequence was synthesized by Integrated DNA Technologies (IDT) of U.S.A., purified by 10% denaturing Polyacrylamide Gel Electrophoresis (page), and the target band was recovered by a fluorescence imager and a Gel cutter. Due to the technical and cost limitations, the yield of in vitro synthesis of single-stranded DNA exceeding 100bp is low, and the cost is high, so the invention utilizes the complementary regions (shown as SEQ ID NO.1 and SEQ ID NO.2) of 15nt at the tail ends of two single-stranded DNA libraries to mutually extend the complementary regions in Polymerase Chain Reaction (PCR) so as to establish a double-stranded DNA library (random bases are represented by N). As the end of the B library carries rC modification, after adding NaOH with the final concentration of 0.25mM and heating at 90 ℃ for 5min, the single-stranded DNA containing RNA modification can be broken to form two single strands with different lengths. Using 8% denaturing PAGE separation, a 149nt total length single-stranded DNA library containing two random sequences (50nt) was obtained.

And (3) PCR reaction system: (50. mu.l. times.15)

And (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 15s, followed by denaturation at 95 ℃ for 15s, annealing at 42 ℃ for 15s, and extension at 72 ℃ for 30s in each cycle, and 5 cycles were performed to ensure that all primer extension was complete; final extension at 72 ℃ for 2 min.

A2 library (SEQ ID NO. 1):

5′-pGTCCGTGCGCAGACCAA(N)₅₀ GACTGCATCACGAAG

b library (SEQ ID NO. 2):

5′-GCTCGTGCGCAGACAGC(N)₅₀ CTTCGTGATGCAGTrC

among these, the A2 library is complementary paired with the underlined sequence region of the B library, i.e., the end-hybridized structure.

First cyclization system:

reaction conditions are as follows: 60 ℃ for 5h

1.2 in vitro screening

In vitro screening, as shown in figure 2. The invention adopts an index enrichment ligand system evolution technology and is carried out by the steps of in vitro pre-screening, cyclization, PCR amplification, secondary cyclization and the like. Deep sequencing was performed after 6 rounds of selection. The specific screening steps are as follows:

1.2.1 Pre-screening

In order to remove abasic sites formed during the screening process, the deoxyribozymes with complete structures are screened, and a pre-screening process is added before the screening step. The circularized single-stranded DNA library was separated and recovered by 8% PAGE, and 50. mu.l of 0.1M piperidine was added thereto and heated at 80 ℃ for 30 minutes. Intact circular single-stranded DNA molecules were separated by 8% denaturing PAGE, cut and recovered, and eluted at room temperature for 3 h.

1.2.2 screening

The recovered circular DNA was denatured at 70 ℃ for 5min in 150. mu.l buffer1, left at room temperature for 5min, added to an equal volume of buffer 2, incubated at 37 ℃ for 1h, and the cleaved linear DNA fragments were recovered by 8% denaturing PAGE. (the subsequent screening system was 25. mu.l + 25. mu.l)

1.2.3 Secondary cyclization

Subjecting the linear DNA fragments obtained after the cleavage to secondary cyclization reaction, and recovering DNA molecules obtained by re-cyclization of linear single-stranded DNA

A secondary ring forming system:

reaction conditions are as follows: 2.5h at 60 ℃.

1.2.4 PCR amplification of DNA libraries

The recovered circular single-stranded DNA was used as a template and amplified by PCR in the following reaction system.

The primer sequence is as follows:

Primer A2(SEQ ID NO.3)：5＇-pGTCCGTGCGCAGACCAA

Primer B(SEQ ID NO.4)5′-GCTCGTGCGCAGACAGrC

and (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 3min, followed by denaturation at 95 ℃ for 20s, annealing at 54 ℃ for 20s, extension at 72 ℃ for 15s, and amplification for 30 cycles per cycle; final extension at 72 ℃ for 2 min.

Note: the reverse primer 3' modifies rC, and the PCR product can be treated by NaOH, so that the modified RNA strand is broken at the rC to form two single-stranded DNA strands with different lengths. The target single-stranded DNA (DNA strand without RNA modification) was subsequently purified by 8% denaturing PAGE separation. The circular single-stranded DNA library was constructed again and the previous screening process was repeated. In order to screen more kinds of dnazymes, no screening pressure is applied during the screening process (changing the screening conditions), and finally DNA fragments are isolated from G6 (sixth round of screening) library for deep sequencing. Two types of deoxyribozymes (III and IV) except the I type and II type enzymes, which induce the hydrolytic cleavage of zinc ions, are obtained and are named as Zn-III-R1(SEQ ID NO.5) and Zn-IV-R1.

2. Degeneration rescreening process

2.1 construction of degenerate libraries

The "degradation" treatment is carried out on the basis of Zn-III-R1: on the basis of designing a secondary structure which is beneficial to ring formation at the tail end, partial randomization is carried out on the bases of the underline part, the rest sequences are kept unchanged, namely 82% of each base of the underline part is still kept as the original base, and the rest 18% of the underline part accounts for 6% of the mixture ratio of the rest three base types. That is, at the time of synthesis, 82% of each site is synthesized according to the base shown in the sequence, such as: the first sequence in the underlined part is T, 82% of the sequence is T and A, C, G is 6% each (i.e., the remaining 18% is mixed with the remaining three base types. Synthesis requires the artificial doping of four deoxynucleotide solutions, the first one is 82% T, 6% A, 6% C, 6% G, the second one is 82% A, 6% T, 6% C, 6% G, the third one is 82% C, 6% T, 6% A, 6% G, the second one is 82% G, 6% T, 6% C, 6% A)

The sequence of class III inducible zinc ion hydrolytic cleavage deoxyribozyme (Zn-III-R1):

the sequence was synthesized by Shanghai Czeri, purified by 10% denaturing polyacrylamide gel electrophoresis (PAGE), and the target sequence was recovered using a fluorescence imager and a gel cutter.

First cyclization system:

reaction conditions are as follows: 60 ℃ for 5h

2.2 in vitro screening

The process is the same as the previous in vitro screening process, and the steps of pre-screening, cyclization, PCR amplification, secondary cyclization and the like are repeated. And (4) carrying out deep sequencing on the sequence screened in the 5 th round, and analyzing the conservative property of sequence evolution in the screening process. As shown in FIG. 3, the underlined, italicized, and bold labeled deoxynucleotides retain at least 75%, 90%, and 97%, respectively, of the conserved sequence, while the relatively non-conserved nucleotides are represented by circles. The shaded areas indicate that the base pairs can be co-varied, and R and Y represent purine and pyrimidine, respectively. The substructure of the base-complementary pair (P1& P2) has also been labeled. After 8 rounds of screening, cloning and sequencing are carried out to find out the deoxyribozyme mutant with higher cutting activity. The detailed sequence is shown in table 1. The specific screening steps comprise:

2.2.1 Pre-screening

In order to remove abasic sites formed during the screening process, the deoxyribozymes with complete structures are screened, and a pre-screening process is added before the screening step. The circularized single-stranded DNA library was separated and recovered by 10% PAGE, and 50. mu.l of 0.1M piperidine was added thereto and heated at 80 ℃ for 30 minutes. Intact circular single-stranded DNA molecules were separated by 10% denaturing PAGE, excised and recovered, and eluted at room temperature for 3 h.

2.2.2 screening

The recovered circular DNA was denatured at 70 ℃ for 5min in 150. mu.l buffer1, left at room temperature for 5min, added to an equal volume of buffer 2 preheated at 37 ℃ and incubated at 37 ℃ for 40min, and the cleaved linear DNA fragments were recovered by 10% denaturing PAGE. (the subsequent screening system was 25. mu.l + 25. mu.l)

2.2.3 Secondary cyclization

Subjecting the obtained linear DNA fragment to secondary cyclization reaction, and recovering DNA molecule formed by linear single-stranded DNA recyclization

A secondary ring forming system:

reaction conditions are as follows: 60 ℃ for 2.5h

2.2.4 PCR amplification of DNA libraries

The recovered circular single-stranded DNA was used as a template, and the enriched library was amplified by PCR reaction in the following reaction system.

In order to increase the sequence diversity of the degenerate library, more active deoxyribozymes were selected, and mutation PCR was introduced in rounds 6 and 7 of selection.

The mutation PCR reaction system is as follows:

the primer sequence is as follows:

primer-5' -pGACGTGCTAGCGCAG (SEQ ID NO.6) of class III deoxyribozyme degradation library

Primer 3' -AGGTGCCTAGCGCArG (SEQ ID NO.7) of class III deoxyribozyme degradation library

And (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 3min, followed by denaturation at 95 ℃ for 15s, annealing at 45 ℃ for 15s, extension at 72 ℃ for 15s, and amplification for 30 cycles per cycle; final extension at 72 ℃ for 2 min.

Mutation PCR reaction conditions: pre-denaturation at 95 deg.C for 3min, then denaturation at 95 deg.C for 1min, annealing at 45 deg.C for 1min, extension at 68 deg.C for 1min, and amplification for 30 cycles; final extension at 72 ℃ for 2 min.

Note: the reverse primer 3' modifies RNA, and the PCR product can be treated by NaOH, so that the modified RNA strands are broken at the RNA, and two DNA strands with different lengths are formed. The target single-stranded DNA (DNA strand without RNA modification) was then purified by 10% denaturing PAGE separation. The circular single-stranded DNA library was constructed again and the previous screening process was repeated. In the screening process, screening pressure is required to be continuously applied to obtain the deoxyribozyme mutant with higher activity. From G0 to G5, the time allowed for the deoxyribozyme reaction in the screening step was 40 minutes; decreasing the reaction time to 30 minutes in the G6 screen; in the screens of G7 and G8, the reaction time was finally reduced to 5 minutes; finally, DNA fragments are separated from a screening library of G8, and cloning and sequencing are carried out to obtain the mutants of the III type deoxyribozyme Zn-III-R2 and Zn-III-R3.

TABLE 1 summary of sequence analysis of Zn-III group deoxyribozymes

EXAMPLE 2 cleavage site testing

15pmol of the DNAzyme cleavage site test sequence was mixed with 200. mu.l of buffer 1(50mM HEPES, 100mM LiCl, pH 7.0), heated at 70 ℃ for 5min, left at room temperature for 5min, and added with an equal volume of buffer 2(50mM HEPES, 100mM LiCl, 10mM MgCl) preheated at 37 ℃₂，4mM ZnCl₂pH 7.0), mixed and reacted at 37 ℃ overnight. After ethanol precipitation, 20% denaturing polyacrylamide gel electrophoresis was performed and imaged with the aid of a photographic camera.

Cleavage site test sequence:

Zn-III-R1-61nt:GCGCAGACCAACGAATGTTTTCATTCGTTTTTATGGACTGATCATGCCCTGCTGTCTGCGC(SEQ ID NO.18)

the reference sequences are as follows:

Zn-III-R1-Marker1-40nt:GCGCAGACCAACGAATGTTTTCATTCGTTTTTATGGACTG(SEQ ID NO.19)

Zn-III-R1-Marker1-39nt:GCGCAGACCAACGAATGTTTTCATTCGTTTTTATGGACT(SEQ ID NO.20)

Zn-III-R1-Marker1-38nt:GCGCAGACCAACGAATGTTTTCATTCGTTTTTATGGAC(SEQ ID NO.21)

the position of the 5 'end cutting fragment generated after Zn-III-R1-61nt cutting is consistent with the SEQ ID NO.20 band position in the reference sequence, which indicates that the generated 5' end cutting fragment sequence is SEQ ID NO.20, and the Zn-III-R1-61n cutting site can be confirmed to be between T/G. The results are shown in FIG. 4.

And (3) utilizing an accurate mass spectrum to characterize the molecular weight of the cleavage mixture, and verifying the cleavage site and simultaneously proving the hydrolytic cleavage. In order not to exceed the range of molecular weight detection by accurate mass spectrometry, group III and group IV deoxyribozymes are separated along a base complementary pairing region (P1, P2), divided into a polymerase chain and a substrate chain, and the base complementary pairing region is shortened to 7 or 8 base pairs.

The mass spectrum sample sequence is as follows:

Zn-III-S-39nt:CATTCGTTTTTATGGACTGATCATGCCCTGCTGTCTGCG(SEQ ID NO.22)

Zn-III-E-16nt:CGCAGACCAACGAATG(SEQ ID NO.23)

a400. mu.l reaction system was charged with 40pmol (1: 1) of each of the enzyme chain and the substrate chain, reacted overnight at 37 ℃ and then ethanol-precipitated and dried to prepare a sample for accurate mass spectrometry. E, S in the figure correspond to the enzyme chain and the substrate chain of each type of deoxyribozyme respectively, the molecular weight corresponding to the mass spectrum peak of the 5 'cleavage product (5' clv) and the 3 'cleavage product (3' clv) is basically consistent with the theoretically calculated molecular weight, and the two types of deoxyribozymes are proved to be hydrolytic cleavage.

Example 3 kinetic testing

In order to accurately measure the kinetic parameters of the deoxyribozyme, FAM fluorescent group is modified at the 5' end of a deoxyribozyme substrate, and the cleavage condition of the deoxyribozyme is quantitatively characterized by a fluorescence detection method. In order to stabilize the enzyme chain and substrate chain to form the structure required for cleavage, the class III and IV deoxyribozymes and their mutant stem regions were extended (Zn-III-R1 Zn-IV-R1stem region was extended to 15bp, Zn-III-R2, Zn-III-R3, Zn-IV-R2, Zn-IV-R3stem region was extended to 20bp to test the kinetic parameters of the more active mutant at 50 ℃) and the corresponding enzyme chain and 5' fluorescently modified substrate chain were ordered from Shanghai Jieli.

Kinetic test sequence:

Zn-III-R1-E-31nt:CTGACATGCGCAGACCAACGAATGCTGGACC(SEQ ID NO.24)

Zn-III-R1-S-54nt:5'-FAM-GGTCCAGCATTCGTTTTTATGGACTGATCATGCCCTGCTGTCTGCGCATGTCAG(SEQ ID NO.25)

Zn-III-R2-E-41nt:CCGATCTGACCTAGCGCAGACTAACGACCGCTGGACTGGCA(SEQ ID NO.26)

Zn-III-R2-S-63nt:5-FAM-TGCCAGTCCAGCGGTCGTTGCTTTGGACAGATCATGCCTTGCTGCTGCGCTAGGTCAGATCGG(SEQ ID NO.27)

Zn-III-R3-E-42nt:CCGATCTGACCTAGCGCAGATCAACGACTGCCTGGACTGGCA(SEQ ID NO.28)

Zn-III-R3-S-64nt:5-FAM-TGCCAGTCCAGGCAGTCGTTCTTGTGGACGAATCATGCCCTGCTGCTGCGCTAGGTCAGATCGG(SEQ ID NO.29)

mu.l of the screening system was reacted at 37 ℃ with 30pmol of the enzyme chain and 10pmol of the substrate chain, and 8. mu.l of the reaction mixture was pipetted at a series of time points of 0s, 20s, 40s, 1min, 2min, 5min, 10min, 20min, 40min, 1h, mixed with 2 Xloading buffer and the substrate chain and cleavage products were separated by running 15% denaturing PAGE gel.

Imaging was performed with the aid of a multifunctional fluorescence analyzer and the gel bands were quantitatively analyzed. The efficiency of DNAzyme cleavage at each time point was determined by calculating the ratio of the 5' substrate cleavage fragment generated after cleavage to the total substrate fragment (substrate cleavage fragment generated after cleavage plus uncleaved full length substrate fragment). The reaction rate constant kobs can be calculated by the following formula: percent cut FCmax (1-e)^－kt) (where k kobs, FCmax maximum cut percentage). The results are shown in FIG. 5, where FIG. 5 shows Zn-III-R1, Zn, according to the inventionGraphs of the results of kinetic tests of-III-R2, Zn-III-R3, Zn-IV-R1, Zn-IV-R2, Zn-IV-R3. Images were plotted as a function of time based on percent cut at each time point and the rate constant of the reaction was calculated.

The mutants Zn-III-R3 and Zn-IV-R3 with the fastest cutting rate are selected, kinetic tests are respectively carried out under the reaction conditions of 30 ℃, 45 ℃ and 50 ℃, the cutting percentage and the rate constant of each time point are calculated, and the result is shown in figure 6.

Example 4 ion specificity detection and magnesium ion dependence test

Zn-III-R3 and Zn-IV-R3 were incubated with 2mM of other divalent ions for 20min, respectively, and their ion specificity of hydrolytic cleavage was analyzed. The dPAGE results are shown in FIG. 7, A. Comparing the cutting conditions that the reaction system only contains magnesium ions, only contains zinc ions and simultaneously contains magnesium ions and zinc ions. The image of the percentage cut as a function of time is shown as B in fig. 7.

Example 5pH dependence and Zinc ion concentration dependence test

A series of screening buffer1, 2 with pH gradient (pH 6.85, pH 6.95, pH 7.05, pH 7.15, pH 7.25, pH 7.35, pH 7.45, pH 7.55) were prepared and incubated with Zn-III-R3 and Zn-IV-R3, respectively, for 20 min. In FIG. 8, A is a 15% dPAGE gel plot of hydrolytic cleavage and a plot of percent cleavage as a function of pH.

The final concentration of zinc ions (0.1mM, 0.2mM, 0.5mM, 1mM, 2mM, 5mM, 10mM, 20mM) in the screening buffer was varied and incubated with Zn-III-R3 and Zn-IV-R3, respectively, for 20 min. In FIG. 8, B is a 15% dPAGE gel plot of its hydrolytic cleavage and a plot of the percent cleavage as a function of zinc ion concentration.

The technical features of the above embodiments can be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the above embodiments are not described, however, as long as there is no contradiction between the combinations of the technical features, the scope of the present description should be considered as being described in the present specification.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> affiliated tumor hospital of double-denier university

<120> III-class deoxyribozyme mutant and preparation method and application thereof

<160> 29

<170> SIPOSequenceListing 1.0

<210> 1

<211> 82

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gtccgtgcgc agaccaannn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60

nnnnnnngac tgcatcacga ag 82

<210> 3

<211> 82

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gctcgtgcgc agacagcnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60

nnnnnnnctt cgtgatgcag tc 82

<210> 3

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gtccgtgcgc agaccaa 17

<210> 4

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gctcgtgcgc agacagc 17

<210> 5

<211> 81

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gacgtgctag cgcagaccaa cgactgcttt tgcagtcgtt tttatggact gatcatgccc 60

tgctgtctgc gctaggcacc t 81

<210> 6

<211> 15

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gacgtgctag cgcag 15

<210> 7

<211> 15

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

aggtgcctag cgcag 15

<210> 8

<211> 68

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ctagcgcaga ctaacgactg cttttgcggt cgttgctttg gacagatcat gccttgctgc 60

tgcgctag 68

<210> 9

<211> 3

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

act 3

<210> 10

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gctttggaca gatcatgcct tgctg 25

<210> 11

<211> 68

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ctagcgcaga tcaacgactg cttttgcagt cgttcttgtg gacgaatcat gccctgctgc 60

tgcgctag 68

<210> 12

<211> 3

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

atc 3

<210> 13

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

cttgtggacg aatcatgccc tgctg 25

<210> 14

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

nytntggacn ratcrtgccy tg 22

<210> 15

<211> 68

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ctagcgcaga yyaacgactg cttttgcngt cgttnytntg gacrratcat gccctgctgc 60

tgcgctag 68

<210> 16

<211> 3

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ayy 3

<210> 17

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

nytntggacr ratcatgccc tgctg 25

<210> 18

<211> 61

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

gcgcagacca acgaatgttt tcattcgttt ttatggactg atcatgccct gctgtctgcg 60

c 61

<210> 19

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

gcgcagacca acgaatgttt tcattcgttt ttatggactg 40

<210> 20

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

gcgcagacca acgaatgttt tcattcgttt ttatggact 39

<210> 21

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

gcgcagacca acgaatgttt tcattcgttt ttatggac 38

<210> 22

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

cattcgtttt tatggactga tcatgccctg ctgtctgcg 39

<210> 23

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

cgcagaccaa cgaatg 16

<210> 24

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

ctgacatgcg cagaccaacg aatgctggac c 31

<210> 25

<211> 54

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

ggtccagcat tcgtttttat ggactgatca tgccctgctg tctgcgcatg tcag 54

<210> 26

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

ccgatctgac ctagcgcaga ctaacgaccg ctggactggc a 41

<210> 27

<211> 63

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

tgccagtcca gcggtcgttg ctttggacag atcatgcctt gctgctgcgc taggtcagat 60

cgg 63

<210> 28

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

ccgatctgac ctagcgcaga tcaacgactg cctggactgg ca 42

<210> 29

<211> 64

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

tgccagtcca ggcagtcgtt cttgtggacg aatcatgccc tgctgctgcg ctaggtcaga 60

tcgg 64

Claims (10)

1. A III-type deoxyribozyme mutant is characterized in that the structural general formula is as follows: p1- (N)_x-P2-P2′-(N)_w-P1', x, w being positive integers, and (N)_wContains a cutting site, wherein the cutting site is between T/G;

wherein (N)_xContains at least one C, (N)_wThe sequence is selected from a sequence shown as SEQ ID NO. 14;

p1 is complementary paired with all or part of the nucleotide sequence of P1' to form subdomain 1;

p2 is complementary paired with all or part of the nucleotide sequence of P2' to form subdomain 2.

2.The mutant deoxyribozyme of class III according to claim 1, wherein the nucleotide sequence of (N)_xIs selected from a sequence shown as SEQ ID NO. 16.

3. The mutant deoxyribozyme of class III according to claim 2, wherein the nucleotide sequence of (N)_xIs selected from a sequence shown as SEQ ID NO.9 or a sequence shown as SEQ ID NO. 12.

4. The mutant deoxyribozyme of class III according to any of claims 1 to 3, wherein (N)_wIs selected from the sequences shown in SEQ ID NO. 17.

5. The mutant deoxyribozyme of class III according to claim 4, wherein the nucleotide sequence of (N)_wIs selected from a sequence shown as SEQ ID NO.10 or a sequence shown as SEQ ID NO. 13.

6. The DNAzyme III mutant according to any one of claims 1-3 and 5, wherein the P2 and the nucleotide sequence of P2 'are in complete or partial complementary pairing to form subdomain 2, and a loop region with the length of 4-6nt is contained between P2 and P2'.

7. Use of the mutant DNAzyme III according to any one of claims 1 to 6 for cleaving long single-stranded DNA.

8. The method for screening a mutant group III deoxyribozyme of any one of claims 1 to 6 in vitro, which comprises the steps of:

(1) two DNA single-strand libraries are constructed, primers are mutually used for performing polymerase chain reaction to obtain linear single-strand DNA: the sequences of the two single-stranded DNA libraries are shown as SEQ ID NO.1 and SEQ ID NO.2, and the complementary regions contained at the tail ends of the SEQ ID NO.1 and the SEQ ID NO. 2; and the end of SEQ ID NO.2 is modified by rC;

(2) carrying out a first cyclization reaction by taking the linear single-stranded DNA as a substrate;

(3) pre-screening, cyclization, PCR amplification and secondary cyclization; the primers for secondary cyclization are shown as SEQ ID NO.3 and SEQ ID NO. 4.

9. The method for screening mutant class III deoxyribozymes in vitro according to claim 8, further comprising the steps of: repeating the following steps a plurality of times after partial randomization of the bases of the product obtained in step (3) as defined in claim 15: the method comprises the following steps of first cyclization reaction, pre-screening, cyclization, PCR amplification and secondary cyclization.

10. The method for screening mutants of the group III deoxyribozyme according to claim 8 or 9, wherein the prescreening is: separating and recovering the cyclized single-stranded DNA library by PAGE, adding piperidine and heating; separating and recovering through denaturing PAGE, and eluting at normal temperature; and/or

The screening is to denature circular DNA obtained by pre-screening in a buffer solution 1, place the circular DNA at room temperature, add a preheated buffer solution 2 with the same volume, incubate the circular DNA, and recover a linear DNA fragment subjected to cutting by denaturing PAGE; the components of the buffer solution 1 comprise HEPES and LiCl; the buffer solution 2 comprises the components of HEPES, LiCl and MgCl₂And ZnCl₂。

Images