CN113046330B - Lentivirus and medicine carrying erythroid gene editing system - Google Patents
Lentivirus and medicine carrying erythroid gene editing system Download PDFInfo
- Publication number
- CN113046330B CN113046330B CN202110310395.5A CN202110310395A CN113046330B CN 113046330 B CN113046330 B CN 113046330B CN 202110310395 A CN202110310395 A CN 202110310395A CN 113046330 B CN113046330 B CN 113046330B
- Authority
- CN
- China
- Prior art keywords
- crispr
- phbb
- plasmid
- plenti
- gene editing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
- A61K48/0058—Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/06—Antianaemics
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0647—Haematopoietic stem cells; Uncommitted or multipotent progenitors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15021—Viruses as such, e.g. new isolates, mutants or their genomic sequences
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention relates to a lentivirus carrying an erythroid gene editing system, which carries a sequence of a CRISPR-Cas9 gene editing system specifically targeting a BCL11A enhancer. The CRISPR-Cas9 gene editing system specifically targeting the BCL11A enhancer is delivered into hematopoietic stem cells through a lentiviral vector, BCL11A is targeted and inhibited, and gamma-globin expression is reactivated, so that beta-thalassemia is relieved or cured. Compared with the electroporation method which is commonly adopted at home and abroad, the method has the characteristics of strong infection capacity, simple operation, high efficiency and high safety.
Description
Technical Field
The invention relates to the field of genetic engineering, in particular to a lentivirus carrying a erythroid gene editing system and a medicament.
Background
Thalassemia and sickle cell anemia are disorders of hemoglobin production due to globin monogene mutations. The thalassemia is a monogenic genetic disease which is most widely distributed and affects people in the world, is also a genetic disease with the largest influence and the highest incidence in China, and is about 3000 million thalassemia gene carriers only in China, but is common in the northern China, but is common in the Guangdong, guangxi, sichuan and the like. Sickle cell anemia has a very low incidence rate in China, but has a very high incidence rate in Africa, because people carrying sickle cell anemia gene mutation are not easy to be infected with malaria and are not easy to be infected with AIDS, while Africa is the area with the highest incidence rate of malaria and AIDS, sickle cell anemia patients have survival advantages in Africa, and thus the sickle cell anemia patients are reserved.
Thalassemia is a wide variety of, with beta-thalassemia being the most common, most severe type. Beta-thalassemia is one of the most common monogenic autosomal recessive inherited diseases in the world, and is high in the mediterranean region (5-15%), the middle east and west asia (2-5%), southeast asia (up to 10%) and south asia (up to 18%). In China, high-hair areas are mainly distributed in the south provinces of the Yangtze river, and the two regions are the most serious. Currently, up to 20 million patients with beta-thalassemia are currently undergoing treatment worldwide. Beta-thalassemia is mainly caused by the fact that beta-globin chain synthesis is reduced or synthesis is obstructed due to the gene defect of beta-globin gene and regulatory sequences thereof, and further alpha/beta-globin proportion is disordered. The relative excess of alpha-globin is deposited in erythrocytes to form inclusion bodies, which lead to a dyserythropoiesis. Clinically, patients with beta-thalassemia often develop severe hemolytic anemia due to massive ineffective erythropoiesis and erythrocyte membrane disruption.
Transfusion therapy is the current routine scheme for clinically relieving severe thalassemia symptoms, but long-term mass transfusion can aggravate iron ion deposition of patients, and finally death of organs due to exhaustion caused by iron overload. To prevent the risk associated with iron overload, patients must adhere to a concurrent iron chelation treatment regimen. However, treatment compliance remains a critical challenge, and even with current transfusion therapy, patients have an overall survival rate of only around 55% before the age of 30.
Currently, the only curative treatment for severe beta-thalassemia is allogeneic bone marrow transplantation. Allogenic bone marrow transplantation presents some significant risks, however, such as infection during transplantation, graft failure, and graft versus host disease (GvHD), some of which are even fatal. There is therefore a need to find Human Leukocyte Antigen (HLA) -matched, young (< 16 years old), sibling donor donors without significant iron overload to avoid as much as possible the above risks. However, due to limited availability and high cost of suitable donors, most patients are difficult to get timely treatment. Therefore, autologous hematopoietic stem cell transplantation based on gene therapy is currently becoming a new hope for a "one-stop" cure of beta-thalassemia, with the greatest advantages that bone marrow donation and allograft transplantation are not required, and one treatment may produce a permanent "cure" effect, hopefully replacing the current imperfect treatment regimen.
Beta-thalassemia is caused by mutation of beta-globin gene, and the previous research shows that gamma-globin has similar function to beta-globin, and gamma-globin is silent and no longer expressed after human adult. Therefore, if the expression of the gamma-globin gene can be reactivated, the deletion of beta-globin can be compensated, so that the beta-thalassemia can be relieved or cured. BCL11A is a transcription factor that inhibits gamma-globin and fetal hemoglobin expression in erythroid cells. Thus, targeted inhibition of BCL11A could theoretically reactivate γ -globin expression, thereby treating β -thalassemia.
Foreign research teams obtained CD34+ hematopoietic stem and progenitor cells from patients, then introduced the CRISPR-Cas9 gene editing system specifically targeting the BCL11A enhancer by electroporation, and then transfused autologous CD34+ cells that edited the BCL11A enhancer via CRISPR-Cas 9. Based on this, in 2018, CTX001 of crispatherapeutics and VertexPharmaceuticals obtained a new drug research application lot of the U.S. and european regulatory agencies, which is also the first new drug clinical trial for in vitro CRISPR therapy initiated by pharmaceutical companies worldwide. In 22 months 7 in 2020, china, shanghai Bangyao Biotechnology Co., ltd announces that clinical tests of ' clinical research on safety and effectiveness of treatment of severe beta-thalassemia by gamma-globin reactivated autologous hematopoietic stem cell transplantation ' carried out by the cooperation of Banghai biology and Hunan university Hunan ya Hospital ' have achieved preliminary results. The gene editing technology is used for treating thalassemia for the first time in Asia, and is also a successful case for treating severe thalassemia of beta 0/beta 0 type for the first time in the world through the CRISPR gene editing technology. In 2021, 18 months, boya edi announced that the medicine evaluation center of the national medicine supervision administration of China has approved the clinical test application of a CRISPR/Cas9 gene editing therapy product ET-01 for transfusion-dependent beta thalassemia, which is the first gene editing therapy product and hematopoietic stem cell product approved by the national medicine supervision agency in China to carry out clinical tests.
However, at present, electroporation is widely used at home and abroad to introduce an editing system for editing the BCL11A enhancer into hematopoietic stem cells, which is complicated in operation, low in efficiency and poor in safety.
Disclosure of Invention
Technical problem to be solved
In view of the problems of the prior art, the invention provides a lentivirus carrying an erythroid gene editing system, provides a CRISPR-Cas9 gene editing system carrying a specific targeting BCL11A enhancer by using a lentivirus vector, delivers the CRISPR-Cas9 gene editing system of the BCL11A enhancer into hematopoietic stem cells by a method of infecting the hematopoietic stem cells by the lentivirus, and has the characteristics of simple operation, high transformation efficiency and high safety.
Further, the CRISPR-Cas9 gene editing system of the specific targeting BCL11A enhancer adopts a promoter of a beta-globin gene to drive the expression of the Cas9 gene so as to improve the specificity of the erythroid gene editing.
(II) technical scheme
In order to achieve the purpose, the invention adopts the main technical scheme that:
in a first aspect, the invention provides a lentivirus carrying an erythroid gene editing system, comprising a lentivirus carrying a sequence of a CRISPR-Cas9 gene editing system that specifically targets the BCL11A enhancer.
Preferably, the promoter used for regulating the expression of the Cas9 protein in the sequence of the CRISPR-Cas9 gene editing system of the specific targeting BCL11A enhancer is the promoter pHBB of erythroid specific beta-globin (shown as SEE ID NO: 1).
Preferably, the features of the lentiviral vector genomic sequence include a plasmid expressing the membrane protein vsv.g (pmd 2.g), a packaging helper plasmid expressing gag-pol (psPAX 2), and a plasmid expressing the erythroid-specific editing system.
In a second aspect, the present invention provides a plasmid for gene editing, the plasmid being: the original promoter EF-1 alpha corepromoter in pLenti-CRISPR-V2 (addge, # 78852) is replaced by the red line specific beta-globin promoter pHBB, and then the oligonucleotide sequence H58-Enhancer2 clone for targeting the BCL11A Enhancer is cloned.
Preferably, the genomic sequence of the plasmid for gene editing comprises: a promoter pHBB of erythroid specific beta-globin, a CRISPR-Cas9 sequence for expressing nuclease and an oligonucleotide sequence H58-Enhancer2 for expressing gRNA specifically targeting a BCL11A Enhancer.
In a third aspect, the present invention provides a method for constructing a plasmid for gene editing, comprising:
s1, replacing an original promoter EF-1 alpha corepromoter in pLenti-CRISPR-V2 (adddge, # 78852) with a promoter pHBB of erythroid specific beta-globin to obtain a pLenti-pHBB-CRISPR-V2 plasmid vector;
s2, cloning the oligonucleotide sequence H58-Enhancer2 for targeting the BCL11A Enhancer into a pLenti-pHBB-CRISPR-V2 plasmid vector to obtain a plasmid pLenti-pHBB-CRISPR-V2-H58-Enhancer2 for gene editing.
Preferably, S1 comprises:
s11, artificially synthesizing a promoter pHBB (SEQ ID NO: 1) of the red-line specific beta-globin, putting the sequence on a universal vector pUC57 (addgene, # 49822) after the synthesis is finished, and introducing enzyme cutting sites EcoRI and XbaI into the vector to obtain a vector pUC57-pHBB;
s12, carrying out double digestion on the pLenti-CRISPR-V2 plasmid and pUC57-pHBB respectively by using restriction endonucleases EcoRI and XbaI, carrying out agarose electrophoresis after double digestion, and then cutting gel and recycling to obtain a pLenti-CRISPR-V2 vector fragment and a pHBB fragment;
s13, connecting the pLenti-CRISPR-V2 vector fragment with the pHBB fragment by adopting ligase;
s14, transforming the ligation product into competence Trans1T1, uniformly mixing, carrying out ice bath, carrying out heat shock, immediately carrying out ice bath, culturing by using a liquid culture medium without antibiotics, then transferring to an agar plate containing ampicillin for continuous culture, then selecting a monoclonal colony to inoculate in a liquid culture medium containing ampicillin for shake culture, extracting plasmid, carrying out double-enzyme digestion identification, then carrying out sequencing identification, and successfully constructing the pLenti-pHBB-CRISPR-V2 plasmid vector.
Preferably, S2 comprises:
s21, annealing an oligonucleotide sequence H58-Enhancer2 (caccgatcaggccaaaaccttcc, aaacggaaagggttggcctctgatc) for positioning a BCL11A Enhancer, and denaturing at 95-98 ℃ for 5-10min to obtain H58-Enhancer2-Oligo;
s22, carrying out single enzyme digestion on the pLenti-pHBB-CRISPR-V2 plasmid vector obtained in the step S1 by using a restriction enzyme Esp3I, carrying out agarose electrophoresis, and then cutting gel and recycling to obtain a pLenti-pHBB-CRISPR-V2 vector fragment
S23, connecting the pLenti-pHBB-CRISPR-V2 vector fragment with the H58-Enhancer2-Oligo fragment by using ligase;
s24, transforming the ligation product into competent Trans1T1, uniformly mixing, performing ice bath, performing heat shock, immediately performing ice bath, culturing by using a liquid culture medium without antibiotics, then transferring to an agar plate containing ampicillin for continuous culture, then selecting a monoclonal colony to inoculate in a liquid culture medium containing ampicillin for shake culture, extracting plasmids, performing sequencing identification, and successfully constructing the pLenti-pHBB-CRISPR-V2-H58-Enhancer2 plasmid vector.
In a fourth aspect, the present invention provides a method for preparing a lentivirus carrying erythroid gene editing system, comprising:
step 1: co-transfecting a plasmid for expressing membrane protein, a packaging plasmid and a plasmid pLenti-pHBB-CRISPR-V2-H58-Enhancer2 for gene editing to a virus production cell;
the genome sequence of the plasmid pLenti-pHBB-CRISPR-V2-H58-Enhancer2 for gene editing comprises: a promoter pHBB of the erythroid specific beta-globin, a CRISPR-Cas9 sequence for expressing nuclease and an oligonucleotide sequence H58-Enhancer for expressing gRNA of the specific targeting BCL11A Enhancer, or the gene sequence is constructed according to the plasmid construction method;
step 2: and collecting the supernatant containing the virus particles, and purifying by chromatography to obtain the lentivirus of the CRISPR-Cas9 gene editing system for delivering the specific targeting BCL11A enhancer.
Preferably, in step 1, the virus-producing cell is 293T, 293FT or HEK293.
In a fifth aspect, the present invention relates to the use of a lentivirus according to any of the above embodiments in the delivery of a CRISPR-Cas9 system for effecting gene editing or base editing.
In a sixth aspect, the invention provides a method of gene editing ex vivo hematopoietic stem cells by infecting hematopoietic stem cells with a lentivirus as described in any of the embodiments above and delivering into the hematopoietic stem cells a CRISPR-Cas9 gene editing system that specifically targets the BCL11A enhancer to excise the BCL11A enhancer.
(III) advantageous effects
The invention has the technical effects that:
packaging a CRISPR-Cas9 gene editing system specifically targeting a BCL11A enhancer into lentivirus particles to obtain lentivirus capable of specifically editing the BCL11A enhancer, infecting CD34+ hematopoietic stem cells by using the lentivirus, delivering the CRISPR-Cas9 gene editing system specifically editing the BCL11A enhancer into the hematopoietic stem cells, and then returning the hematopoietic stem cells back, wherein Cas9 protein of the CRISPR-Cas9 gene editing system is expressed in the hematopoietic stem cells, so that the BCL11A enhancer of the hematopoietic stem cells is edited (cut off), thereby inhibiting BCL11A in a targeted manner, further reactivating gamma-globin expression and relieving or curing beta-thalassemia.
Compared with the electroporation method which is commonly adopted at home and abroad, the method has the characteristics of strong infection capacity, simple operation, high efficiency and high safety. In addition, the CRISPR-Cas9 gene editing system utilizes a promoter pHBB of a beta-globin gene to drive the expression of the Cas9 gene, and the specificity of the gene editing red line is greatly improved.
Drawings
FIGS. 1 (a) - (c) are sequentially RP-HPLC detection results of hemoglobin of normal erythrocytes, blank human cord blood CD34+ cell in vitro differentiation, and human cord blood CD34+ cell in vitro differentiation infected with lentivirus carrying pLenti-pHBB-CRISPR-V2-H58-Enhancer2 (H58-E2).
Detailed Description
For the purpose of better explaining the present invention and to facilitate understanding, the present invention will be described in detail by way of specific embodiments with reference to the accompanying drawings.
In order to prepare the lentivirus carrying the CRISPR-Cas9 gene editing system of the specificity targeting BCL11A enhancer, a plasmid vector for realizing related functions is constructed firstly, then the plasmid vector, an envelope protein plasmid and a packaging plasmid are co-transfected into a virus production cell (such as 293T, 293FT or HEK 293) and then the supernatant is separated after transfection and purified by chromatography, so that the lentivirus of the CRISPR-Cas9 gene editing system for delivering the specificity targeting BCL11A enhancer is obtained. The invention provides a specific implementation method which comprises the following steps:
1. plasmid construction
(1) Construction of pLenti-pHBB-CRISPR-V2-H58-Enhacer2 plasmid vector:
the original promoter EF-1 alpha corepromoter in pLenti-CRISPR-V2 (addrene, # 78852) is replaced by the promoter pHBB of the red line specific beta-globin to obtain the pLenti-pHBB-CRISPR-V2 plasmid vector, and the method comprises the following steps:
(1) the red-line specific beta-globin promoter pHBB (SEQ ID NO: 1) was synthesized artificially, and after completion of the synthesis, the sequence was placed in the universal vector pUC57 (addgene, # 49822) and the restriction sites EcoR I and XbaI were introduced. The vector delivered by Sequence synthesizer was pUC57-pHBB (Shanghai Biotech).
(2) The pLenti-CRISPR-V2 plasmid and pUC57-pHBB were digested simultaneously with restriction enzymes EcoRI and XbaI, respectively, and digested at 37 ℃ for 1 hour.
(3) After double digestion, agarose electrophoresis is carried out, and then gel cutting and recovery are carried out to obtain a pLenti-CRISPR-V2 vector fragment and a pHBB fragment.
(4) The pLenti-CRISPR-V2 vector fragment and the pHBB fragment were ligated with a ligase. A connection system: 4 mu L of pLenti-CRISPR-V2 vector fragment; 4 μ L of pHBB fragment; 1. Mu.L of T4 DNA ligase and 1. Mu.L of T4 DNA ligase buffer. Ligation was carried out at 16 ℃ for 12h.
(5) Taking 5ul of the ligation product, converting the competent Trans1T1, gently mixing the contents uniformly, and carrying out ice bath for 30min; heat shock at 42 ℃ for 90s; immediately ice-bathing for 3min, adding 800ul LB culture solution without antibiotic, shaking at 37 deg.C for 60min, uniformly spreading the bacterial solution on the whole LB agar plate containing ampicillin with a sterile glass spreader, and culturing for 12-16h at 37 deg.C in an inverted manner. The single colony was inoculated in 4ml of LB liquid medium containing ampicillin, and shaken at 37 ℃ for 16 hours. And extracting plasmids by using the plasmid miniprep kit, performing double enzyme digestion identification on EcoRI and XbaI, and performing sequencing identification to successfully construct a pLenti-pHBB-CRISPR-V2 plasmid vector.
(2) Cloning an oligonucleotide sequence H58-Enhancer2 for targeting a BCL11A Enhancer into a pLenti-pHBB-CRISPR-V2 plasmid vector to obtain pLenti-pHBB-CRISPR-V2-H58-Enhancer2, wherein the specific method comprises the following steps:
(1) annealing the oligonucleotide sequence H58-Enhancer2 (caccgatcaggccaaaaccttcc, aaacggaaggtttggcccttgatc) and carrying out water bath at 98 ℃ for 5 minutes to obtain the H58-Enhancer2-Oligo fragment.
(2) The pLenti-pHBB-CRISPR-V2 plasmid vector is subjected to single enzyme digestion by using a restriction enzyme Esp 3I.
(3) After single enzyme digestion, agarose electrophoresis is carried out, and then gel cutting and recovery are carried out to obtain the pLenti-pHBB-CRISPR-V2 vector fragment.
(4) And connecting the pLenti-pHBB-CRISPR-V2 vector fragment with the H58-Enhancer2 fragment by adopting ligase. A connection system: 4 mu L of pLenti-pHBB-CRISPR-V2 vector fragment;
4 mu L of H58-Enhancer2-Oligo oligonucleotide sequence fragment; 1. Mu.L of T4 DNA ligase and 1. Mu.L of T4 DNA ligase buffer. Ligation was carried out at 16 ℃ for 12h.
(5) Transforming the ligation product into competence Trans1T1, gently mixing the contents uniformly, and carrying out ice bath for 30min; heat shock at 42 ℃ for 90s; immediately ice-bathing for 3min, adding 800ul LB culture solution without antibiotic, shaking at 37 deg.C for 60min, uniformly spreading the bacterial solution on the whole LB agar plate containing ampicillin with a sterile glass spreader, and culturing for 12-16h at 37 deg.C in an inverted manner. The single colony was inoculated in 4ml of LB liquid medium containing ampicillin, and shaken at 37 ℃ for 16 hours. And (3) extracting plasmids, and then carrying out sequencing identification to successfully construct a pLenti-pHBB-CRISPR-V2-H58-Enhancer2 plasmid vector.
2. Production and purification of lentivirus medicine
pLenti-pHBB-CRISPR-V2-H58-Enhancer2, envelope protein plasmid pMD2.G (purchased from Addgene, with the commercial number of Addgene plasmid # 12259) and packaging plasmid psPAX2 (purchased from Addgene, with the commercial number of Addgene plasmid # 12260) were inoculated to 293T cells of a 10-layer cell factory one day before cotransfection, fresh DMEM medium was replaced 6 hours after the cotransfection, and the supernatant was collected for chromatographic purification 72 hours later.
The transfection conditions and process conditions were: cells 1.00E +09293T were seeded 24 hours before transfection in a 10-layered cell factory. The prepared transfection system contains 80ml of opti-MEM culture medium, 750ug of Lenti-pHBB-CRISPR-V2-H58-Enhancer2 plasmid, 500ug of psPAX2 plasmid, 250ug of pMD2.G plasmid and transfection reagent. The transfection system was added to a 10-layer cell factory and gently mixed. Fresh DMEM 1000ml was replaced 6 hours after transfection. Cells were cultured further and medium (containing lentivirus) was harvested 72 hours after transfection.
The purification adopts an AKTA avant chromatographic system of GE, adopts DEAE chromatography, tangential flow filtration and core700 chromatography purification processes, and obtains the lentivirus by purification, and the specific purification process is as follows:
(1) MF (clarification) the virus harvest was filtered (0.45 μm) to remove insoluble particles such as 293T cells and debris, and to improve the clarity of the solution for subsequent chromatographic purification.
(2) Benzonase treatment (nuclease digestion): after treatment with 25U/ml Benzonase at 37 ℃ for 1 hour, the residual plasmid DNA from the transfection process and the released genome from the dead cells were removed by more than 85%. The clear solution of the first step may be concentrated and then subjected to the present step, whereby the cost of use of digestive enzymes can be reduced and the nucleic acid removal rate can be further improved.
(3) IEX (anion exchange chromatography): the anion exchange chromatography is carried out by adopting an integral column CIM DEAE, 99 percent of protein and DNA pollutants can be removed by the step, the virus yield is as high as more than 80 percent, and higher loading capacity can be kept at high flow rate.
(4) UF/DF (concentrate change): concentrating and replacing the eluate of IEX chromatography, and purifying by molecular exclusion chromatography. Due to the large size of the lentivirus particles, about 80-120nm in diameter, a 500kDa cut-off membrane is required for TFF (phase cut flow filtration). In the process of concentrating and replacing liquid, some small molecular impurities can be effectively removed, thereby achieving the purpose of purification.
(5) SEC (size exclusion chromatography): the Core700 chromatography packing is adopted to discharge the particles such as virus with the molecular weight of more than 700kDa through the volume of external water, and impurities with smaller molecular weight enter pores of the packing and are adsorbed in the pores, so that the loading quantity is large, and the impurity removal capacity is good. The yield of the step can reach 40%.
(6) Storage (Storage): and filtering the SEC purified solution by adopting a 0.2um membrane, subpackaging and storing at-80 ℃. Since the infectious capacity of lentiviruses is greatly reduced during repeated freeze-thawing, they are preserved in DMEM medium or 1mg/ml BSA, providing protection during the freeze-thawing process.
3. The validity verification process of the CRISPR-Cas9 gene editing system for delivering the BCL11A enhancer by lentivirus by taking an in-vitro induction cord blood CD34+ stem cell to erythrocyte differentiation system as a model is as follows: a lentivirus carrying pLenti-pHBB-CRISPR-V2-H58-Enhancer2 (H58-E2) (lentivirus prepared and purified in the second step above) was infected with human CD34+ cord blood stem cells. Differentiation is carried out after infection, induction culture is carried out for 21 days, and the expression condition of gamma-globin is detected. The experimental method is as follows:
(1) Reviving cells
(1) Human cord blood CD34+ hematopoietic stem cells frozen in liquid nitrogen are placed in a water bath at 42 ℃ for fast re-melting, the cell freezing tube is gently shaken while re-melting, and re-melting is completed within 2 min.
(2) And (3) disinfecting the cryopreserved tube with alcohol, sucking the cryopreserved cells into a 15ml centrifuge tube, cleaning the cryopreserved tube with 3ml of preheated DPBS, and combining the cleaning solution into the centrifuge tube.
(3) Cells were harvested by centrifugation at 400g for 10min at room temperature, the supernatant was discarded and 1ml of pre-warmed HSC1 medium was used to resuspend the cells.
(4) 20 μ l of the cell suspension was taken and the cells were counted after trypan blue staining.
(5) Cells were plated on appropriate cell culture plates according to cell number, and day zero (D0) was noted.
(2) In vitro differentiation of cord blood stem cells
(1) D0 revives 1 x 10^6 human cord blood CD34+ cells, and cultures in hematopoietic stem cell culture medium (Gibco).
(2) D1 (day 1) 2.0X 10^5 human cord blood CD34+ cells were taken, placed in serum-free and plasma-free hematopoietic stem cell medium and infected with lentivirus carrying pLenti-pHBB-CRISPR-V2-H58-Enhancer2 (H58-E2) for 1 day (hereinafter referred to as drug-treated group (H58-E2)). Meanwhile, another 2.0 x 10^5 human cord blood CD34+ cells are placed in hematopoietic stem cell culture medium for induction for 7 days as Blank negative control (Blank).
(3) D2 (day 2) was cultured for 6 days with replacement of fresh complete hematopoietic stem cell medium.
(4) D8 (day 8) was cultured for 3 days with an incomplete hematopoietic stem cell medium (without interleukin 3).
(5) D11 (day 11) the incomplete hematopoietic stem cell culture medium (without interleukin 3 and stem cell factor) was replaced and induction culture was continued for 4 days.
(6) D15 (day 15) the culture was changed to incomplete hematopoietic stem cell medium (without interleukin 3, stem cell factor and erythropoietin) for 6 days until the erythrocytes differentiated and matured.
(7) D21 (day 21), collecting cells, lysing to extract hemoglobin, and detecting gamma-globin expression by reverse phase high performance liquid chromatography (RP-HPLC). Normal red blood cells were used as positive control.
The HPLC result analysis is shown in FIGS. 1 (a) - (c), and the area under the peak results are shown in Table 1 below. Wherein FIG. 1 (a) is the result of normal red blood cell (RP-HPLC) detection; FIG. 1 (b) shows the result of detection (RP-HPLC) of Blank control (Blank) red blood cells; FIG. 1 (c) shows the results of (RP-HPLC) detection of lentivirus-infected erythrocytes.
Table 1: HPLC detection of area under various peaks
From the above table, it can be seen that:
carrying out differentiation culture on human cord blood CD34+ infected by lentivirus carrying pLenti-pHBB-CRISPR-V2-H58-Enhancer2 (H58-E2) for 21 days in vitro, realizing normal expression of hemoglobin by a Blank control group (Blank) and a drug treatment group (H58-E2), and ensuring that the ratio of beta-like globin (beta to gamma-globin) to alpha-globin expression (HPLC peak area below) is approximately 1 (1.028 and 0.970) and is consistent with the ratio of beta/alpha-globin of normal human red blood cells. See table (γ G + A + β)/α above.
The ratio of γ -globin to β -globin in the Blank control group (Blank) β -like globin was 0.408, while the ratio of γ -globin to β -globin in the drug treated group (H58-E2) was 0.583. Compared with the ratio of gamma/beta of Blank group ((Treat gamma/beta-Blank gamma/beta)/Blank gamma/beta), the ratio of gamma/beta of the drug treatment group (H58-E2) is increased by 42.7 percent, so that the expression level of gamma-globin of human cord blood CD34+ can be obviously improved by the lentiviral vector gene drug, and the effect of treating the beta-thalassemia of a patient is achieved.
The above experimental results prove that:
after the lentivirus carrying the pLenti-pHBB-CRISPR-V2-H58-Enhancer2 (H58-E2) prepared by the invention infects CD34+ hematopoietic stem cells, the lentivirus is transfused back into a patient body, the CD34+ hematopoietic stem cells are differentiated to erythrocytes, and a CRISPR-Cas9 gene editing system of a peculiar BCL11A Enhancer of an erythroid activates the expression of gamma-globin, so that the effect of treating the beta-thalassemia of the patient can be achieved; the prepared lentivirus can be used as a gene therapy medicament for beta-thalassemia.
Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.
Sequence listing
<110> Zhongji Zhi medicine (Nanjing) Biotech Co., ltd
<120> Lentivirus and drug carrying erythroid gene editing system
<130> EJS210207I
<141> 2021-03-18
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 319
<212> DNA
<213> Artificial Sequence
<400> 1
tacgtaaata cacttgcaaa ggaggatgtt tttagtagca atttgtactg atggtatggg 60
gccaagagat atatcttaga gggagggctg agggtttgaa gtccaactcc taagccagtg 120
ccagaagagc caaggacagg tacggctgtc atcacttaga cctcaccctg tggagccaca 180
ccctagggtt ggccaatcta ctcccaggag cagggagggc aggagccagg gctgggcata 240
aaagtcaggg cagagccatc tattgcttac atttgcttct gacacaactg tgttcactag 300
caacctcaaa cagacacca 319
Claims (8)
1. A lentivirus carrying a erythroid gene editing system, wherein the genome sequence of the lentivirus comprises a plasmid pmd2.G expressing a membrane protein vsv. G, a packaging helper plasmid psPAX2 expressing gag-pol, and a plasmid expressing an erythroid specific editing system;
the lentivirus carries a sequence of a CRISPR-Cas9 gene editing system specifically targeting the BCL11A enhancer; wherein the promoter for regulating the expression of the Cas9 protein is a promoter pHBB of erythroid specific beta-globin, and the sequence of the promoter pHBB is a sequence shown as SEQ ID NO. 1; the sequences of the specific targeting BCL11A enhancer, caccgatcaggccaaaaccctcc and aaacggaagggtttggccttgatc, are double-stranded oligonucleotides composed of base complementary pairs.
2. A plasmid for gene editing, wherein the plasmid is: replacing an original promoter EF-1 alpha coreprometer in the pLenti-CRISPR-V2 with a promoter pHBB of erythroid specific beta-globin, and cloning an oligonucleotide sequence H58-Enhancer2 for targeting a BCL11A Enhancer to obtain the target polypeptide;
the sequence of the promoter pHBB of the erythroid specific beta-globin is shown as SEQ ID NO. 1;
the oligonucleotide sequence H58-Enhancer2 is a double strand consisting of caccgatcaggccaaaaccttcc and aaacggaaagggttggccttgatc which are paired with each other in a base complementary manner.
3. The plasmid for gene editing of claim 2, further comprising: expressing CRISPR-Cas9 sequence of nuclease.
4. A method for constructing a plasmid for gene editing, comprising:
s1, replacing an original promoter EF-1 alpha corepromemoter in pLenti-CRISPR-V2 with a promoter pHBB of red-line specific beta-globin to obtain a pLenti-pHBB-CRISPR-V2 plasmid vector; the method comprises the following specific steps:
s11, artificially synthesizing a promoter pHBB of the red-line specific beta-globin, wherein the nucleotide sequence of the promoter pHBB is shown as SEQ ID NO:1, putting the promoter pHBB on a universal vector pUC57 after the synthesis is finished, and introducing enzyme cutting sites EcoRI and XbaI into the vector to obtain a vector pUC57-pHBB;
s12, carrying out double digestion on the pLenti-CRISPR-V2 plasmid and pUC57-pHBB respectively by using restriction endonucleases EcoRI and XbaI, carrying out agarose electrophoresis after double digestion, and then cutting gel and recycling to obtain a pLenti-CRISPR-V2 vector fragment and a pHBB fragment;
s13, connecting the pLenti-CRISPR-V2 vector fragment with the pHBB fragment by adopting ligase;
s14, transforming the ligation product into competent Trans1T1, uniformly mixing, carrying out ice bath, carrying out heat shock, immediately carrying out ice bath, firstly culturing by using a liquid culture medium without antibiotics, then transferring to an agar plate containing ampicillin for continuous culture, then selecting a monoclonal bacterial colony, inoculating the monoclonal bacterial colony into a liquid culture solution containing ampicillin for shake culture, extracting plasmid, carrying out double-enzyme digestion identification, carrying out sequencing identification, and successfully constructing a pLenti-pHBB-CRISPR-V2 plasmid vector;
s2, cloning an oligonucleotide sequence H58-Enhancer2 for targeting the BCL11A Enhancer into a pLenti-pHBB-CRISPR-V2 plasmid vector to obtain a plasmid pLenti-pHBB-CRISPR-V2-H58-Enhancer2 for gene editing; the method comprises the following specific steps:
s21, annealing an oligonucleotide sequence H58-Enhancer2 for positioning a BCL11A Enhancer, and denaturing at 95-98 ℃ for 5-10min to obtain H58-Enhancer2-Oligo; wherein the oligonucleotide sequence H58-Enhancer2 is a double strand consisting of caccgatcaggccaaaaccttcc and aaacggaaggtttggcccttgatc which are paired with each other in a base complementary manner;
s22, performing single enzyme digestion on the pLenti-pHBB-CRISPR-V2 plasmid vector obtained in the step S1 by using a restriction enzyme Esp3I, performing agarose electrophoresis, and cutting and recovering gel to obtain a pLenti-pHBB-CRISPR-V2 vector fragment;
s23, connecting the pLenti-pHBB-CRISPR-V2 vector fragment with the H58-Enhancer2-Oligo fragment by using ligase;
s24, transforming the ligation product into competent Trans1T1, uniformly mixing, performing ice bath, performing heat shock, immediately performing ice bath, culturing by using a liquid culture medium without antibiotics, then transferring to an agar plate containing ampicillin for continuous culture, then selecting a monoclonal colony to inoculate in a liquid culture medium containing ampicillin for shake culture, extracting plasmids, performing sequencing identification, and successfully constructing the pLenti-pHBB-CRISPR-V2-H58-Enhancer2 plasmid vector.
5. A method for preparing a lentivirus carrying a erythroid gene editing system, which comprises the following steps:
step 1: co-transfecting a plasmid for expressing membrane protein, a packaging plasmid and a plasmid pLenti-pHBB-CRISPR-V2-H58-Enhancer2 for gene editing to a virus production cell;
the plasmid pLenti-pHBB-CRISPR-V2-H58-Enhancer2 for gene editing is the plasmid of claim 3; or a plasmid constructed according to the construction method of claim 4;
step 2: and collecting the supernatant containing the virus particles, and purifying by chromatography to obtain the lentivirus of the CRISPR-Cas9 gene editing system for delivering the specific targeting BCL11A enhancer.
6. The method of claim 5, wherein the virus-producing cell is 293T, 293FT or HEK293.
7. Use of the lentiviral vector carrying the erythroid gene editing system of claim 1 in the delivery of a CRISPR-Cas9 system in the preparation of a medicament for the treatment of beta-thalassemia.
8. A method for gene editing of ex vivo hematopoietic stem cells, characterized in that the BCL11A enhancer is sheared by infecting hematopoietic stem cells with the lentivirus carrying the erythroid gene editing system of claim 1 and delivering the CRISPR-Cas9 gene editing system carrying a specific target to the BCL11A enhancer into the hematopoietic stem cells.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110310395.5A CN113046330B (en) | 2021-03-23 | 2021-03-23 | Lentivirus and medicine carrying erythroid gene editing system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110310395.5A CN113046330B (en) | 2021-03-23 | 2021-03-23 | Lentivirus and medicine carrying erythroid gene editing system |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113046330A CN113046330A (en) | 2021-06-29 |
| CN113046330B true CN113046330B (en) | 2023-03-21 |
Family
ID=76514616
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110310395.5A Active CN113046330B (en) | 2021-03-23 | 2021-03-23 | Lentivirus and medicine carrying erythroid gene editing system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113046330B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113308494A (en) * | 2021-07-14 | 2021-08-27 | 卡瑞济(北京)生命科技有限公司 | Safer thalassemia gene therapy vector, construction method and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017214940A1 (en) * | 2016-06-16 | 2017-12-21 | 毛侃琅 | Lentiviral expression vector for specifically promoting high expression of cplx2 gene, and applications thereof |
| CN108410877A (en) * | 2018-03-27 | 2018-08-17 | 和元生物技术（上海）股份有限公司 | The sgRNA of CRISPR-Cas9 targeting knock outs people's cell SANIL1 genes and its specificity |
| CN109641064A (en) * | 2016-06-08 | 2019-04-16 | 美国基因技术国际有限公司 | Nonconformity viral delivery systems and its correlation technique |
| CN109735497A (en) * | 2017-10-27 | 2019-05-10 | 博雅辑因（北京）生物科技有限公司 | A method of improving fetal hemoglobin expression |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018191440A1 (en) * | 2017-04-11 | 2018-10-18 | President And Fellows Of Harvard College | In vivo gene editing of blood progenitors |
-
2021
- 2021-03-23 CN CN202110310395.5A patent/CN113046330B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109641064A (en) * | 2016-06-08 | 2019-04-16 | 美国基因技术国际有限公司 | Nonconformity viral delivery systems and its correlation technique |
| WO2017214940A1 (en) * | 2016-06-16 | 2017-12-21 | 毛侃琅 | Lentiviral expression vector for specifically promoting high expression of cplx2 gene, and applications thereof |
| CN109735497A (en) * | 2017-10-27 | 2019-05-10 | 博雅辑因（北京）生物科技有限公司 | A method of improving fetal hemoglobin expression |
| CN109735574A (en) * | 2017-10-27 | 2019-05-10 | 博雅辑因（北京）生物科技有限公司 | A method of improving fetal hemoglobin expression |
| CN108410877A (en) * | 2018-03-27 | 2018-08-17 | 和元生物技术（上海）股份有限公司 | The sgRNA of CRISPR-Cas9 targeting knock outs people's cell SANIL1 genes and its specificity |
Non-Patent Citations (2)
| Title |
|---|
| BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis;Matthew C Canver;《Nature》;20150916;第527卷(第7577期);讨论部分 * |
| The degree of phenotypic correction of murine beta -thalassemia intermedia following lentiviral-mediated transfer of a human gamma-globin gene is influenced by chromosomal position effects and vector copy number;Derek A Persons;《Blood》;20030315;第101卷(第6期);总结第2、5小结、图3-图5 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113046330A (en) | 2021-06-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20210180091A1 (en) | Materials and methods for treatment of hemoglobinopathies | |
| CN110747195B (en) | shRNA and lentiviral vector for inhibiting human EDRADD gene expression as well as construction method and application thereof | |
| CN109528653B (en) | Membrane vesicle with gene editing function and preparation method, pharmaceutical composition and application thereof | |
| CN111088224B (en) | Method for promoting directional differentiation of umbilical cord mesenchymal stem cells to chondroblasts | |
| CN113046330B (en) | Lentivirus and medicine carrying erythroid gene editing system | |
| CN110106201A (en) | A kind of retroviral vector controllably immortalized and human umbilical cord mesenchymal stem cells and its construction method | |
| WO2020149395A1 (en) | Therapeutic agent for dystrophic epidermolysis bullosa | |
| CN113025656A (en) | AAV vector for exosome delivery CasRx gene silencing and construction method and application thereof | |
| US11045498B2 (en) | Nonviral minicircle vector carrying SOX gene and construction method therefor | |
| CN111139222B (en) | Recombinant mesenchymal stem cell and preparation method and application thereof | |
| CN109294994B (en) | Method for effectively repairing Westmead mutation of thalassemia and application | |
| CN1948475B (en) | Recombination expression carrier for treating Aids, reformed blood building stem cell and method | |
| EP3784695B1 (en) | Use of lentivector-transduced t-rapa cells for amelioration of lysosomal storage disorders | |
| CN110029091B (en) | Preparation method of T lymphocyte preparation for relieving inhibition of PD-1 immune check point | |
| CN109055432B (en) | Lentivirus infection reagent and preparation method and application thereof | |
| CN109266683B (en) | Lentiviral recombinant vector containing E4BP4 gene and preparation method and application thereof | |
| WO2024036839A1 (en) | Gene-modified cell drug expressing pah, method for preparing same, and use thereof | |
| CN117384967A (en) | Nucleic acid construct | |
| AU2020459825A1 (en) | Therapeutic agent for dystrophic epidermolysis bullosa | |
| CN114181954A (en) | Optimized lentivirus packaging system | |
| CN110467680B (en) | Fusion protein, medicine and coding gene prepared from fusion protein and MSC (mesenchymal stem cell) containing gene | |
| CN112746072A (en) | sgRNA for beta-hemoglobinopathy gene editing and application | |
| WO2022199552A1 (en) | Alpha-globin overexpression vector and application thereof | |
| CN115058455B (en) | Preparation method and application of clinical blood immune cell preparation | |
| CN116271106B (en) | Application of lentiviral vector Lentillalpha in preparation of medicine for treating alpha-thalassemia |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |