CN113018432A - Preparation method of immune medicine - Google Patents
Preparation method of immune medicine Download PDFInfo
- Publication number
- CN113018432A CN113018432A CN202110263132.3A CN202110263132A CN113018432A CN 113018432 A CN113018432 A CN 113018432A CN 202110263132 A CN202110263132 A CN 202110263132A CN 113018432 A CN113018432 A CN 113018432A
- Authority
- CN
- China
- Prior art keywords
- protein
- aptamer
- dna
- nucleic acid
- specific binding
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/44—Antibodies bound to carriers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
- A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
- A61K47/65—Peptidic linkers, binders or spacers, e.g. peptidic enzyme-labile linkers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/80—Vaccine for a specifically defined cancer
- A61K2039/804—Blood cells [leukemia, lymphoma]
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Engineering & Computer Science (AREA)
- Epidemiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Hematology (AREA)
- Oncology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention provides a preparation method of an immune drug, which comprises the steps of firstly preparing fusion protein containing specific binding protein and covalent link protein; preparing a nucleic acid structure containing the aptamer and the covalently linked DNA; and then incubating the fusion protein and the nucleic acid structure together, and enabling the covalent link protein and the covalent link DNA to be covalently combined to obtain the immune drug. The invention broadens the types of immunotherapy drugs, and the current protein bispecific antibody is evolved into a chimeric form in which DNA participates. The preparation method of the invention overcomes the defect that the traditional bispecific antibody must be subjected to genetic engineering, shortens the synthesis preparation time of the immune drug, and reduces the production cost. The invention takes the aptamer as a target cell recognition element, and relies on the advantage that the aptamer can be combined in a multivalent way, so that the tumor recognition types are various, the binding affinity and specificity with tumor cells are improved, and the recognition range is expanded.
Description
Technical Field
The invention relates to the technical field of tumor immunotherapy drugs, and particularly provides a novel immunotherapy drug for mediating T cell to kill tumor cells in a targeted manner, a preparation method thereof and application thereof in tumor immunotherapy.
Background
Cancer immunotherapy can activate the immune system of a patient to prevent immune evasion by cancer, and has great potential in reducing cancer metastasis and recurrence for a long time. Unlike traditional chemotherapy or radiotherapy, tumor immunotherapy has greater selectivity and lower toxicity in tumor therapy, while providing long-term immunity through immunological memory. Recent studies have shown that T cells can redirect and eliminate tumors by bispecific molecules that bind tumor-specific antigens. Among them, people have attracted special attention because of the advantage that Bispecific T-cell engage (BiTE) antibody mediated killing can bypass MHC restriction to selectively kill tumor cells. BiTE is essentially a single polypeptide chain comprising single chain (sc) Fv domains of two different antibodies, one of which is designed to recognize CD3e expressed on any T cell, and the other of which is designed to bind a tumor-associated antigen expressed by a tumor cell. Despite their remarkable success, since BiTE belongs to the protein class of drugs, bites for the treatment of different tumor cells must be genetically engineered by means of existing DNA sequences, a process which is not only time and labor consuming but also whose stability and activity cannot be guaranteed. Meanwhile, customized medical treatment cannot be quickly realized according to the actual condition of a patient. In addition, the in vivo is a multicellular environment, the types of molecules on the surface of tumor cells are the same as those on the surface of normal cells, and only the difference of expression amount exists, so that the composition of the BiTE structure is fixed at present, so that the BiTE structure can kill the normal cells in the immunotherapy process, and certain side effects exist. From this point of view, aptamers (aptamers) can solve the problems of the existing BiTE. Aptamers are called "chemical antibodies" and are considered to be an ideal choice for targeted therapy of tumors because of their small size, ease of preparation, and good targeting properties. Thereby expanding the cancer treatment range and accelerating the drug generation and development process. In addition, the aptamer can be rapidly assembled into a DNA nano structure with other DNA in a test tube by the base complementary pairing principle. DNA nanostructures are widely used in the biomedical field due to their programmability, ease of modification, and high biocompatibility. And different structures of the antigen can combine different numbers of aptamers, thereby improving the tumor recognition capability and reducing the side effect of immunotherapy.
Therefore, there is an urgent need in the art to develop an immune drug that recognizes tumor cell surface molecules using nucleic acids and a method for preparing the same, which are used to solve the problems of time and labor consuming development of the existing immunotherapy, limited subjects and side effects.
Disclosure of Invention
In the invention, the aptamer is used for replacing an antibody structure domain in the current BiTE to identify the molecules on the surface of tumor cells, and the antibody-nucleic acid chimera obtained by research and development can solve the problems in the prior art as a novel bispecific drug.
Therefore, the invention firstly provides an immune medicament, the immune medicament is a dual-specificity immune medicament (1) comprising a specific binding protein (11) and a nucleic acid aptamer (12), and the specific binding protein (11) and the nucleic acid aptamer (12) are connected in a direct or indirect mode, the specific binding protein (11) is a protein structure, the nucleic acid aptamer (12) is a nucleic acid structure, the specific binding protein (11) is used for specifically binding with an immune cell receptor or a target cell receptor, and correspondingly, the nucleic acid aptamer (12) is used for specifically binding with the target cell receptor or the immune cell receptor.
In a specific embodiment, a covalent linking protein (13) and a covalent linking DNA (14) are linked between the specific binding protein (11) and the aptamer (12), the covalent linking protein (13) is linked to the specific binding protein (11), the covalent linking DNA (14) is linked directly or indirectly to the aptamer (12), and the covalent binding between the covalent linking protein (13) and the covalent linking DNA (14).
In a particular embodiment, a linking structure is also linked between the covalently linked DNA (14) and the aptamer (12), the linking structure also being composed of nucleotides.
In a particular embodiment, the covalent linking protein (13) is a HUH family protein, preferably a DCV protein.
In a specific embodiment, the immune drug comprises one aptamer (12) or a plurality of same or different aptamers (12), and preferably the immune drug comprises 3-100 same or different aptamers.
In a specific embodiment, the specific binding protein (11) is α CD 3.
In a specific embodiment, the aptamer (12) is one or more of sgc8, TE02, SYL3C, MUC1 and C-MET.
In a specific embodiment, the covalently attached DNA (14) has the sequence aagtattaccagaaa.
The invention also provides application of the immune medicament in tumor immunotherapy.
In a specific embodiment, the immunopharmaceutical is targeted to inhibit tumor cell growth in vivo.
The invention also provides a preparation method of the immune medicament, the immune medicament is a dual-specificity immune medicament (1) comprising the specific binding protein (11) and the aptamer (12), and the specific binding protein (11) and the aptamer (12) are indirectly connected, the specific binding protein (11) is a protein structure, the aptamer (12) is a nucleic acid structure, the specific binding protein (11) is used for specifically binding with an immune cell receptor or a target cell receptor, and correspondingly, the aptamer (12) is used for specifically binding with the target cell receptor or the immune cell receptor; a covalent linking protein (13) and a covalent linking DNA (14) are connected between the specific binding protein (11) and the aptamer (12), the covalent linking protein (13) is directly or indirectly connected with the specific binding protein (11), the covalent linking DNA (14) is directly or indirectly connected with the aptamer (12), and the covalent binding is formed between the covalent linking protein (13) and the covalent linking DNA (14); the preparation method comprises the following steps of,
step A: preparing a fusion protein containing the specific binding protein (11) and the covalent linking protein (13);
and B: preparing a nucleic acid construct comprising said aptamer (12) and covalently linked DNA (14);
step A and step B can be carried out simultaneously or in any sequence;
and C: and (C) incubating the fusion protein prepared in the step (A) and the nucleic acid structure obtained in the step (B) together, and enabling the covalent link protein (13) and the covalent link DNA (14) to be covalently bound to obtain the immune drug.
In a specific embodiment, the nucleic acid sequence of the fusion protein is first synthesized in a whole gene and a recombinant plasmid is constructed, and then the active fusion protein is expressed by escherichia coli pronucleus.
In a specific embodiment, after step a, the purification of the resulting fusion protein is further included.
In a particular embodiment, in step B, the nucleic acid structure further comprises a linking structure for linking the aptamer (12) and covalently linking the DNA (14), the linking structure also consisting of nucleotides.
In a specific embodiment, the nucleic acid structure comprises any one of a single-stranded aptamer, a Y-type DNA nanoparticle and a dendritic DNA nanoparticle, wherein the single-stranded aptamer comprises 1 aptamer (12), the Y-type DNA nanoparticle comprises 2 aptamers (12), the dendritic DNA nanoparticle comprises 3-100 aptamers (12), and the aptamers (12) contained in the Y-type DNA nanoparticle and the dendritic DNA nanoparticle are the same or different.
In a specific embodiment, the Y-shaped DNA nanoparticles are prepared by an enzyme-free self-assembly process, and the dendritic DNA nanoparticles are synthesized in vitro by a polymeric chain reaction.
In a specific embodiment, the incubation method is to mix the fusion protein prepared in step a and the nucleic acid structure obtained in step B, incubate the mixture at 36-38 ℃ for more than 10 minutes to obtain the immune drug, and preferably store the obtained immune drug at 2-8 ℃ for later use.
In a specific embodiment, the covalently linked protein (13) is a HUH family protein, preferably a DCV protein, and the covalently linked DNA (14) has the sequence aagtattaccagaaa.
In a specific embodiment, the specific binding protein (11) is α CD 3.
In a specific embodiment, the aptamer (12) is one or more of sgc8, TE02, SYL3C, MUC1 and C-MET.
The invention has at least the following beneficial effects:
1) the invention prepares the bispecific antibody-nucleic acid chimera by covalently combining the antibody single-chain-DCV fusion protein and the nucleic acid aptamer, widens the types of immunotherapy drugs, and develops the current bispecific antibody into a chimeric form with DNA participation.
2) The invention uses the antibody-nucleic acid chimera to mediate T cells to kill tumor cells, the generation process of the chimera overcomes the defect that the traditional bispecific antibody must be subjected to genetic engineering, shortens the synthesis and preparation time of the immunopharmaceuticals, and reduces the production cost.
3) The invention takes the aptamer as a target cell recognition element, depends on the advantages of more targets of the aptamer and capability of being assembled into a nano structure in a programmed manner, has various tumor recognition types, improves the binding affinity and specificity with tumor cells, and enlarges the recognition range of different tumor specificities.
4) The invention is based on the base complementary pairing principle to rapidly assemble the DNA nano structure with a specific structure and a specific valence state. Chimeras formed by different DNA nanostructures and antibody single chains can achieve different therapeutic effects. It is possible to make the reagent customized.
Drawings
FIG. 1 is a schematic diagram of the binding of the immunopharmaceutical of the present invention to T cells (i.e., immune cells) and target cells (i.e., tumor cells).
FIG. 2 shows the effect of the antibody-sgc 8 aptamer chimera on tumor killing measured at the cellular level.
FIGS. 3-4 are graphs demonstrating the universality of the application of the antibody-nucleic acid chimera in the field of immunotherapy.
FIGS. 5 to 8 are schematic diagrams of in vivo targeting and killing of tumor cells by the antibody-nucleic acid chimera. In which, fig. 5 and 6 are statistics of continuously measured tumor size, and fig. 7 and 8 are statistics of continuously measured mouse body weight.
In fig. 1: immune drug 1, specific binding protein 11, aptamer 12, covalent link protein 13, covalent link DNA14, T cell 2, T cell receptor 21, target cell 3, target cell receptor 31.
The features and advantages of the present invention will be further understood from the following detailed description taken in conjunction with the accompanying drawings. The examples provided are merely illustrative of the method of the present invention and do not limit the remainder of the disclosure in any way.
Detailed Description
In order that the invention may be more fully understood, a more particular description of the invention will now be rendered by reference to specific embodiments thereof that are illustrated in the appended drawings. However, the invention may be implemented in many different combinations and is not limited to the embodiments described herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.
The invention provides a novel immune medicament for tumor immunotherapy, which comprises two modules: the two modules can be covalently connected to form a chimera, and the chimera can mediate specific recognition of T cells and target cells and inhibit growth of tumor cells in a targeted manner in vitro and in vivo. The antibody-nucleic acid chimera has the structure shown in FIG. 1.
The invention also aims to provide a preparation method of the antibody-nucleic acid chimera, which comprises the following steps: the antibody is illustrated by a DCV-alpha CD3 fusion protein;
firstly), preparing an antibody;
1) recombinant plasmids containing antibody sequences, such as pET28 a-DCV-alpha CD3, were synthesized in their entirety.
2) Prokaryotic expression of active DCV-alpha CD3 fusion protein (i.e., fusion protein formed by the linkage of specific binding protein 11 and covalent linking protein 13).
Preferably, the DCV- α CD3 fusion protein expression purification method is as follows: pET28 a-DCV-alpha CD3 recombinant plasmid heat shock transformation Escherichia coli BL21(DE3) competence, 1mM IPTG induced its expression of target protein, collection of bacterial liquid, after ultrasonication, NI column purification of 6 His-DCV-alpha CD3 fusion protein.
II) preparing nucleic acid;
nucleic acids include three forms: single-stranded aptamers, Y-type DNA nanoparticles and dendritic DNA nanoparticles.
Alternatively, the single-chain aptamer of the invention is exemplified by sgc8 aptamer, and the sequence thereof is as follows:
aagtattaccagaaaaaaaaaaaaaaaATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTT AGA are provided. Wherein aagtattaccagaaaaaaaaaaaaaaa is the covalently linked DNA of the present invention (14).
The number of aptamers (aptamers) connected to the Y-type DNA nanoparticles is 2, and the DNA nanoparticles can be the same or different. The Y-type DNA nano-particle is assembled by three nucleic acid chains, and the sequence of the Y-type DNA nano-particle is as follows:
Y1-DCV：aagtattaccagaaa TTTTTGAC CGA TGG ATG ACT TAC GAC GCA CAA GGA GAT CAT GAG；
Y2-sgc8：ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATTTTTGAC CGA TGG ATG ACC TGT CTG CCT AAT GTG CGT CGT AAG；
Y3-sgc8：ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATTTTTGAC CGA TGG ATG ACT CAT GAT CTC CTT TAG GCA GAC AGG。
wherein aagtattaccagaaa is the covalently linked DNA of the present invention (14).
The number n of the connected nucleic acid aptamers in the dendritic DNA nano-particles is less than 100, the specific number n can be any integer, and the DNA nano-particles can be the same or different. The structure of the dendritic DNA nanoparticles for assembling is assembled by five nucleic acid chains, and the sequence is as follows:
H1：TTAACCCACGCCGAATCCTAGACTCAAAGTAGTCTAGGATTCGGCGTGAAAA AGTGAGCACGGACG；
H2：GACGTGCAGGCTGTTTAAAGTCTAGGATTCGGCGTGGGTTAACACGCCGAAT CCTAGACTACTTTG；
Sgc8c-SH2：CAGCCTGCACGTCATCTAACTGCTGCGCCGCCGGGAAAATACTGTA CGGTTAGA；
DNA1(C1)NC：CGTCCGTGCTCAC；
DCV Initiator(I)：aagtattaccagaaaAGTCTAGGATTCGGCGTGGGTTAA。
wherein the sequence aagtattaccagaaa is a DCV protein targeting DNA sequence, namely, the covalently linked DNA (14) of the present invention, and is used for covalently linking an antibody to a nucleic acid structure, namely, the covalently linked DNA (14) of the present invention.
Thirdly), preparing an antibody-aptamer chimera;
and (3) incubating the antibody in the step one) and the nucleic acid in the step two) together to obtain the antibody-nucleic acid chimera.
The invention also provides application of the antibody-nucleic acid chimera in tumor immunotherapy.
In one embodiment of the invention, the effect of the bispecific antibody-nucleic acid chimera sgc 8-DCV-alpha CD3 on mediated T cell killing of tumor cells is detected in vitro, and the cell level is detected by using a CCK8 method to detect the target killing effect on CCRF-CEM human acute lymphoblastic leukemia cells. As a result: the prepared sgc 8-DCV-alpha CD3 chimera has the capacity of mediating T cells to kill tumor cells, and the killing effect is gradually enhanced along with the increase of the drug concentration of the sgc 8-DCV-alpha CD3 chimera.
In one embodiment of the present invention, sgc8 in the above embodiment is replaced by an antibody-nucleic acid chimera prepared from any other aptamer (in this embodiment, TE02, SYL3C, MUC1 and C-MET), and the chimera is tested at the cellular level for its killing effect on different types of tumor cells by the CCK8 method. The results show that: chimeras connected with different aptamers can mediate T cells to kill tumor cells, and the method has universality in the field of immunotherapy.
In one embodiment of the present invention, the effect of antibody-aptamer nanostructure chimeras in mediating T cell killing in vitro was studied. The antibody-aptamer nano-structure chimera is used as a medicine, and the cell level is used for detecting the breast cancer targeted killing effect of the antibody-aptamer nano-structure chimera on MCF-7 human by using a CCK8 method. The result shows that the prepared antibody-dendritic aptamer nanostructure chimera has the best effect of mediating T cells to kill tumor cells, and the antibody-Y aptamer nanostructure is adopted. antibody-Y aptamer nanostructures represent bivalent DNA nanoparticles. In addition to the Y-shaped structure in this embodiment, other nanostructures to which a defined number of aptamers are attached may be used. In addition dendritic DNA nanostructures represent DNA nanostructures synthesized in vitro by the polymer chain reaction.
In one embodiment of the invention, a nude mouse model is utilized to perform a targeting experiment of an in vivo antibody-nucleic acid chimera on nude mouse subcutaneous tumor-bearing CEM, and the sgc8 aptamer is taken as an example to explore the tumor immunotherapy effect of the antibody-nucleic acid chimera with different structures. Immunotherapy effects were reflected by continuous measurement of tumor size and measurement of mouse body weight. The results show that the tumor of the experimental group injected with the antibody-nucleic acid chimera is significantly smaller than that of the control group. In the experimental group, injection of the antibody-dendritic aptamer nanostructure chimera significantly inhibited tumor growth, followed by the antibody-Y aptamer nanostructure chimera. The immunotherapy effect can be improved by constructing the DNA nanoparticles with different structures, and a new idea is provided for tumor therapy.
In summary, the antibody-nucleic acid chimera provided by the present invention is a novel immunotherapeutic drug, which is first applied to T cell-mediated immunotherapy. The medicine comprises an antibody module and a nucleic acid module, wherein the antibody module can be any antibody single chain capable of identifying immune cell surface molecules, and the nucleic acid module can also be any aptamer capable of identifying tumor cell surface molecules. In addition, the invention constructs DNA nano particles with different structures on the basis that the antibody can form chimera with nucleic acid, and applies the functionalized DNA nano particles to the field of immunotherapy. The DNA nano-particle comprises a nano-structure connected with a specific number of aptamers (such as the aptamer number n of a Y-shaped structure is 2 and the like) and a nano-structure of a plurality of aptamers formed by polymerization chain Hybridization (HCR) (such as the aptamer number n of a dendritic structure is less than 100), wherein multivalent DNA nano-particles can be the same DNA sequence or different DNA sequences.
The bispecific immunopharmaceutical in the present invention means that the immunopharmaceutical has specificity to both T cells (immune cells) and target cells (tumor cells). The bispecific immune drug used for connecting T cells and target cells in the prior art is either protein or nucleic acid in both modules, and the invention firstly proposes a bispecific immune drug comprising a protein module and a nucleic acid module.
The preparation method of the immune medicine comprises the following steps: in 2018, the covalent binding of covalent connexin 13 and covalent connexin 14 is reported, the invention prepares a covalent connexin 13 according to the literature, then prepares a conjugate of specific binding protein 11 and covalent connexin 13, and connects covalent connexin 13-matched covalent connexin DNA14 and aptamer 12 to form a nucleic acid structure (the nucleic acid structure can be customized by a nucleic acid manufacturer), and then uses the covalent binding of covalent connexin 13 and covalent connexin DNA14 to obtain the whole immune drug containing specific binding protein 11, aptamer 12, covalent connexin 13 and covalent connexin DNA14, and the structure of the immune drug sequentially comprises specific binding protein 11, covalent connexin 13, covalent connexin DNA14 and aptamer 12 from one end to the other end. In the present invention, the covalent binding protein 13 may be specifically a HUH protein, more specifically a DCV protein, but may be a protein belonging to many families other than HUH, and can covalently bind to DNA.
The specific binding protein 11 of the present invention may bind to a receptor of a T cell, in which case the aptamer 12 binds to a receptor of a target cell, or the reverse, in which the aptamer 12 binds to a receptor of a T cell, and the specific binding protein 11 binds to a receptor of a target cell.
The aptamer 12 of the present invention is indispensable, and the aptamer is essentially nucleic acid, and ordinary DNA is also nucleic acid, but ordinary DNA cannot be used in the present invention because it does not have the ability of the aptamer to specifically recognize a receptor.
In addition, because it is difficult to directly connect the common protein with the common nucleic acid chain, the specific binding protein 11 and the aptamer 12 are connected by specifically adopting the covalent connexin 13 and the covalent connexin DNA14 in the invention, the covalent connexin 13 reported in the literature is a DCV protein of HUH family, which belongs to a protein member of duck circovirus, compared with other similar proteins, such as: PCV (porcine virus) has the highest efficiency of connecting DCV with DNA, so the corresponding DCV protein is expressed according to the literature in the invention.
Example 1
This example is the preparation of DNA nanoparticles.
One, single-chain aptamers.
A DCV protein recognition sequence named DCV-aptamer was added to the 5' end of the published aptamer sequence. The nucleic acid synthesis mechanism sent to the Shanghai synthesizes a single-stranded aptamer.
Secondly, preparing Y-type DNA nano particles.
1, three nucleotide chains are ordered: YA-sgc8, Yb-DCV and YC-sgc 8.
2, synthesizing Y-type DNA nano-particles: the Y-shaped DNA macromolecules are prepared by an enzyme-free self-assembly process. First, a Y-junction scaffold (Y-DNA) was prepared as a building block. In the experiment, the three oligonucleotide chains contain the aptamer and the target sequence of DCV protein (YA-sgc8, Yb-DCV, YC-sgc8 sequence), which is PBS-MgCl2Solution (10mM, pH 7.4, containing 150mM NaCl and 2mM MgCl)2) Dissolved at a concentration of 10 mM. The DNA mixed solution is heated in boiling water for 5min, then slowly cooled to room temperature, and kept in a refrigerator at 4 ℃ for later use.
Thirdly, preparing the dendritic DNA nano particles.
1, ordering the five nucleotide chains required for building the structure, namely H1, H2, sgc8C-SH2, DNA1(C1) NC and DCV Initiator (I) as described above.
2, using PBS-MgCl to make the above-mentioned five chains2The solution was dissolved and diluted to a final concentration of 10mM by first mixing and diluting H1, H2, sgc8C-SH2 and DNA1(C1) NC in equal amounts to a final concentration of 20. mu.M, heating the DNA mixture solution in boiling water for 5min, and then slowly cooling to room temperature. After cooling, 4. mu.M of DCV initiator (I) was added to the DNA mixture and the mixture was allowed to stand at 37 ℃ for overnight reaction. And placing the assembled DNA nano particles in a refrigerator at 4 ℃ for later use.
Example 2
This example is the preparation of an antibody-nucleic acid chimera.
The DCV-alpha CD3 fusion protein was added to DCV-sgc8 aptamer in equal amounts and mixed, and cultured at 37 ℃ for 15 min. Then stored at 4 ℃ for later use.
Example 3
This example is the application and detection of antibody-nucleic acid chimera in vitro and in vivo for tumor targeted killing. An example of the preparation of an aptamer-DCV-alpha CD3 chimera is DCV-sgc8 (aptamer of human acute lymphoblastic leukemia).
Firstly, a cell level CCK8 method detects that the aptamer-DCV-alpha CD3 chimera mediates the target killing effect of T cells.
1, CCRF-CEM cells (5% FBS +1640) and PBMC cells (5% FBS +1640+ IL2) which were well pre-fed;
2, taking the CEM cells (2 x 10)4Individual cells) and PBMC cells (human peripheral blood mononuclear cells) (1 x 10)5Individual cells) and various concentrations of sgc 8-DCV-. alpha.CD 3 were incubated at 37 ℃ for 24 hours.
3, detecting the reduction amount of the cell number of the sgc 8-DCV-alpha CD3 mediated T cell targeting lysis CEM cells by using a CCK-8 kit (cat No. C0039, Byunnan), thereby judging the killing effect. CCRF-CEM human acute lymphoblastic leukemia was plated per well in 96-well plates. The control group was set up to include only T cells and CEM cells (human acute lymphoblastic leukemia cells) as well as the negative cells Ramos. The effect of the ratio of the number of tumor cells and effector cells, CEM cells (2 x 10) was also evaluated4Individual cells) with different numbers of PBMC cells (0, 1 x 10)5，2*105) And 100nm sgc 8-DCV-. alpha.CD 3 chimera incubated at 37 ℃ for 24 hours.
After 4, 24h, 20ul CCK-8 solution was added per well. After incubation at 37 ℃ for 2 hours, the absorbance at 570nm was measured using Bio-Tek, SYNERGYMx. The cytotoxicity was calculated as cell killing rate (%) ═ 100 (experimental value-experimental low control)/(high control-low control).
As a result: the novel immune drug prepared by the method (taking sgc 8-DCV-alpha CD3 as an example) has the capacity of mediating T cells to kill tumor cells, and the killing effect is gradually enhanced along with the increase of the concentration of sgc 8-DCV-alpha CD 3. As shown in fig. 2. In FIG. 2, CEM is human acute lymphocytic leukemia cell, and Ramos is negative cell.
Fig. 3 and 4 are both to verify the universality of the application of the antibody-nucleic acid chimera in the field of immunotherapy. NC, sgc8, TE02, SYL3C, MUC1 and C-MET belong to aptamers, MCF-7 in FIG. 4 is a human breast cancer cell, Hela is a cervical cancer cell, HepG2 cell is a liver cancer cell, LO2 is a human normal liver cell, and SH-SY5Y is a human neuroblastoma cell.
Secondly, the targeted killing effect of sgc 8-DCV-alpha CD3 chimera on CCRF-CEM human acute lymphoblastic leukemia is detected at the living body level.
1, subcutaneous tumor-bearing CCRF-CEM in 4-6 weeks old female nude mice on day 0, 1 x 106One/one;
2, on day 7, tumor-bearing nude mice were randomly divided into two groups, a group a was a PBS control group, a group b was an injection T cell group, and a group b was subdivided into 5 groups: a blank control group, a DCV-alpha CD3 antibody control group, an sgc 8-DCV-alpha CD3 experimental group, a bivalent sgc 8-DCV-alpha CD3 experimental group and a multivalent sgc 8-DCV-alpha CD3 experimental group.
3, measuring the size of the tumor once every 2 days by using a vernier caliper and recording the size of the tumor in the whole experiment;
4, recording the weight of the tumor-bearing nude mice in the whole experiment process;
5, the experiment was ended up to 32 days.
The experimental results are shown in FIGS. 5 to 8. Among them, fig. 5 and 6 are statistical results of continuously measuring tumor sizes, and the results show that the tumors of the sgc 8-DCV-alpha CD3 injection group are significantly smaller than those of the protein injection only group. Meanwhile, the multivalent sgc 8-DCV-alpha CD3 (dendritic DNA nanostructure) experimental group has the tumor remarkably smaller than that of the bivalent sgc 8-DCV-alpha CD3 (Y-type DNA nanostructure) experimental group and sgc 8-DCV-alpha CD3 (linear single-chain) experimental group. The improvement of the valence state can improve the immunotherapy effect. Fig. 7 and 8 are statistical results of continuously measuring the body weight of tumor-bearing nude mice, and the results show that the injected medicament does not affect the life activities of the tumor-bearing nude mice.
In conclusion, the antibody-nucleic acid chimera constructed by the invention can mediate T cells to kill tumors in a targeted manner when being used as a medicament. And the immunotherapy effect can be customized and adjusted by building a DNA nano structure in vitro.
The foregoing is a more detailed description of the invention in connection with specific preferred embodiments and it is not intended that the invention be limited to these specific details. For those skilled in the art to which the invention pertains, several simple deductions and substitutions can be made without departing from the spirit of the invention, and all shall be considered as belonging to the protection scope of the invention.
Claims (10)
1. A method for the preparation of an immuno-drug, said immuno-drug being a bispecific immuno-drug (1) comprising a specific binding protein (11) and a nucleic acid aptamer (12), and the specific binding protein (11) and the nucleic acid aptamer (12) being indirectly linked, said specific binding protein (11) being itself a protein structure and said nucleic acid aptamer (12) being itself a nucleic acid structure, said specific binding protein (11) being adapted for specific binding to an immune cell receptor or a target cell receptor, respectively, said nucleic acid aptamer (12) being adapted for specific binding to a target cell receptor or an immune cell receptor; a covalent linking protein (13) and a covalent linking DNA (14) are connected between the specific binding protein (11) and the aptamer (12), the covalent linking protein (13) is directly or indirectly connected with the specific binding protein (11), the covalent linking DNA (14) is directly or indirectly connected with the aptamer (12), and the covalent binding is formed between the covalent linking protein (13) and the covalent linking DNA (14); the preparation method comprises the following steps of,
step A: preparing a fusion protein containing the specific binding protein (11) and the covalent linking protein (13);
and B: preparing a nucleic acid construct comprising said aptamer (12) and covalently linked DNA (14);
step A and step B can be carried out simultaneously or in any sequence;
and C: and (C) incubating the fusion protein prepared in the step (A) and the nucleic acid structure obtained in the step (B) together, and enabling the covalent link protein (13) and the covalent link DNA (14) to be covalently bound to obtain the immune drug.
2. The method according to claim 1, wherein in step A, the nucleic acid sequence of the fusion protein is first synthesized in a whole gene and a recombinant plasmid is constructed, and then the active fusion protein is expressed by Escherichia coli pronucleus.
3. The method of claim 1, further comprising purifying the resulting fusion protein after step a.
4. The method according to claim 1, wherein in step B, the nucleic acid construct further comprises a linker structure for linking the aptamer (12) and the DNA (14), and the linker structure is also composed of nucleotides.
5. The method according to claim 1, wherein in step B, the nucleic acid structure comprises any one of a single-stranded aptamer, a Y-type DNA nanoparticle and a dendritic DNA nanoparticle, wherein the single-stranded aptamer comprises 1 aptamer (12), the Y-type DNA nanoparticle comprises 2 aptamers (12), the dendritic DNA nanoparticle comprises 3 to 100 aptamers (12), and the aptamers (12) contained in the Y-type DNA nanoparticle and the dendritic DNA nanoparticle are the same or different.
6. The method according to claim 5, wherein in step B, the Y-type DNA nanoparticles are prepared by an enzyme-free self-assembly process, and the dendritic DNA nanoparticles are synthesized in vitro by a polymerase chain reaction.
7. The method according to claim 1, wherein in the step C, the fusion protein obtained in the step a and the nucleic acid structure obtained in the step B are mixed and then incubated at 36-38 ℃ for 10 minutes or more to obtain the immuno-drug, and preferably, the immuno-drug is stored at 2-8 ℃ for further use.
8. The method according to any one of claims 1 to 7, wherein the covalently linked protein (13) is a protein of the HUH family, preferably a DCV protein, and the covalently linked DNA (14) has the sequence aagtattaccagaaa.
9. The method of any one of claims 1 to 7, wherein the specific binding protein (11) is α CD 3.
10. The method according to any one of claims 1 to 7, wherein the aptamer (12) is one or more of sgc8, TE02, SYL3C, MUC1 and C-MET.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110263132.3A CN113018432B (en) | 2021-03-11 | 2021-03-11 | Preparation method of immune medicine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110263132.3A CN113018432B (en) | 2021-03-11 | 2021-03-11 | Preparation method of immune medicine |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113018432A true CN113018432A (en) | 2021-06-25 |
| CN113018432B CN113018432B (en) | 2022-12-13 |
Family
ID=76469488
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110263132.3A Active CN113018432B (en) | 2021-03-11 | 2021-03-11 | Preparation method of immune medicine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113018432B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102317303A (en) * | 2007-07-31 | 2012-01-11 | 约翰·霍普金斯大学 | Polypeptide-nucleic acid conjugate for immunoprophylaxis or immunotherapy for neoplastic or infectious disorders |
| CN104788567A (en) * | 2015-01-21 | 2015-07-22 | 武汉友芝友生物制药有限公司 | A preparing method of bispecific antibodies targeting a mouse T lymphocyte CD3 and a human tumor antigen EpCAM, and applications of the bispecific antibodies |
| CN110494563A (en) * | 2017-01-30 | 2019-11-22 | 奥菲尔·努斯鲍姆 | Chemical entities suitable for treatment |
-
2021
- 2021-03-11 CN CN202110263132.3A patent/CN113018432B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102317303A (en) * | 2007-07-31 | 2012-01-11 | 约翰·霍普金斯大学 | Polypeptide-nucleic acid conjugate for immunoprophylaxis or immunotherapy for neoplastic or infectious disorders |
| CN104788567A (en) * | 2015-01-21 | 2015-07-22 | 武汉友芝友生物制药有限公司 | A preparing method of bispecific antibodies targeting a mouse T lymphocyte CD3 and a human tumor antigen EpCAM, and applications of the bispecific antibodies |
| CN110494563A (en) * | 2017-01-30 | 2019-11-22 | 奥菲尔·努斯鲍姆 | Chemical entities suitable for treatment |
Non-Patent Citations (3)
| Title |
|---|
| KLAUS N. LOVENDAHL等: "Sequence-Directed Covalent Protein−DNA Linkages in a Single Step Using HUH-Tags", 《J. AM. CHEM. SOC.》 * |
| KYUN HEO等: "An aptamer-antibody complex (oligobody) as a novel delivery platform for targeted cancer therapies", 《JOURNAL OF CONTROLLED RELEASE》 * |
| MARGHERITA PASSARIELLO等: "Novel Human Bispecific Aptamer-Antibody Conjugates for Efficient Cancer Cell Killing", 《CANCERS》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113018432B (en) | 2022-12-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109476718A (en) | The combination of MRNA and application thereof of encoding immune adjusting polypeptide | |
| JP2020528758A (en) | Antibodies with a functional domain in the elbow region between the variable domain and the constant domain | |
| CN103313730A (en) | Compositions of a peptide-based system for cell-specific targeting | |
| EP3360893A1 (en) | High-affinity and soluble pdl-1 molecule | |
| CN110478322B (en) | Nucleic acid drug compound and preparation method and application thereof | |
| WO2021083363A1 (en) | High-affinity tcr for kras g12v recognition | |
| CN104321077A (en) | Methods and compositions for treating inflammation | |
| CN106795517A (en) | Composition based on RNA and for preventative and therapeutic treatment adjuvant | |
| CN112675202A (en) | Anti-tumor immune cell based on targeting ligand cell coupling technology and preparation method and application thereof | |
| CN104244928A (en) | Magnetic nanoparticle-samirna complex and method for preparing same | |
| KR102023839B1 (en) | Highly Efficient Aptamer Complex Containing Branched DNA and Aptamer, and Uses Thereof | |
| US11331365B2 (en) | Multispecific protein drug and library thereof, preparing method therefor and application thereof | |
| CN113018433B (en) | Immune medicine and application thereof in tumor immunotherapy | |
| KR102324242B1 (en) | Novel aptamer and its uses | |
| CN113018432B (en) | Preparation method of immune medicine | |
| WO2021204287A1 (en) | High-affinity tcr for recognizing hpv16 | |
| WO2021185368A1 (en) | High-affinity tcr for recognizing afp antigen | |
| WO2021043284A1 (en) | High-affinity t cell receptor that recognizes ssx2 | |
| EP3844177A1 (en) | Combination therapies | |
| CN115998851A (en) | Individuation mRNA composition, vector, mRNA vaccine and application thereof | |
| WO2021254458A1 (en) | High-affinity t-cell receptor for recognizing hpv antigen | |
| WO2021234110A1 (en) | Single domain antibodies and their use in cancer therapies | |
| CN114539385A (en) | TCR (T cell receptor) for identifying HPV (human papillomavirus) antigen | |
| CN105399832A (en) | Label-free single-chain type anthropogenic double-specificity antibody and application thereof | |
| CN106632686B (en) | anti-IL-4R single-chain antibody and snake venom L-amino acid oxidase fusion protein and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |