CN110478322B - Nucleic acid drug compound and preparation method and application thereof - Google Patents
Nucleic acid drug compound and preparation method and application thereof Download PDFInfo
- Publication number
- CN110478322B CN110478322B CN201910877543.4A CN201910877543A CN110478322B CN 110478322 B CN110478322 B CN 110478322B CN 201910877543 A CN201910877543 A CN 201910877543A CN 110478322 B CN110478322 B CN 110478322B
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- branched chain
- branched
- functional
- drug complex
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/14—Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles
- A61K9/141—Intimate drug-carrier mixtures characterised by the carrier, e.g. ordered mixtures, adsorbates, solid solutions, eutectica, co-dried, co-solubilised, co-kneaded, co-milled, co-ground products, co-precipitates, co-evaporates, co-extrudates, co-melts; Drug nanoparticles with adsorbed surface modifiers
- A61K9/146—Intimate drug-carrier mixtures characterised by the carrier, e.g. ordered mixtures, adsorbates, solid solutions, eutectica, co-dried, co-solubilised, co-kneaded, co-milled, co-ground products, co-precipitates, co-evaporates, co-extrudates, co-melts; Drug nanoparticles with adsorbed surface modifiers with organic macromolecular compounds
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicinal Preparation (AREA)
Abstract
The invention provides a nucleic acid drug compound and a preparation method and application thereof, wherein the nucleic acid drug compound consists of a branched chain structure, a functional element modified on the branched chain structure and a bridging structure connected with the branched chain structure; the branched chain structure comprises a supramolecule and a nucleic acid branched chain connected to the supramolecule; the functional element is assembled on the supermolecule of the branched chain structure through host-guest recognition; the bridging structure comprises complementary strands of nucleic acid branches, disulfide bonds and nucleic acid drug; the bridging structure serves as a connecting chain to connect a plurality of branched structures to form a nucleic acid drug complex. The prepared nucleic acid drug compound can be loaded with functional elements such as targeted delivery, controllable release and the like by reasonable structural design and sequence design and combining the host-guest recognition function of a supramolecular system, realizes the targeted delivery and controllable release of nucleic acid drugs, and has important application value in the fields of early diagnosis of diseases, treatment of genetic diseases, tumor treatment and the like.
Description
Technical Field
The invention belongs to the technical field of nucleic acid nano assembly, and relates to a nucleic acid drug compound and a preparation method and application thereof.
Background
In recent years, with the continuous development of nucleic acid manipulation technology, people gradually realize effective editing and silencing of target genes. Nucleic acid gene therapy drugs gradually come into clinical use, show great potential in early diagnosis and treatment of diseases, and gradually develop into a high-efficiency disease diagnosis and treatment means.
However, gene therapy also faces a series of challenges, and the problem of difficult administration of nucleic acid drugs is urgently needed to be solved. Nowadays, the gene therapy vectors which are used clinically are viral vectors, but the viral vectors have potential safety problems, and the risks of patients in the gene therapy process are increased to a great extent. In addition to viral vectors, non-viral vectors such as liposomes, cationic polymers, inorganic nanoparticles, etc. have also been successfully developed as vectors for delivery of nucleic acid drugs, but the non-viral vectors have high immunogenicity and cytotoxicity, which limits the applications of such vectors to some extent.
CN 103804473 a discloses a polypeptide and a nucleic acid drug nanoparticle containing the polypeptide, wherein the polypeptide comprises a first fragment with positive charge and a second fragment with a targeting function. The polypeptide is used as a nucleic acid drug delivery carrier, a first segment of the polypeptide is combined with nucleic acid with poly negative charges through electrostatic interaction to form a compound, a second segment of the polypeptide is combined with receptors on the surface of liver cancer cells, and the nucleic acid is concentrated on liver cancer tissues through passive targeting and active targeting, so that the targeting property of the nucleic acid drug is greatly improved, and the dosage of the nucleic acid drug is reduced; the polypeptide-nucleic acid nanoparticles prepared by the method have the advantages of good stability, high medication safety, 20-300 nm size, simple and controllable preparation process and easy large-scale production. However, the nucleic acid drug nanoparticles containing the polypeptide have high immunogenicity.
CN 109288815A discloses a preparation method and application of a multistage delivery nanoparticle capable of realizing targeted delivery of a nucleic acid drug to a tumor, wherein the multistage delivery nanoparticle is designed to be of a core-shell structure, a shell layer with environmental responsiveness endows the multistage delivery nanoparticle with the capability of presenting different surface characteristics to the surrounding environment, the multistage delivery nanoparticle is allowed to overcome multiple physiological barriers and efficiently deliver the nucleic acid drug to a tumor tissue, and the multistage delivery nanoparticle which is injected into a mouse with the tumor and carries plasmid DNA marked by a fluorescent probe realizes efficient enrichment of the nucleic acid drug in the tumor tissue, which indicates that the multistage delivery nanoparticle can completely realize targeted delivery of the nucleic acid drug to the tumor. However, the shell layer of the multi-stage delivery nanoparticle adopts PEI/PBA as an environment-responsive polymer, has certain cytotoxicity, is complex in preparation process, and cannot realize large-scale production.
The nucleic acid serves as a carrier of genetic information on one hand, and can also be assembled to form a nucleic acid nano-structure with specific size and morphology by means of base complementary pairing on the other hand. With the continuous development of nucleic acid nanotechnology, nucleic acid nanomaterials with good biocompatibility are gradually applied to various biomedical research fields such as in-vivo imaging, biological detection, drug delivery and the like.
Therefore, based on the very high structural homology between the nucleic acid drugs and the nucleic acid nano-carrier, the development of the efficient nucleic acid nano-carrier for transmitting the nucleic acid drugs has important significance for the development of gene therapy drugs.
Disclosure of Invention
Aiming at the defects and actual requirements of the prior art, the invention provides a nucleic acid medicine compound and a preparation method and application thereof, wherein the nucleic acid medicine compound has the functions of targeted delivery and controllable release of nucleic acid medicines, has good biocompatibility and high safety, can efficiently deliver the nucleic acid medicines, and improves the effect of gene therapy.
In order to achieve the purpose, the invention adopts the following technical scheme:
in a first aspect, the present invention provides a nucleic acid drug complex, which consists of a branched structure, a functional element modified on the branched structure, and a bridging structure connecting the branched structure;
the branched chain structure comprises a supramolecule and a nucleic acid branched chain connected to the supramolecule;
the functional element is assembled on the supermolecule of the branched chain structure through host-guest recognition;
the bridging structure comprises complementary strands of nucleic acid branches, disulfide bonds and nucleic acid drug;
the bridging structure serves as a connecting chain to connect a plurality of branched structures to form a nucleic acid drug complex.
According to the invention, through reasonable structure design and sequence design, the host-guest recognition function of a supramolecular system is combined, and the nucleic acid drug compound formed by assembly can realize targeted delivery and controllable release of the nucleic acid drug, so that the purpose of treating diseases is achieved.
Compared with the traditional non-viral vectors such as liposome, cationic polymer and inorganic nano-particles, the supermolecule-based nucleic acid drug complex has good biocompatibility and high safety, can efficiently transfer nucleic acid drugs, and has important application value in the fields of early diagnosis of diseases, treatment of genetic diseases, treatment of tumors and the like.
According to the invention, the supermolecule in the nucleic acid drug compound can load functional elements such as targeted delivery and controllable release by forming a host-guest recognition system with ligand molecules, so that the gene therapy effect is improved.
Preferably, the nucleic acid sequence of the nucleic acid branched chain is shown as SEQ ID NO 1-2;
SEQ ID NO:1：GAGAGAGAGAGAGAGTTTTT；
SEQ ID NO:2：TTTTTGTGTGTGTGTGTGTG。
preferably, the functional element comprises a functional nucleic acid and/or a functional polypeptide modified with a supramolecular ligand.
Preferably, the supramolecular ligand includes adamantane.
In the invention, adamantane (Ad) which is subject-guest recognition with beta-cyclodextrin is selected as a ligand molecule to be modified on functional nucleic acid and/or functional polypeptide, so that functional elements are combined on a nucleic acid drug compound taking beta-cyclodextrin as a core.
Preferably, the functional nucleic acid comprises the nucleic acid aptamer MUC 1.
The invention introduces the nucleic acid aptamer MUC1 into the nucleic acid drug compound as functional nucleic acid, thereby being beneficial to realizing the targeted delivery of the nucleic acid drug compound.
Preferably, the nucleic acid aptamer MUC1 comprises a nucleic acid sequence as shown in SEQ ID NO. 3;
SEQ ID NO:3：TTTTTGCAGTTGATCCTTTGGATACCCTGG。
preferably, the functional polypeptide comprises an endosome escape peptide.
The invention introduces endosome escape peptide into the nucleic acid drug compound as functional polypeptide, which is beneficial to realizing the controllable release of the nucleic acid drug compound.
Preferably, the endosome escape peptide comprises an amino acid sequence as set forth in SEQ ID NO 4;
SEQ ID NO:4：GLFGAIAGFIENGWEGMIDGWYG。
preferably, complementary strands of the nucleic acid branched chains of the bridging structure are shown as SEQ ID NO 5-6;
SEQ ID NO:5：CTCTCTCTCTCTCTC；
SEQ ID NO:6：CACACACACACACAC。
preferably, the nucleic acid drug of the bridging structure comprises an antisense nucleic acid of a target gene.
In the invention, the antisense nucleic acid is introduced into the bridging structure through a disulfide bond modified at the tail end, which is beneficial to realizing the controllable release of the antisense nucleic acid drug, the target of the antisense nucleic acid can be any mRNA, for example, the mRNA targeting green fluorescent protein shown in SEQ ID NO. 7, preferably, the target of the antisense nucleic acid is mRNA related to the tumorigenesis development, for example, the mRNA targeting tumor-related gene PLK1 shown in SEQ ID NO. 8.
Preferably, the antisense nucleic acid is shown as SEQ ID NO 7-8;
SEQ ID NO:7：GACCAGGATGGGCACCACCC；
SEQ ID NO:8：GCACTTGGCAAAGCCGCCCTT。
preferably, the molar ratio of the branched structures, functional elements and bridging structures is 1:1 (1-7), and may be, for example, 1:1:1, 1:1:2, 1:1:3, 1:1:3.5, 1:1:4, 1:1:5, 1:1:6 or 1:1: 7.
In a second aspect, the present invention provides a method for preparing a nucleic acid drug complex as described in the first aspect, the method comprising:
(1) constructing a branched chain structure:
(2) constructing a functional element;
(3) the branched structure, the functional element and the bridging structure are assembled to form the nucleic acid drug complex.
The preparation method of the nucleic acid-drug complex is simple to operate, has good repeatability and can realize large-scale production.
According to the invention, a branched structure is prepared by coupling nucleic acid branches to specific functional groups of supramolecules by using an organic synthesis strategy, and preferably, the construction of the branched structure in step (1) comprises the following steps:
(1') taking beta-cyclodextrin as a supramolecular core, and converting primary alcohol hydroxyl of the beta-cyclodextrin into azide group (beta-CD-7N) through organic functionalization3)；
(2') respectively reacting the amino-modified nucleic acid branched chain with DBCO-NHS (diphenylcyclooctyne-active ester) micromolecules containing alkynyl, and modifying a DBCO functional group at the tail end of the nucleic acid branched chain;
(3') carrying out copper-free click reaction on the nucleic acid branched chain with the end modified with DBCO and beta-cyclodextrin containing azide groups respectively to construct a branched chain structure with the beta-cyclodextrin as a core.
Preferably, the dosage ratio of the nucleic acid branch modified with DBCO at the end of the step (3') to the beta-cyclodextrin containing the azide group is (7-14): 1, and can be 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1 or 14:1, for example.
Preferably, the constructing of the functional element of step (2) comprises amidating crosslinking of adamantane on the functional nucleic acid and/or amidating solid phase synthesis of adamantane on the functional polypeptide.
Preferably, the molar ratio of the branched structure, the functional element and the bridging structure in step (3) is 1:1 (1-7), and may be, for example, 1:1:1, 1:1:2, 1:1:3, 1:1:3.5, 1:1:4, 1:1:5, 1:1:6 or 1:1: 7.
As a preferred technical scheme, the nucleic acid drug complex comprises two branched structures (branched nucleic acids of SEQ ID NO:1 or SEQ ID NO:2 are modified on supermolecules respectively) and two functional elements, and the molar ratio is optimally that the branched structure I is a branched structure II, Ad-MUC1, Ad-HA, and the bridging structure is 1:1:1:1: 7.
Preferably, the assembling conditions in step (3) are: incubating at 35-40 deg.C for 5-10 min, cooling to 0-4 deg.C, incubating at 35 deg.C, 36 deg.C, 37 deg.C, 38 deg.C, 39 deg.C or 40 deg.C, and incubating for 5min, 6min, 7min, 8min, 9min or 10 min.
In a third aspect, the present invention provides a use of the nucleic acid drug complex of the first aspect in the preparation of a drug for treating tumor.
Preferably, the tumor comprises any one of breast cancer, liver cancer, ovarian cancer, prostate cancer, non-small cell cancer, head and neck cancer, or non-hodgkin's lymphoma.
Compared with the prior art, the invention has the following beneficial effects:
(1) according to the invention, through reasonable structural design and sequence design and by combining the host-guest recognition function of a supramolecular system, the prepared nucleic acid drug compound can be loaded with functional elements such as targeted delivery and controllable release, so that the targeted delivery and controllable release of the nucleic acid drug are realized, and the gene therapy effect is improved;
(2) compared with the traditional non-viral vectors such as liposome, cationic polymer and inorganic nano-particles, the supermolecule-based nucleic acid drug complex has good biocompatibility and high safety, can efficiently transfer nucleic acid drugs, and has important application value in the fields of early diagnosis of diseases, treatment of genetic diseases, treatment of tumors and the like;
(3) the preparation method of the nucleic acid medicine compound is simple and convenient, the repeatability is good, the formed nucleic acid medicine compound has determined appearance and size, and the large-scale production can be realized.
Drawings
FIG. 1 is a schematic diagram of a method for preparing a nucleic acid drug complex;
FIG. 2 is a diagram showing the results of gel electrophoresis detection of branched structures;
FIG. 3 is a diagram showing the results of gel electrophoresis detection of nucleic acid-drug complexes;
FIG. 4 is an atomic force microscope topography characterization of nucleic acid drug complexes;
FIG. 5 is a graph showing the silencing effect of nucleic acid drug complexes on intracellular green fluorescent protein;
FIG. 6 is a graph showing the growth inhibitory effect of nucleic acid drug complexes on tumor cells.
Detailed Description
To further illustrate the technical means adopted by the present invention and the effects thereof, the present invention is further described below with reference to the embodiments and the accompanying drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting of the invention.
The examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The reagents or apparatus used are conventional products commercially available from normal sources, not indicated by the manufacturer.
The instruments and materials used in the examples are as follows:
equipment: gradient PCR instrument (Eppendorf, germany), small high-speed centrifuge (Eppendorf, germany), uv-visible spectrophotometer (shimadzu, japan), fluorescence microscope (Leica, germany), full-wavelength plate reader (TECAN, switzerland);
raw materials: the nucleic acid sequence is purchased from Biotechnology engineering (Shanghai) Inc., the polypeptide is purchased from Shanghai purple-region Biotech Co., Ltd, and the DBCO-NHS small organic molecule is purchased from Sigma-Aldrich Co., Ltd;
reagent: the composition of the buffer solution 1 × PBS buffer solution (pH 7.4) used in the experiment was: 136.9 × 10- 3mol·L-1(8.00g·L-1)NaCl，2.68×10-3mol·L-1(0.20g·L-1)KCl，9.75×10-3mol·L-1(1.56g·L-1)Na2HPO4·H2O and 1.47X 10-3mol·L-1(0.20g·L-1)KH2PO4The reagents of the buffer solution are all analytically pure and purchased from Sigma-Aldrich company; cell viability assay kits used were purchased from japan renegorian chemistry;
cell: human breast cancer MCF7 and MCF7-EGFP cell lines were purchased from the cell center of the institute of basic medicine, university of Council, China;
culture medium: DMEM medium (ThermoFisher, USA) added with 10% fetal bovine serum (ThermoFisher, USA), cells inoculated in 100mm culture dish, and placed in 5% CO2The cells were cultured in an incubator at 37 ℃ and passaged when they had grown to around 80% confluency.
EXAMPLE 1 preparation of nucleic acid drug complexes
FIG. 1 is a schematic diagram of a preparation method of a nucleic acid drug complex, which comprises the following specific steps:
(1) constructing a branched chain structure:
selecting beta-cyclodextrin (beta-CD) in a supermolecule system as a core, and converting primary alcohol hydroxyl of the beta-cyclodextrin into azide group (beta-CD-7N) through organic functionalization3)；
Selecting two nucleic acid sequences with terminal modified amino groups SEQ ID NO:1 (F): GAGAGAGAGAGAGAGTTTTT (3' amino modification), SEQ ID NO:2 (R): TTTTTGTGTGTGTGTGTGTG (5' end amino modification), respectively reacting with DBCO-NHS micromolecules containing alkynyl, and modifying DBCO functional groups at the tail ends of the nucleic acid branched chains;
the nucleic acid branched chains (F-DBCO and R-DBCO) with DBCO modified at the tail ends are respectively the same as beta-CD-7N3Performing a copper-free click reaction in which the DBCO-modified nucleic acid branch is bound to beta-CD-7N3The molar ratio of beta-cyclodextrin is 14:1, a branched nucleic acid structure taking beta-cyclodextrin as a core is constructed and named as a branched structure I and a branched structure II;
(2) constructing a functional element:
selecting adamantane (Ad) which is subject-guest recognized with beta-cyclodextrin as a ligand molecule, and crosslinking NHS activated carboxylic adamantane (Ad-NHS) with a nucleic acid aptamer MUC1 SEQ ID NO:3(TTTTTGCAGTTGATCCTTTGGATACCCTGG) with a cell targeting function and modified by 5' amino to construct an adamantane modified nucleic acid aptamer (Ad-MUC 1);
modifying adamantane at the N end of an endosome escape peptide SEQ ID NO 4 (HA: GLFGAIAGFIENGWEGMIDGWYG) with a controllable release function in a polypeptide solid phase synthesis manner to construct adamantane modified polypeptide (Ad-HA);
(3) the branched structure, functional element and bridging structure are assembled to form a nucleic acid drug complex:
the antisense nucleic acid sequence in the bridging structure targets mRNA of green fluorescent protein, and specifically comprises the following steps:
CTCTCTCTCTCTCTCS-SGACCAGGATGGGCACCACCCS-SCACACACA CACACAC (Linker-EGFP: mRNA targeting green fluorescent protein);
and (2) incubating the branched chain structure I and the branched chain structure II obtained in the step (1), the adamantane modified nucleic acid aptamer (Ad-MUC1) and the endosome escape peptide (Ad-HA) obtained in the step (2) and the bridging structure (Linker-EGFP) at a molar ratio of 1:1:1:1:7 at 37 ℃ for 5min, and gradually and slowly cooling to 4 ℃ to construct the nucleic acid drug compound taking beta-cyclodextrin as the core.
FIG. 2 is a diagram showing the results of gel electrophoresis detection of the branched structure constructed in step (1), wherein lane 1 is a double-stranded DNA marker, lane 2 is a branched structure I, and lane 3 is a branched structure II, which indicates that the branched structure is successfully constructed.
FIG. 3 is a diagram showing the results of gel electrophoresis detection of the nucleic acid drug complex constructed in step (3), in which lane 1 is a branched structure I, lane 2 is an assembly of the branched structure I and a bridged structure, lane 3 is an assembly of the branched structure I and the branched structure II with the bridged structure, and lane 4 is a nucleic acid drug complex in which an adamantane-modified nucleic acid aptamer (Ad-MUC1) and an endosome escape peptide (Ad-HA) are loaded on the assembly of the branched structure I and the branched structure II with the bridged structure. It can be seen that the nucleic acid-drug complex entered the gel well and exhibited more delayed electrophoretic behavior than the assembly of the branched structure, the branched structure and the bridged structure.
FIG. 4 is an atomic force microscope morphology characterization diagram of the constructed nucleic acid drug complex, wherein the nucleic acid drug complex has a good nanoparticle morphology with a particle size of 80 + -15 nm.
Example 2 silencing Effect of nucleic acid drug complexes on intracellular Green fluorescent protein
Human breast cancer MCF7-EGFP cells stably expressing green fluorescent protein were inoculated in a 35mm petri dish and placed in 5% CO2Culturing in an incubator at 37 ℃ overnight;
the nucleic acid-drug complex prepared in example 1 was added to the MCF7-EGFP cell culture medium (drug concentration: 100nM) as a target structure group, while a PBS control group, a separate target gene EGFP antisense nucleic acid group, and a functional element-unmodified nucleic acid complex group (target structure-free group) were set;
after 72 hours of incubation, the fluorescence intensity of the green fluorescent protein was observed by a fluorescence microscope.
The results are shown in FIG. 5, where antisense nucleic acids alone were essentially unable to enter cells and showed no significant silencing effect; the targeting-free structure group can partially enter cells and shows a certain silencing effect on green fluorescent protein; the targeted structure group can fully enter target cells and show very obvious silencing effect of green fluorescent protein.
Example 3
In comparison with example 1, the nucleic acid sequence of the bridging structure used in step (3) is:
CTCTCTCTCTCTCTCS-SGCACTTGGCAAAGCCGCCCTTS-SCACACACACACACAC (Linker-PLK 1: mRNA targeting tumor associated gene PLK 1), and the other conditions were the same as in example 1.
EXAMPLE 4 growth inhibitory Effect of nucleic acid drug complexes on tumor cells
Human breast cancer MCF7 cells were seeded in 100mm dishes in 5% CO2Culturing in an incubator at 37 ℃ overnight;
culturing the cells to logarithmic phase, digesting with trypsin and collecting the cells, adjusting the cell suspension concentration to 5X 104one/mL, seeded in 96-well plates at 100. mu.L per well;
place 96-well plate in CO2Culturing overnight in incubator, sucking out cultureNutrient solution, the nucleic acid drug complex prepared in example 3 was mixed into a new medium, added to MCF7-EGFP cells (drug concentration: 100nM) as a target structure group, and a PBS control group, a separate antisense nucleic acid group of the target gene PLK1, and a nucleic acid complex group not modified with a functional element (no target structure group) were set at the same time;
after incubation for 72 hours, discarding the culture medium, adding a cell viability detection reagent, 100 μ L per well, and continuing incubation for 1 hour;
detecting the OD value of each hole at 450nm by using a microplate reader, and calculating the survival rate of the tumor cells according to the OD value, wherein the calculation formula is as follows: survival% ═ OD value in experimental group/OD value in control group × 100.
As shown in FIG. 6, the antisense nucleic acid alone could not enter the cells and did not exhibit significant tumor cell suppression; the group without targeting structure showed a certain tumor cell inhibition capacity (cell survival < 80%); the group with the targeting structure showed the strongest tumor cell inhibition effect (cell survival < 25%). Therefore, the target-modified supramolecule-core nucleic acid drug complex can efficiently transmit antisense nucleic acid sequences and show a remarkable tumor inhibition effect.
In conclusion, the branched chain structure taking supramolecules as cores can quickly and efficiently load antisense nucleic acid sequences to form nucleic acid drug complexes with certain shapes and sizes; the nucleic acid drug compound is loaded with functional elements such as targeted delivery and controllable release through subject-object recognition, so that the effect of gene therapy is improved to a great extent; the invention can realize the introduction of antisense nucleic acid sequences with different targets only by simple nucleic acid sequence design, and has wide application prospect in the research field of disease treatment drugs.
The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.
SEQUENCE LISTING
<110> national center for Nano science
<120> nucleic acid drug compound, preparation method and application thereof
<130> 20190916
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 1
<210> 2
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 2
<210> 3
<211> 30
<212> DNA
<213> Artificial Synthesis
<400> 3
tttttgcagt tgatcctttg gataccctgg 30
<210> 4
<211> 23
<212> PRT
<213> Artificial Synthesis
<400> 4
Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu Gly
1 5 10 15
Met Ile Asp Gly Trp Tyr Gly
20
<210> 5
<211> 15
<212> DNA
<213> Artificial Synthesis
<400> 5
ctctctctct ctctc 15
<210> 6
<211> 15
<212> DNA
<213> Artificial Synthesis
<400> 6
cacacacaca cacac 15
<210> 7
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 7
<210> 8
<211> 21
<212> DNA
<213> Artificial Synthesis
<400> 8
gcacttggca aagccgccct t 21
Claims (16)
1. A nucleic acid drug complex, which is formed by assembling a branched structure, a functional element modified on the branched structure, and a bridging structure connecting the branched structure;
the branched chain structure comprises a supramolecule and a nucleic acid branched chain connected to the supramolecule;
the supramolecules in the branched chain structure include beta-cyclodextrin;
the functional element is assembled on the supermolecule of the branched chain structure through host-guest recognition;
the functional element comprises a functional nucleic acid and/or a functional polypeptide modified with a supramolecular ligand;
the supramolecular ligand includes adamantane;
the functional nucleic acid comprises nucleic acid aptamer MUC 1;
the functional polypeptide comprises an endosome escape peptide;
the bridging structure comprises a complementary strand of nucleic acid branches, a nucleic acid drug, and a disulfide bond linking the complementary strand and the nucleic acid drug;
the bridging structure serves as a connecting chain to connect a plurality of branched structures to form a nucleic acid drug complex.
2. The nucleic acid-drug complex of claim 1, wherein the nucleic acid branch has a nucleic acid sequence shown in SEQ ID NO 1-2.
3. The nucleic acid drug complex of claim 1, wherein the nucleic acid aptamer MUC1 comprises a nucleic acid sequence as shown in SEQ ID NO. 3.
4. The nucleic acid-drug complex of claim 1, wherein the endosome escape peptide comprises an amino acid sequence as set forth in SEQ ID NO. 4.
5. The nucleic acid-drug complex of claim 1, wherein the complementary strand of the nucleic acid branch of the bridging structure is shown in SEQ ID NO 5-6.
6. The nucleic acid drug complex of claim 1, wherein the nucleic acid drug of the bridging structure comprises an antisense nucleic acid of a target gene.
7. The nucleic acid-drug complex of claim 6, wherein the antisense nucleic acid is represented by SEQ ID NO 7-8.
8. The nucleic acid-drug complex of claim 1, wherein the molar ratio of the branched structure, the functional element, and the bridging structure is 1:1: 1-7.
9. A method for preparing a nucleic acid drug complex according to any one of claims 1 to 8, comprising:
(1) constructing a branched chain structure;
(2) constructing a functional element;
(3) the branched structure, the functional element and the bridging structure are assembled to form the nucleic acid drug complex.
10. The method of claim 9, wherein the step (1) of constructing the branched structure comprises the steps of:
(1') converting primary alcohol hydroxyl of beta-cyclodextrin into azide group by taking the beta-cyclodextrin as a supermolecule;
(2') respectively reacting the amino-modified nucleic acid branched chain with DBCO-NHS micromolecules containing alkynyl, and modifying a DBCO functional group at the tail end of the nucleic acid branched chain;
(3') carrying out copper-free click reaction on the nucleic acid branched chain with the end modified with DBCO and beta-cyclodextrin containing azide groups respectively to obtain the branched chain structure.
11. The preparation method of claim 10, wherein the charge ratio of the nucleic acid branch modified with DBCO at the end of the step (3') to the beta-cyclodextrin containing the azide group is 7-14: 1.
12. The method of claim 9, wherein the constructing of the functional element in step (2) comprises amidating crosslinking of adamantane to the functional nucleic acid and/or amidating solid phase synthesis of adamantane to the functional polypeptide.
13. The method according to claim 9, wherein the molar ratio of the branched structure, the functional element and the bridged structure in step (3) is 1:1: 1-7.
14. The method of claim 9, wherein the assembling of step (3) is carried out under the conditions: incubating for 5-10 min at 35-40 ℃, and cooling to 0-4 ℃.
15. Use of a nucleic acid drug complex according to any one of claims 1 to 8 in the preparation of a medicament for the treatment of tumors.
16. The use of claim 15, wherein the tumor comprises any one of breast cancer, liver cancer, ovarian cancer, prostate cancer, non-small cell cancer, head and neck cancer, or non-hodgkin's lymphoma.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910877543.4A CN110478322B (en) | 2019-09-17 | 2019-09-17 | Nucleic acid drug compound and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910877543.4A CN110478322B (en) | 2019-09-17 | 2019-09-17 | Nucleic acid drug compound and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110478322A CN110478322A (en) | 2019-11-22 |
| CN110478322B true CN110478322B (en) | 2021-07-27 |
Family
ID=68557459
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910877543.4A Active CN110478322B (en) | 2019-09-17 | 2019-09-17 | Nucleic acid drug compound and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110478322B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111234034B (en) * | 2020-01-22 | 2021-10-08 | 国家纳米科学中心 | Polypeptide composition for regulating cell membrane receptor and preparation method and application thereof |
| CN111588703B (en) * | 2020-07-14 | 2021-11-23 | 澳门大学 | Supermolecule cell carrier, drug-loading system and preparation method thereof |
| CN112881358B (en) * | 2021-01-28 | 2022-09-27 | 中国地质大学（武汉） | Supermolecule biomolecule nano particle, and synthesis method and application thereof |
| CN114480377A (en) * | 2022-01-27 | 2022-05-13 | 浙江浥眸生物科技有限公司 | Brush-shaped nucleic acid assembly, composite nanoparticles and application of brush-shaped nucleic acid assembly and composite nanoparticles |
| CN114854735B (en) * | 2022-06-07 | 2024-01-30 | 国家纳米科学中心 | Branched-chain nucleic acid structure and preparation method and application thereof |
| CN115011593B (en) * | 2022-06-13 | 2024-03-12 | 国家纳米科学中心 | Higher-order nucleic acid structure and preparation method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104840975A (en) * | 2015-04-24 | 2015-08-19 | 南开大学 | Supermolecular assembly for small interfering RNA targeting delivery and preparation method |
| WO2018109138A1 (en) * | 2016-12-14 | 2018-06-21 | University College Cork - National University Of Ireland, Cork | Cyclodextrin conjugates |
| WO2019022611A2 (en) * | 2017-07-28 | 2019-01-31 | ACADEMISCH ZIEKENHUIS LEIDEN (h.o.d.n. LUMC) | Enhancement of pathogen immunogenicity |
-
2019
- 2019-09-17 CN CN201910877543.4A patent/CN110478322B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104840975A (en) * | 2015-04-24 | 2015-08-19 | 南开大学 | Supermolecular assembly for small interfering RNA targeting delivery and preparation method |
| WO2018109138A1 (en) * | 2016-12-14 | 2018-06-21 | University College Cork - National University Of Ireland, Cork | Cyclodextrin conjugates |
| WO2019022611A2 (en) * | 2017-07-28 | 2019-01-31 | ACADEMISCH ZIEKENHUIS LEIDEN (h.o.d.n. LUMC) | Enhancement of pathogen immunogenicity |
Non-Patent Citations (6)
| Title |
|---|
| A Crosslinked Nucleic Acid Nanogel for Effective siRNA Delivery and Antitumor Therapy;Ding et al.;《Angew. Chem. Int. Ed.》;20181231;第57卷;第3064页摘要及右栏第3段，第3065段式1、左栏第1段及右栏第1段 * |
| A Self-Assembled Platform Based on Branched DNA for sgRNA/Cas9/Antisense Delivery;Liu et al.;《J. Am. Chem. Soc.》;20191115;第141卷;第19032-19037页 * |
| Branched Antisense and siRNACo-Assembled Nanoplatform for Combined Gene Silencing and Tumor Therapy;Liu et al.;《Angew. Chem. Int. Ed.》;20201124;第60卷;第1853-1860页 * |
| Modular Synthesis of Supramolecular DNA Amphiphiles through Host-guest Interactions and their Self-assembly into DNA decorated Nanovesicles;Albert et al.;《Nanoscale》;20170309;第9卷;第5425-5432页 * |
| Self-assembly of DNA Nanohydrogels with Controllable Size and Stimuli-Responsive Property for Targeted Gene Regulation Therapy;Li et al.;《J. Am. Chem. Soc.》;20150112;第137卷;第1412页摘要、第1413页式1及左栏第1段 * |
| 环糊精超分子组装体与核酸的相互作用;陈湧等;《有机化学》;20121231;第32卷;第813页左栏第2段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110478322A (en) | 2019-11-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110478322B (en) | Nucleic acid drug compound and preparation method and application thereof | |
| CN107469088B (en) | Construction method for accurately identifying targeted nano-carrier based on DNA origami and application thereof | |
| JP7267416B2 (en) | Nucleic acid nanoparticles, pharmaceutical composition containing same, drug containing adriamycin and method for producing same | |
| CN103159819A (en) | Synthesis of cholesterol derivative and application thereof in gene transfection | |
| CN112941072A (en) | Nucleic acid self-assembly structure and preparation method and application thereof | |
| CN110711253B (en) | Medicine containing adriamycin and preparation method thereof | |
| CN110960530B (en) | Tacrine-containing medicine, preparation method thereof, pharmaceutical composition and application thereof | |
| CN110960534B (en) | Medicine containing pentafluorouracil, preparation method thereof, pharmaceutical composition and application thereof | |
| KR101183989B1 (en) | Composite for delivering a gene into a cell, preparation method thereof, and method of delivering a gene into a cell using same | |
| CN111150852B (en) | Cisplatin-containing medicine, preparation method thereof, pharmaceutical composition and application thereof | |
| CN111096965B (en) | Medicine containing dihydroartemisinin, preparation method thereof, medicine composition and application thereof | |
| CN110960683B (en) | Medicine containing methotrexate, preparation method thereof, pharmaceutical composition and application thereof | |
| WO2014056414A1 (en) | Reduction stimuli-responsive gene vector system and preparation and use thereof | |
| KR101956450B1 (en) | Nanoparticle complexes for specific delivery of RNA and preparation method thereof | |
| CN114773418B (en) | Nucleic acid aptamer cluster modified nano structure and preparation method and application thereof | |
| CN114904010B (en) | Preparation method and application of layered self-assembled siRNA-loaded nanoparticle | |
| JP2004107272A (en) | Gene therapeutic agent | |
| CN110960684B (en) | Medicine containing 10-hydroxycamptothecin, preparation method thereof, pharmaceutical composition and application thereof | |
| CN110960691B (en) | Gemcitabine-containing medicine, preparation method thereof, pharmaceutical composition and application | |
| CN110960689B (en) | Medicine containing daunorubicin, preparation method thereof, medicine composition and application thereof | |
| CN110960536B (en) | Aspirin-containing medicine, preparation method, pharmaceutical composition and application thereof | |
| CN111068065B (en) | Drug containing oxaliplatin, preparation method thereof, pharmaceutical composition and application thereof | |
| CN110960542B (en) | Medicament containing pirarubicin, preparation method thereof, pharmaceutical composition and application thereof | |
| CN111053765B (en) | Medicine containing paclitaxel, preparation method, pharmaceutical composition and application thereof | |
| CN114306278A (en) | Preparation method of EV-loaded CPP-siRNA nanoparticles, product and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |