CN110960689B - Medicine containing daunorubicin, preparation method thereof, medicine composition and application thereof - Google Patents

Medicine containing daunorubicin, preparation method thereof, medicine composition and application thereof Download PDF

Info

Publication number
CN110960689B
CN110960689B CN201910944097.4A CN201910944097A CN110960689B CN 110960689 B CN110960689 B CN 110960689B CN 201910944097 A CN201910944097 A CN 201910944097A CN 110960689 B CN110960689 B CN 110960689B
Authority
CN
China
Prior art keywords
sequence
nucleic acid
daunorubicin
rna
chain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201910944097.4A
Other languages
Chinese (zh)
Other versions
CN110960689A (en
Inventor
王力源
王萌
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Baiyao Zhida Beijing Nano Biotechnology Co ltd
Original Assignee
Baiyao Zhida Beijing Nano Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Baiyao Zhida Beijing Nano Biotechnology Co ltd filed Critical Baiyao Zhida Beijing Nano Biotechnology Co ltd
Publication of CN110960689A publication Critical patent/CN110960689A/en
Application granted granted Critical
Publication of CN110960689B publication Critical patent/CN110960689B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6921Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere
    • A61K47/6927Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores
    • A61K47/6929Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A61K31/704Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549Sugars, nucleosides, nucleotides or nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/55Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being also a pharmacologically or therapeutically active agent, i.e. the entire conjugate being a codrug, i.e. a dimer, oligomer or polymer of pharmacologically or therapeutically active compounds
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/48Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51Nanocapsules; Nanoparticles
    • A61K9/5107Excipients; Inactive ingredients
    • A61K9/5123Organic compounds, e.g. fats, sugars
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Nanotechnology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Optics & Photonics (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The application provides a medicine containing daunorubicin, a preparation method, a pharmaceutical composition and application thereof. The medicine comprises nucleic acid nanoparticles and daunorubicin, and the daunorubicin is carried on the nucleic acid nanoparticles; the nucleic acid nanoparticle comprises a nucleic acid domain, wherein the nucleic acid domain comprises a sequence a, a sequence b and a sequence c, the sequence a comprises a sequence a1 or a sequence a1 with at least one base insertion, deletion or substitution, the sequence b comprises a sequence b1 or a sequence b1 with at least one base insertion, deletion or substitution, and the sequence c comprises a sequence c1 or a sequence c1 with at least one base insertion, deletion or substitution. The daunorubicin-containing medicine provided by the application has the advantages that the nucleic acid structure domain is modified by the target head, the target targeting property is good, the daunorubicin can be stably delivered, and the reliability is high.

Description

Medicine containing daunorubicin, preparation method thereof, pharmaceutical composition and application thereof
Technical Field
The application relates to the field of medicines, in particular to a medicine containing daunorubicin, a preparation method, a pharmaceutical composition and an application thereof.
Background
Daunorubicin (Daunorubicin, CSA:20830-81-3, molecular formula: C27H29NO10Molecular weight: 527.52) is mainly used for treating acute lymphocytic or granulocytic leukemia with resistance to common antineoplastic drugs, but has short remission stage, so it needs to be combined with other drugs for application. Is orange red needle crystal and is easy to dissolve in water. The aqueous solution is quite stable, has the same effect as adriamycin, can inhibit the synthesis of RNA and DNA by embedding DNA, has obvious effect on RNA and selectively acts on purine nucleoside.
Currently, antitumor antibiotics, including daunorubicin, must be administered at high doses of chemotherapeutic drugs in order to achieve effective therapeutic levels at the tumor site, but systemic administration of high doses can damage healthy normal cells and cause adverse effects in a range of tissues and organs. These adverse effects include immune system suppression (myelosuppression), inflammation and cleansing of the gut mucosa (mucositis), hair loss (alopecia) and organ-specific toxicity, such as cardiotoxicity and neurotoxicity. In order to avoid the adverse reactions, a tumor local administration mode needs to be used for replacing the traditional systemic administration mode so as to achieve the effects of increasing the tumor local drug concentration and reducing the systemic drug concentration. Therefore, how to achieve such local drug delivery and in vitro controlled release has become a focus of research in cancer chemotherapy.
In order to reduce the side effect caused by poor targeting of the active ingredients of the medicine, the medicine delivery carrier is produced, and the function of the carrier is mainly to carry the active ingredients of the medicine and deliver the active ingredients into blood or tissue cells to treat diseases. There are a variety of approaches to achieve targeted delivery of different drugs. This can be accomplished with instruments or apparatus, such as gene guns, electroporators, etc. The methods do not need to use gene vectors, but the transfection efficiency is generally low, the operation is complex, and the damage to tissues is large. It is also mediated by viral vectors, such as adenovirus and lentivirus, etc., and although the viral vectors have high in vitro transfection activity, the immunogenicity and the susceptibility to mutation of the viral vectors bring huge safety hazards to in vivo delivery. And non-viral vectors, especially biodegradable high molecular materials are used for realizing the targeted transportation of the medicine. The advantages of non-viral vectors are mainly that under the condition of ensuring the expected transfection activity, the immunogenicity and a plurality of inflammatory reactions brought by the viral vectors can be greatly reduced.
Of the above-mentioned various targeted delivery approaches, more research is currently focused on the field of non-viral vectors, and is generally designed for several vectors: (a) a cationic liposome; (b) a polycationic gene vector. However, more researches are focused on the modification of polycation gene vectors and cationic liposomes, so that the polycation gene vectors and cationic liposomes are suitable for the targeted delivery of gene substances. Cationic liposomes have high transfection activity in vitro and in vivo, however, normal distribution in vivo is affected due to positive charges on the surface, and meanwhile, the cationic lipids cause immunogenicity and inflammatory reactions in animal experiments. The polycation gene vector is developed more mature at present, however, in the structural design, the targeting group is difficult to ensure on the surface of the structure, a self-design contradiction between toxicity and transfection activity exists, and meanwhile, the connection of the polycation gene vector is difficult to realize nontoxic degradation in vivo.
Therefore, how to improve the delivery reliability of the existing small-molecule drug daunorubicin is one of the difficulties in solving the limited clinical application of the existing daunorubicin drug.
Disclosure of Invention
The main objective of the present application is to provide a daunorubicin-containing drug, a preparation method thereof, a pharmaceutical composition and an application thereof, so as to improve the delivery reliability of the daunorubicin drug.
In order to achieve the above objects, according to one aspect of the present application, there is provided a daunorubicin-containing drug including a nucleic acid nanoparticle and daunorubicin, and the daunorubicin is suspended on the nucleic acid nanoparticle; the nucleic acid nanoparticle comprises a nucleic acid domain, wherein the nucleic acid domain comprises a sequence a, a sequence b and a sequence c, the sequence a comprises a sequence a1 or a sequence a1 with at least one base insertion, deletion or substitution, the sequence b comprises a sequence b1 or a sequence b1 with at least one base insertion, deletion or substitution, and the sequence c comprises a sequence c1 or a sequence c1 with at least one base insertion, deletion or substitution; wherein, the sequence a1 is SEQ ID NO: 1: 5'-CCAGCGUUCC-3' or SEQ ID NO: 2: 5'-CCAGCGTTCC-3', respectively; b1 sequence is SEQ ID NO: 3: 5 '-GGUUCGCCG-3' or SEQ ID NO: 4: 5 '-GGTTCGCCG-3'; c1 sequence is SEQ ID NO: 5: 5'-CGGCCAUAGCGG-3' or SEQ ID NO: 6: 5'-CGGCCATAGCGG-3' are provided.
Further, when the sequence a1 is SEQ ID NO.1, the sequence b1 is SEQ ID NO. 3, and the sequence c1 is SEQ ID NO. 5, at least one of the sequences a, b, and c comprises a sequence in which at least one base is inserted, deleted, or substituted.
Further, base insertions, deletions or substitutions occur at:
(1) 1, 2, 4 or 5 bases from the 5' end of the sequence shown in SEQ ID NO.1 or SEQ ID NO. 2; and/or
(2) Between 8 th to 10 th bases from the 5' end of the sequence shown in SEQ ID NO.1 or SEQ ID NO. 2; and/or
(3) Between the 1 st to 3 rd bases from the 5' end of the sequence shown in SEQ ID NO. 3 or SEQ ID NO. 4; and/or
(4) Between 6 th to 9 th bases from the 5' end of the sequence shown in SEQ ID NO. 3 or SEQ ID NO. 4; and/or
(5) Between the 1 st to 4 th bases from the 5' end of the sequence shown in SEQ ID NO. 5 or SEQ ID NO. 6; and/or
(6) Between the 9 th to 12 th bases from the 5' end of the sequence shown in SEQ ID NO. 5 or SEQ ID NO. 6.
Further, the sequence a, the sequence b and the sequence c self-assemble to form a structure shown in a formula (1):
Figure BDA0002223702040000031
wherein W-C represents a Watson-Crick pair, N and N' represent non-Watson-Crick pairs, and W-C at any position is independently selected from C-G or G-C; in the sequence a, the first N from the 5' end is A, the second N is G, the third N is U or T, and the fourth N is any one of U, T, A, C or G; in the b sequence, the first N 'from the 5' end is any one of U, T, A, C or G; the second N 'is U or T, and the third N' is C; in the c sequence, the NNNN sequence in the 5 'to 3' direction is CAUA or CATA.
Further, the sequence a, the sequence b and the sequence c are any one of the following groups: (1) a sequence: 5'-GGAGCGUUGG-3', sequence b: 5'-CCUUCGCCG-3', c sequence: 5'-CGGCCAUAGCCC-3', respectively; (2) a sequence: 5'-GCAGCGUUCG-3', sequence b: 5'-CGUUCGCCG-3', c sequence: 5'-CGGCCAUAGCGC-3', respectively; (3) a sequence: 5'-CGAGCGUUGC-3', sequence b: 5'-GCUUCGCCG-3', c sequence: 5'-CGGCCAUAGCCG-3', respectively; (4) a sequence: 5'-GGAGCGUUGG-3', sequence b: 5 '-CCUUCGGG-3', c sequence: 5'-CCCCCAUAGCCC-3', respectively; (5) a sequence: 5'-GCAGCGUUCG-3', sequence b: 5'-CGUUCGGCG-3', c sequence: 5'-CGCCCAUAGCGC-3'; (6) a sequence: 5'-GCAGCGUUCG-3', sequence b: 5'-CGUUCGGCC-3', c sequence: 5'-GGCCCAUAGCGC-3'; (7) a sequence: 5'-CGAGCGUUGC-3', sequence b: 5'-GCUUCGGCG-3', c sequence: 5'-CGCCCAUAGCCG-3'; (8) a sequence: 5'-GGAGCGTTGG-3', sequence b: 5'-CCTTCGCCG-3', c sequence: 5'-CGGCCATAGCCC-3'; (9) a sequence: 5'-GCAGCGTTCG-3', sequence b: 5'-CGTTCGCCG-3', c sequence: 5'-CGGCCATAGCGC-3'; (10) a sequence: 5'-CGAGCGTTGC-3', sequence b: 5'-GCTTCGCCG-3', c sequence: 5'-CGGCCATAGCCG-3'; (11) a sequence: 5'-GGAGCGTTGG-3', sequence b: 5'-CCTTCGGGG-3', c sequence: 5'-CCCCCATAGCCC-3', respectively; (12) a sequence: 5'-GCAGCGTTCG-3', sequence b: 5'-CGTTCGGCG-3', c sequence: 5'-CGCCCATAGCGC-3'; (13) a sequence: 5'-GCAGCGTTCG-3', sequence b: 5'-CGTTCGGCC-3', c sequence: 5'-GGCCCATAGCGC-3'; (14) a sequence: 5'-CGAGCGTTGC-3', sequence b: 5'-GCTTCGGCG-3', c sequence: 5'-CGCCCATAGCCG-3' are provided.
Further, the nucleic acid domain also comprises a first extension segment, wherein the first extension segment is a Watson-Crick paired extension segment, and the first extension segment is positioned at the 5 'end and/or the 3' end of any sequence in the sequences a, b and c; preferably, the first elongate section is selected from any one of the following: (1): a 5' end of chain: 5' -CCCA-3', 3' end of c chain: 5 '-UGGG-3'; (2): a 3' end of the chain: 5' -GGG-3', 5' -end of b chain: 5 '-CCC-3'; (3): b 3' end of strand: 5' -CCA-3', 5' end of c chain: 5 '-UGG-3'; (4): a 5' end of the chain: 5' -CCCG-3', 3' end of c chain: 5 '-CGGG-3'; (5): a 5' end of chain: 5' -CCCC-3', 3' end of c strand: 5 '-GGGG-3'; (6): b 3' end of strand: 5' -CCC-3', 5' -end of c strand: 5 '-GGG-3'; (7): b 3' end of strand: 5' -CCG-3', the 5' end of the c chain: 5 '-CGG-3'; (8): a 5' end of the chain: 5' -CCCA-3', 3' end of c chain: 5 '-TGGG-3'; (9): b 3' end of strand: 5' -CCA-3', 5' end of c chain: 5 '-TGG-3'.
Further, the nucleic acid domain also comprises a second extension segment, the second extension segment is positioned at the 5 'end and/or the 3' end of any sequence in the sequence a, the sequence b and the sequence c, and the second extension segment is a Watson-Crick matched extension segment; preferably, the second extension is an extension of a CG base pair; more preferably, the second extension is an extension sequence of 1-10 CG base pairs.
Further, the nucleic acid domain further comprises at least one set of second stretches: a first group: a 5' end of the chain: 5' -CGCGCG-3 ', 3' -end of c chain: 5 '-CGCGCG-3'; second group: a 3' end of chain: 5' -CGCCGC-3 ', 5' -end of b chain: 5 '-GCGGCG-3'; third group: b 3' end of strand: 5' -GGCGGC-3 ', 5' -end of c chain: 5 '-GCCGCC-3'.
Further, the second extension is an extension sequence containing both CG base pairs and AT/AU base pairs, and preferably the second extension is an extension sequence of 2-50 base pairs.
Further, the second extension segment is an extension sequence formed by alternately arranging a sequence of continuous 2-8 CG base pairs and a sequence of continuous 2-8 AT/AU base pairs; alternatively, the second extension is an extended sequence of 1 CG base pair alternating with 1 AT/AU base pair sequence.
Further, bases, ribose and phosphate in the sequence a, the sequence b and the sequence c have at least one modifiable site, and any modifiable site is modified by any one of the following modification linkers: -F, methyl, amino, disulfide, carbonyl, carboxyl, mercapto and aldehyde groups; preferably, the sequence a, sequence b and sequence C have 2' -F modifications at the C or U bases.
Further, the daunorubicin is carried on the nucleic acid nanoparticles in a physical connection and/or covalent connection mode, and the molar ratio of the daunorubicin to the nucleic acid nanoparticles is 2-300: 1, preferably 10-50: 1, and more preferably 15-25: 1.
Further, the nucleic acid nanoparticle further comprises a bioactive substance, wherein the bioactive substance is connected with the nucleic acid structural domain, and the bioactive substance is one or more of a target, fluorescein, interfering nucleic acid siRNA, miRNA, ribozyme, riboswitch, aptamer, RNA antibody, protein, polypeptide, flavonoid, glucose, natural salicylic acid, monoclonal antibody, vitamin, phenolic lecithin and small molecule drugs except daunorubicin.
Further, the relative molecular weight of the nucleic acid domains is denoted as N1The total relative molecular weight of daunorubicin and biologically active substance is denoted as N2,N1/N2≥1:1。
Further, the bioactive substance is one or more of a target, fluorescein and miRNA, wherein the target is located on any one of the sequences a, b and c, preferably the 5' end or the 3' end of any one of the sequences a, b and c, or is inserted between GC bonds of the nucleic acid domains, the miRNA is anti-miRNA, the fluorescein is modified on the 5' end or the 3' end of the anti-miRNA, and the miRNA is located at any one or more of the 3' end of the sequence a, the 5' end and the 3' end of the sequence c; preferably, the target head is folic acid or biotin, the fluorescein is any one or more of FAM, CY5 and CY3, and the anti-miRNA is anti-miR-21.
Further, the small molecule drugs other than daunorubicin are drugs containing any one or more of the following groups: amino groups, hydroxyl groups, carboxyl groups, mercapto groups, phenyl ring groups, and acetamido groups.
Further, the protein is one or more of SOD, survivin, hTERT, EGFR and PSMA; the vitamin is levo-C and/or esterified C; the phenols are tea polyphenols and/or grape polyphenols.
Further, the particle size of the nucleic acid nanoparticles is 1-100 nm, preferably 5-50 nm; more preferably 10-30 nm; further preferably 10 to 15 nm.
According to another aspect of the present application, there is also provided a method for preparing a daunorubicin-containing medicament, comprising the steps of: providing the nucleic acid nanoparticle described above; the daunorubicin is carried on the nucleic acid nanoparticles in a physical connection and/or covalent connection mode to obtain the daunorubicin-containing medicine.
Further, the step of mounting daunorubicin by means of physical attachment comprises: mixing and stirring daunorubicin, nucleic acid nanoparticles and a first solvent to obtain a premixed system; precipitating the premixed system to obtain a medicine containing daunorubicin; preferably, the first solvent is selected from one or more of DCM, DCC, DMAP, Py, DMSO, PBS and glacial acetic acid; preferably, the step of precipitating the premixed system to obtain the daunorubicin-containing medicament comprises: precipitating the premixed system to obtain a precipitate; washing the precipitate to remove impurities to obtain the medicine containing daunorubicin; more preferably, the premixed system is mixed with absolute ethyl alcohol and then precipitated at the temperature lower than 10 ℃ to obtain precipitates; a daunorubicin-containing drug; more preferably, the precipitate is precipitated at a temperature of 0 to 5 ℃ to obtain a precipitate. More preferably, absolute ethyl alcohol with the volume 6-12 times that of the precipitate is adopted to wash and remove impurities, and the medicine containing daunorubicin is obtained.
Further, the step of carrying daunorubicin by covalent attachment comprises: preparing a daunorubicin solution; enabling the daunorubicin solution to react with the amino outside the G ring of the nucleic acid nano-particles under the mediation effect of formaldehyde to obtain a reaction system; purifying the reaction system to obtain a medicine containing daunorubicin; preferably, the step of reacting comprises: mixing the daunorubicin solution with the paraformaldehyde solution and the nucleic acid nanoparticles, and reacting under a dark condition to obtain a reaction system; the concentration of the preferable paraformaldehyde solution is preferably 3.7-4 wt%, the preferable paraformaldehyde solution is a solution formed by mixing paraformaldehyde and a second solvent, and the second solvent is one or more of DCM, DCC, DMAP, Py, DMSO, PBS and glacial acetic acid.
Further, the preparation method further comprises a step of preparing a nucleic acid nanoparticle, which comprises: obtaining a nucleic acid domain by self-assembling the single strand corresponding to the nucleic acid domain; preferably, after obtaining the nucleic acid domain, the method of making further comprises: the bioactive substances are carried on the nucleic acid structural domain in a physical connection and/or covalent connection mode, and then the nucleic acid nano-particles are obtained.
Further, in the process of carrying the bioactive substances in a covalent connection mode, carrying is carried out through solvent covalent connection, linker covalent connection or click link; preferably, the solvent is a third solvent used in the covalent attachment as the attachment medium, and the third solvent is selected from one or more of paraformaldehyde, DCM, DCC, DMAP, Py, DMSO, PBS, and glacial acetic acid; preferably, the linker is selected from the group consisting of disulfide bond, p-azido, bromopropyne, or PEG; preferably, click-linking is performed by alkynyl or azide modification of the biologically active substance precursor and the nucleic acid domain at the same time and then by click-linking.
Further, when the biologically active substance is linked to the nucleic acid domain in a click-link manner, the site of the biologically active substance precursor for the alkynyl or azido modification is selected from the group consisting of a 2 ' hydroxyl group, a carboxyl group, or an amino group, and the site of the nucleic acid domain for the alkynyl or azido modification is selected from the group consisting of a G exocyclic amino group, a 2 ' -hydroxyl group, an A amino group, or a 2 ' -hydroxyl group.
According to a third aspect of the present application, there is also provided a pharmaceutical composition comprising any one of the daunorubicin-containing drugs described above.
According to a fourth aspect of the present application, there is also provided the use of any one of the daunorubicin-containing medicaments described above in the preparation of a medicament for the treatment of a tumor.
Further, the tumor is acute lymphocytic leukemia or granulocytic leukemia.
According to a fifth aspect of the present application, there is also provided a method of preventing and/or treating a tumor, the method comprising: providing any one of the daunorubicin-containing medicaments or pharmaceutical compositions described above; administering an effective amount of the above daunorubicin-containing drug or pharmaceutical composition to a patient with a tumor.
Further, the tumor is acute lymphocytic leukemia or granulocytic leukemia.
The daunorubicin-containing medicine provided by the application comprises nucleic acid nanoparticles and daunorubicin, and the daunorubicin is carried on the nucleic acid nanoparticles in a physical connection and/or covalent connection mode. In the nucleic acid nanoparticle, the three sequences or the variant sequences thereof provided by the application can be contained, so that not only the nucleic acid domains can be formed by self-assembly, but also daunorubicin can be connected to any 5 'end and/or 3' end of the three strands as a carrier, or daunorubicin can be stably inserted between the strands of the nucleic acid domains. According to the application, the small-molecule medicine daunorubicin is loaded on the nucleic acid nanoparticles, the coating effect is achieved on the daunorubicin by utilizing the internal hydrophobicity, the external hydrophilicity and the stacking effect of basic groups of the nucleic acid nanoparticles, and the daunorubicin cannot be dissolved within a certain time due to the coating effect or covalent connection, so that the delivery stability is improved. In addition, when the nucleic acid structure domain is modified by a target head, the target has better targeting property, can stably deliver the daunorubicin and has high reliability; meanwhile, the contact chance of daunorubicin and non-target cells or tissues can be reduced, and the toxic and side effects are reduced.
Drawings
The accompanying drawings, which are incorporated in and constitute a part of this application, are included to provide a further understanding of the application, and the description of the exemplary embodiments and illustrations of the application are intended to explain the application and are not intended to limit the application. In the drawings:
FIG. 1 shows the result of electrophoresis detection of RNA nanoparticles formed by self-assembly in example 1 of the present application;
FIG. 2 shows the result of electrophoresis detection of DNA nanoparticles formed by self-assembly in example 1 of the present application;
FIG. 3 shows the results of 2% agarose gel electrophoresis detection of 7 sets of short-sequence RNA nanoparticles formed by self-assembly in example 2 of the present application;
FIG. 4 shows the results of 4% agarose gel electrophoresis detection of 7 sets of short-sequence RNA nanoparticles formed by self-assembly in example 2 of the present application;
FIG. 5 shows the result of 2% agarose gel electrophoresis detection of 7 sets of conventional sequence RNA nanoparticles formed by self-assembly in example 3 of the present application;
FIG. 6 shows the results of 4% agarose gel electrophoresis detection of 7 sets of conventional sequence RNA nanoparticles formed by self-assembly in example 3 of the present application;
FIG. 7 shows the result of 2% agarose gel electrophoresis detection of 7 sets of conventional sequence DNA nanoparticles formed by self-assembly in example 4 of the present application;
FIG. 8 shows the results of 4% agarose gel electrophoresis detection of 7 sets of conventional sequence DNA nanoparticles formed by self-assembly in example 4 of the present application;
FIG. 9 shows a TEM image of self-assembled DNA nanoparticles D-7 of the present application in example 4;
FIG. 10 shows a standard curve of daunorubicin absorbance during the mounting ratio test in example 5 of the present application;
FIG. 11 shows the microscopic observations of the binding and internalization of the RNAh-Biotin-quasar670 nanoparticles and of the RNAh-Biotin-quasar670-DNR nanoparticles with MCF-7 cells in example 6 of the present application;
FIG. 12 shows the results of electrophoresis of RNAh-Biotin-quasar670-DNR nanoparticles in example 8 of the present application after incubation in serum for various periods of time under the Coomassie Blue program;
FIG. 13 shows the results of electrophoresis of RNAh-Biotin-quasar670-DNR nanoparticles in serum after incubation for various periods of time under the program Stain Free Gel in example 8 of the present application;
FIG. 14 shows the results of detecting the inhibition of MCF-7 cell proliferation by small molecule drugs daunorubicin and RNAh-Biotin-quasar670-DNR nanoparticles in example 9 of the present application;
FIG. 15 shows the results of detecting the inhibition of MCF-7 cell proliferation by the fluorescent targeting vector RNAh-Bio-FAM in example 9 of the present application;
FIG. 16 shows the result of non-denaturing PAGE gel electrophoresis detection of 7 sets of modified-stretch + core short-sequence RNA self-assembly products in example 10 of the present invention;
FIG. 17 shows the dissolution curve of the RNA nanoparticle R-15 in example 10 of the present invention;
FIG. 18 shows the dissolution curve of the RNA nanoparticle R-16 in example 10 of the present invention;
FIG. 19 shows the dissolution curve of RNA nanoparticle R-17 in example 10 of the present invention;
FIG. 20 shows the dissolution curve of the RNA nanoparticle R-18 in example 10 of the present invention;
FIG. 21 shows the dissolution curve of RNA nanoparticle R-19 in example 10 of the present invention;
FIG. 22 shows the dissolution curve of the RNA nanoparticle R-20 in example 10 of the present invention;
FIG. 23 shows the dissolution curve of the RNA nanoparticle R-21 in example 10 of the present invention;
FIG. 24 shows the results of native PAGE gel electrophoresis detection of 7 sets of extended stretch-deformed + core short-sequence DNA self-assembly products in example 11 of the present invention;
FIG. 25 shows a dissolution curve of DNA nanoparticle D-8 in example 11 of the present invention;
FIG. 26 shows a dissolution curve of the DNA nanoparticle D-9 in example 11 of the present invention;
FIG. 27 is a graph showing a dissolution curve of DNA nanoparticle D-10 in example 11 of the present invention;
FIG. 28 shows a dissolution curve of the DNA nanoparticle D-11 in example 11 of the present invention;
FIG. 29 is a graph showing the dissolution profile of the DNA nanoparticle D-12 in example 11 of the present invention;
FIG. 30 is a graph showing a dissolution curve of DNA nanoparticle D-13 in example 11 of the present invention;
FIG. 31 shows the dissolution curve of DNA nanoparticle D-14 in example 11 of the present invention;
FIG. 32 shows the result of electrophoresis detection of the RNA nanoparticle R-15 of example 12 after incubation in serum for various times;
FIG. 33 shows the result of electrophoresis detection of RNA nanoparticle R-16 in example 12 after incubation in serum for various times;
FIG. 34 shows the result of electrophoresis detection of RNA nanoparticle R-17 in example 12 after incubation in serum for different time periods;
FIG. 35 shows the result of electrophoresis detection of RNA nanoparticle R-18 in example 12 after incubation in serum for various times;
FIG. 36 shows the result of electrophoresis detection of the RNA nanoparticle R-19 of example 12 after incubation in serum for various periods of time;
FIG. 37 shows the result of electrophoresis detection of the RNA nanoparticle R-20 in example 12 of the present invention after incubation in serum for various periods of time;
FIG. 38 shows the result of electrophoresis detection of RNA nanoparticle R-21 in example 12 after incubation in serum for various times;
FIG. 39 shows the result of electrophoresis detection of DNA nanoparticle D-8 in example 13 after incubation in serum for various times;
FIG. 40 shows the results of electrophoresis detection of DNA nanoparticles D-9 in example 13 of the present invention after incubation in serum for various periods of time;
FIG. 41 shows the results of electrophoresis detection of DNA nanoparticle D-10 in example 13 of the present invention after incubation in serum for various periods of time;
FIG. 42 shows the result of electrophoresis detection of DNA nanoparticle D-11 in example 13 of the present invention after incubation in serum for various times;
FIG. 43 shows the results of electrophoresis detection of the DNA nanoparticle D-12 of example 13 of the present invention after incubation in serum for various periods of time;
FIG. 44 shows the result of electrophoresis detection of DNA nanoparticle D-13 in example 13 of the present invention after incubation in serum for various times;
FIG. 45 shows the results of electrophoresis detection of DNA nanoparticle D-14 in example 13 of the present invention after incubation in serum for various periods of time;
FIGS. 46a, 46b, 46c, 46D, 46e, 46f, 46g and 46h show cell viability curves for DMSO and the prodrug doxorubicin, D-8 and D-8-doxorubicin, D-9 and D-9-doxorubicin, D-10 and D-10-doxorubicin, D-11 and D-11-doxorubicin, D-12 and D-12-doxorubicin, D-13 and D-13-doxorubicin and D-14-doxorubicin, respectively, in example 16 of the present invention;
FIG. 47 shows a standard curve of daunorubicin absorbance used in the mounting ratio measurement process of example 17.
Detailed Description
It should be noted that the embodiments and features of the embodiments in the present application may be combined with each other without conflict. The present application will be described in detail with reference to examples.
Interpretation of terms:
blank vector: refers to a blank nucleic acid nanoparticle vector, such as RNAh or DNAh, that does not contain any biologically active substance.
Targeting vectors: refers to a nucleic acid nanoparticle vector containing a targeting tip but not containing a fluorescent substance, such as Biotin-RNAh or Biotin-DNAh.
A fluorescent carrier: refers to a nucleic acid nanoparticle vector containing a fluorescent substance but not containing a targeting moiety, such as Cy5-RNAh or Cy 5-DNAh.
Targeting fluorescent vector: refers to a nucleic acid nanoparticle vector containing a target and a fluorescent substance, such as Biotin-Cy5-RNAh or Biotin-Cy 5-DNAh.
Targeting drugs: refers to a nucleic acid nanoparticle vector containing a targeting head, a fluorescent substance and a chemical, such as RNAh-Biotin-quasar670-DNR or DNAh-Biotin-quasar 670-DNR.
It should be noted that there is no specific format in the naming convention of each vector or bioactive substance in the present application, and the fore-and-aft position in the description does not mean that it is at the 5 'end or 3' end of RNAh or DNAh, but means that it contains the bioactive substance.
As mentioned in the background, although there are many drug carriers for improving drug delivery efficiency in the prior art, it is still difficult to solve the problem that the clinical application of drugs is limited. In order to improve the situation, the inventor of the present application has studied all available materials as drug carriers, and has conducted in-depth investigation and analysis on various carriers from the aspects of cell/tissue targeting property of the carriers, stability during transportation, activity and efficiency of entering target cells, drug release capacity after reaching target cells, toxicity to cells and the like, and found that nanostructures formed by self-assembly of emerging DNA and/or RNA molecules, for example, DNA in a self-assembly system of DNA dendrimers, have a significant effect of hindering nuclease degradation, and have very important application values in the fields of gene therapy and biomedicine.
Through analysis of the nanoparticles formed by self-assembly of DNA and RNA reported in the prior art, compared with DNA nanoparticles, RNA nanoparticles have greater flexibility and stronger tension due to a large number of stem-loop structures existing in molecules or between molecules. Therefore, the compound is more advantageous as a candidate drug carrier. However, the stability of RNA nanoparticles in their natural state is relatively poor, and the current improvements based on the application of RNA nanocarriers have mostly been developed around improving their stability and reliability. The current research results, although providing the possibility of drug loading to some extent, focus more on the research on the possibility and effectiveness of the loading of nucleic acid drugs, especially siRNA drugs or miRNA drugs. However, there are few reports on whether non-nucleic acids are equally effective.
In order to solve the problem of poor delivery reliability of daunorubicin drugs in the prior art, the applicant compares and improves the existing RNA nanoparticles, develops a series of new RNA nanoparticles, and further develops another series of DNA nanoparticles which are low in price, easy to operate and excellent in performance from the viewpoint of improving applicability and reducing cost. Experiments prove that the RNA nano-particles and the DNA nano-particles improved by the inventor can both carry daunorubicin and stably exist in serum; further experiments verify that the daunorubicin can be carried into cells, and a single carrier has no toxicity to the cells. And the carrier carrying the daunorubicin can play a role in relieving and treating corresponding diseases.
On the basis of the above research results, the applicant proposed the technical solution of the present application. The application provides a medicine containing daunorubicin, which comprises nucleic acid nanoparticles and daunorubicin, wherein the daunorubicin is carried on the nucleic acid nanoparticles; the nucleic acid nanoparticle comprises a nucleic acid domain, wherein the nucleic acid domain comprises a sequence a, a sequence b and a sequence c, the sequence a comprises a sequence a1 or a sequence a1 with at least one base insertion, deletion or substitution, the sequence b comprises a sequence b1 or a sequence b1 with at least one base insertion, deletion or substitution, and the sequence c comprises a sequence c1 or a sequence c1 with at least one base insertion, deletion or substitution; wherein, the sequence of a1 is SEQ ID NO: 1: 5'-CCAGCGUUCC-3' or SEQ ID NO: 2: 5'-CCAGCGTTCC-3'; b1 sequence is SEQ ID NO: 3: 5 '-GGUUCGCCG-3' or SEQ ID NO: 4: 5 '-GGTTCGCCG-3'; c1 sequence is SEQ ID NO: 5: 5'-CGGCCAUAGCGG-3' or SEQ ID NO: 6: 5'-CGGCCATAGCGG-3' is added.
The daunorubicin-containing medicine provided by the application comprises nucleic acid nanoparticles and daunorubicin, and the daunorubicin is loaded on the nucleic acid nanoparticles. The nucleic acid nanoparticle can be used as a carrier in which daunorubicin is linked to any of the 5 'ends and/or 3' ends of the three strands or can be stably inserted between strands of the nucleic acid domain, as well as a nucleic acid domain formed by self-assembly by including the three sequences or their variant sequences. According to the medicine containing daunorubicin, the small molecule medicine daunorubicin is hung on the nucleic acid nanoparticles, and due to the fact that the nucleic acid nanoparticles are internally hydrophobic, externally hydrophilic and have base stacking effect, the medicine is equivalent to a coating effect on daunorubicin, and the daunorubicin cannot be dissolved within a certain time due to coating or covalent connection, and the delivery stability is improved. In addition, when the nucleic acid structure domain is modified by a target head, the target has better targeting property, can stably deliver the daunorubicin and has high reliability; meanwhile, the contact chance of daunorubicin and non-target cells or tissues can be reduced, and the toxic and side effects are reduced.
The self-assembly refers to a technique in which basic structural units spontaneously form an ordered structure. In the self-assembly process, the basic building blocks spontaneously organize or aggregate into a stable structure with a certain regular geometric appearance under non-covalent bond-based interactions. The self-assembly process is not a simple superposition of weak interaction forces (wherein the weak interaction forces refer to hydrogen bonds, van der waals forces, electrostatic forces, hydrophobic forces and the like) among a large number of atoms, ions or molecules, but a plurality of individuals spontaneously occur simultaneously and are connected in parallel and are combined together to form a compact and ordered whole body, and the self-assembly process is a complex synergistic action of the whole body.
The generation of self-assembly requires two conditions: self-contained power and guidance. The kinetics of self-assembly refers to the synergistic effect of weak interaction forces between molecules, which provides energy for molecular self-assembly. The direction of self-assembly refers to the complementarity of the molecules in space, that is, the occurrence of self-assembly requires the rearrangement of the molecules to be satisfied in the size and direction of space.
The DNA nanotechnology is a mode of molecular self-assembly from bottom to top, spontaneously forming a stable structure based on the physical and chemical properties of nucleic acid molecules, with molecular architecture as the starting point, following strict principles of nucleic acid base pairing. A plurality of DNA fragments are connected together in a correct sequence in vitro, and a sub-assembly structure is established through a base complementary pairing principle, so that a complex multilevel structure is finally formed. Unlike DNA, RNA can be structured beyond the limitations of the double helix. RNA can form a series of different base pairs with at least two hydrogen bonds between them. The different bases can be divided into two types, including standard Watson-Crick base pair type and non-Watson-Crick base pair type, so that the RNA can form a large number of and various types of circulating structure modules, which are basic units constituting the tertiary structure of the folded RNA. RNA nanotechnology can take advantage of these naturally occurring 3D modules and their predictable interactions, where many biologically active RNA structures can have atomic-level resolution, such as ribosomes, various classes of ribozymes, and natural RNA aptamers present in riboswitches. One advantageous feature of RNA nanotechnology is that structures can be designed that are comparable in size and complexity to natural RNA species. The unique assembly properties of RNA within the native RNA complex can also be exploited.
The nucleic acid nanoparticles comprise three sequences shown by SEQ ID NO 1, SEQ ID NO 3 and SEQ ID NO 5 or sequences after variation thereof, or three sequences shown by SEQ ID NO 2, SEQ ID NO 4 and SEQ ID NO 6 or sequences after variation thereof, and the nucleic acid nanoparticles can be formed by self-assembly, and the specific sequence after variation can be obtained by reasonably selecting variation sites and variation types on the basis of the sequences of SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5 and SEQ ID NO 6, or by prolonging suitable fragments.
The nanoparticles formed by self-assembly of SEQ ID NO.1, SEQ ID NO. 3 and SEQ ID NO. 5 are RNA nanoparticles, and the nanoparticles formed by self-assembly of SEQ ID NO. 2, SEQ ID NO. 4 and SEQ ID NO. 6 are DNA nanoparticles. In a preferred embodiment, when the nucleic acid nanoparticle is an RNA nanoparticle, at least one of the sequences a, b, and c comprises a sequence with at least one base insertion, deletion, or substitution. The specific position and the base type of the variant sequence in the RNA nano-particle can be improved into the nano-particle for improving the drug loading capacity or the stability according to the requirement on the premise of realizing self-assembly.
In order to make the nucleic acid nanoparticles have relatively higher stability and further make the medicine obtained by daunorubicin suspension more stable, when base insertion, deletion or substitution is carried out on the sequence shown in SEQ ID NO:1/2, SEQ ID NO:3/4 and/or SEQ ID NO:5/6, base insertion, deletion or substitution can be carried out on the base at certain specific positions of the sequence, on one hand, the sequence after variation is the same as the original sequence and can be self-assembled into the nanoparticles, and on the other hand, the variation keeps at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of homology with the original sequence, so that the nanoparticles formed by self-assembling the sequence have the same medicine carrying property and similar stability, and daunorubicin can be well suspended and delivered.
In a preferred embodiment, the above base insertions, deletions or substitutions occur in: (1) 1 or 2 between the 1 st, 2 nd, 4 th and 5 th bases from the 5' end of the a sequence shown in SEQ ID NO; and/or (2) between 8 th to 10 th bases from the 5' end of the sequence a shown in SEQ ID NO.1 or 2; and/or (3) between 1 to 3 bases from the 5' end of the b sequence shown in SEQ ID NO. 3 or 4; and/or (4) between 6 th and 9 th bases from the 5' end of the b sequence shown in SEQ ID NO. 3 or 4; and/or (5) between the 1 st to 4 th bases from the 5' end of the c sequence shown in SEQ ID NO. 5 or 6; and/or (6) between bases 9 to 12 from the 5' end of the c sequence shown in SEQ ID NO. 5 or 6.
In the above preferred embodiment, the base positions where the mutation is limited are the non-classical Watson-Crick paired base positions or the protruding unpaired base positions in the nanostructure formed by the sequences shown in SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5 and SEQ ID NO 6, thereby not affecting the formation of these protruding or loop structures, and thus maintaining the flexibility and tension of the nanostructure formed by the above sequences, which helps to maintain their stability as a carrier.
In order to further improve the stability of the nucleic acid nanoparticles and further improve the stability of the drug formed after daunorubicin is carried, in a preferred embodiment, the sequence a, the sequence b and the sequence c are self-assembled into a structure shown in formula (1):
Figure BDA0002223702040000121
wherein W-C represents Watson-Crick pairing, N and N ' represent non-Watson-Crick pairing, each W-C at any position is independently selected from C-G or G-C, and the two bases at the 5' end and 3' end of each of at least two of the a, b, and C sequences are not complementary; in the sequence a, the first N from the 5' end is A, the second N is G, the third N is U or T, and the fourth N is any one of U, T, A, C or G; in the b sequence, the first N 'from the 5' end is any one of U, T, A, C or G; the second N 'is U or T, and the third N' is C; among the c sequences, the NNNN sequence in the 5 'to 3' direction is CAUA or CATA.
In the preferred embodiment, the sequences a, b and C form a nucleic acid domain having the formula (1) by self-assembly, wherein the bases at the other positions except for the non-Watson-Crick base pairs defined by N and N' form a classical Watson-Crick pair, and the bases of the Watson-Crick pair are selected from G-C or C-G base pairs. The nucleic acid nanostructure is more stable because the force of hydrogen bonds between G-C or C-G base pairs is greater than the force of hydrogen bonds between A-U/T or U/T-A base pairs. And a bulge or loop structure formed by non-Watson-Crick pairing base brings higher tension to the nucleic acid nano-carrier, so that the adaptability of the nucleic acid nano-carrier to microenvironment change is stronger, and the stability of the nucleic acid nano-particle is higher.
In the nanoparticles having the structure of formula (1), the specific sequence composition of the a sequence, the b sequence and the c sequence is not particularly limited as long as the structure can be formed. From the viewpoint of self-assembly of nucleic acid sequences, in order to further improve the efficiency of self-assembly of the three sequences into the nanoparticle having the structure of formula (1), when selecting the bases paired in Watson-Crick, the bases at different positions are preferably selected according to the following principle: (1) a sequence a, a sequence b and a sequence c, wherein when one sequence is independent, self-complementary pairing is not performed to form a secondary structure; (2) and one end of any two sequences is complementarily paired to form a double chain, and the other end of the two sequences is not complementarily paired to form a Y-shaped or T-shaped structure. The principle of the base selection is to make the two ends of any one strand complementary and paired with the two ends of the other two strands respectively to improve the self-assembly efficiency. Of course, in addition to the Y-type or T-type structure, other variants such as tetragons other than trifurcations may be used as long as the principle that one end of any two sequences is complementarily paired to form a double strand and the other end is not complementarily paired is satisfied.
In the nanoparticle with the structure of the formula (1), in the non-Watson-Crick pairing base, the fourth N from the 5' end in the a sequence and the first N ' from the 5' end in the b sequence can be non-Watson-Crick pairing U-U, or modified T, A, C or G following the Watson-Crick pairing principle. The Watson-Crick pairing relatively improves the bonding force between chains and improves the stability, but the non-Watson-Crick pairing endows the nano particles with greater flexibility and is also beneficial to improving the stability of the nano particles in the face of microenvironment change.
In a preferred embodiment, the sequence a, the sequence b and the sequence c are any one of the following groups: (1) a sequence (SEQ ID NO: 7): 5'-GGAGCGUUGG-3', b sequence (SEQ ID NO: 8): 5'-CCUUCGCCG-3', c sequence (SEQ ID NO: 9): 5'-CGGCCAUAGCCC-3', respectively; (2) a sequence (SEQ ID NO: 10): 5'-GCAGCGUUCG-3', b sequence (SEQ ID NO: 11): 5 '-CGUUCGCCGC-3', c sequence (SEQ ID NO: 12): 5'-CGGCCAUAGCGC-3', respectively; (3) a sequence (SEQ ID NO: 13): 5'-CGAGCGUUGC-3', b sequence (SEQ ID NO: 14): 5 '-GCUUCGCCGCCG-3', c sequence (SEQ ID NO: 15): 5'-CGGCCAUAGCCG-3'; (4) a sequence (SEQ ID NO: 16): 5'-GGAGCGUUGG-3', b sequence (SEQ ID NO: 17): 5 '-CCUUCGGG-3', c sequence (SEQ ID NO: 18): 5'-CCCCCAUAGCCC-3', respectively; (5) a sequence (SEQ ID NO: 19): 5'-GCAGCGUUCG-3', b sequence (SEQ ID NO: 20): 5'-CGUUCGGCG-3', c sequence (SEQ ID NO: 21): 5'-CGCCCAUAGCGC-3'; (6) a sequence (SEQ ID NO: 22): 5'-GCAGCGUUCG-3', b sequence (SEQ ID NO: 23): 5'-CGUUCGGCC-3', c sequence (SEQ ID NO: 24): 5'-GGCCCAUAGCGC-3'; (7) a sequence (SEQ ID NO: 25): 5'-CGAGCGUUGC-3', b sequence (SEQ ID NO: 26): 5'-GCUUCGGCG-3', c sequence (SEQ ID NO: 27): 5'-CGCCCAUAGCCG-3', respectively; (8) a sequence (SEQ ID NO: 28): 5'-GGAGCGTTGG-3', b sequence (SEQ ID NO: 29): 5'-CCTTCGCCG-3', c sequence (SEQ ID NO: 30): 5'-CGGCCATAGCCC-3', respectively; (9) a sequence (SEQ ID NO: 31): 5'-GCAGCGTTCG-3', b sequence (SEQ ID NO: 32): 5'-CGTTCGCCG-3', c sequence (SEQ ID NO: 33): 5'-CGGCCATAGCGC-3', respectively; (10) a sequence (SEQ ID NO: 34): 5'-CGAGCGTTGC-3', b sequence (SEQ ID NO: 35): 5'-GCTTCGCCG-3', c sequence (SEQ ID NO: 36): 5'-CGGCCATAGCCG-3'; (11) a sequence (SEQ ID NO: 37): 5'-GGAGCGTTGG-3', b sequence (SEQ ID NO: 38): 5'-CCTTCGGGG-3', c sequence (SEQ ID NO: 39): 5'-CCCCCATAGCCC-3'; (12) a sequence (SEQ ID NO: 40): 5'-GCAGCGTTCG-3', b sequence (SEQ ID NO: 41): 5'-CGTTCGGCG-3', c sequence (SEQ ID NO: 42): 5'-CGCCCATAGCGC-3'; (13) a sequence (SEQ ID NO: 43): 5'-GCAGCGTTCG-3', b sequence (SEQ ID NO: 44): 5'-CGTTCGGCC-3', c sequence (SEQ ID NO: 45): 5'-GGCCCATAGCGC-3', respectively; (14) a sequence (SEQ ID NO: 46): 5'-CGAGCGTTGC-3', b sequence (SEQ ID NO: 47): 5'-GCTTCGGCG-3', c sequence (SEQ ID NO: 48): 5'-CGCCCATAGCCG-3' are provided.
The nucleic acid nanoparticles formed by self-assembly of the fourteen groups of sequences not only have higher stability, but also have higher self-assembly efficiency.
The nucleic acid nanoparticles mentioned above can be not only self-assembled and molded, but also have the ability to carry or carry daunorubicin drugs. Depending on the position of G-C or C-G base pairs in the nucleic acid nanoparticles, the amount of daunorubicin carried may vary.
In order to make the nucleic acid domain capable of carrying more daunorubicin and bioactive substances (see the description of the bioactive substances below), in a preferred embodiment, the nucleic acid domain further comprises a first extension, the first extension is a Watson-Crick paired extension, and the first extension is located at the 5 'end and/or the 3' end of any one of the a sequence, the b sequence and the c sequence. A certain matching relationship is required between the carrier and the carried substance, and when the molecular weight of the carrier is too small and the molecular weight of the carried substance is too large, the carrying or transporting capacity of the carrier to the carried substance is relatively reduced from the mechanical point of view. Therefore, a vector matching the size of the loaded substance can be obtained by adding a first extension to the 5 'end and/or the 3' end of any one of the a sequence, the b sequence and the c sequence based on the nucleic acid nanostructure.
The specific length of the first extension segment can be determined according to the size of the substance to be carried. In a preferred embodiment, the first elongate section is selected from any one of the following: (1): a 5' end of chain: 5' -CCCA-3', 3' end of c strand: 5 '-UGGG-3'; (2): a 3' end of the chain: 5' -GGG-3', 5' -end of b chain: 5 '-CCC-3'; (3): b 3' end of strand: 5' -CCA-3', 5' end of c chain: 5 '-UGG-3'; (4): a 5' end of chain: 5' -CCCG-3', 3' end of c strand: 5 '-CGGG-3'; (5): a 5' end of the chain: 5' -CCCC-3', 3' end of c chain: 5 '-GGGG-3'; (6): b 3' end of strand: 5' -CCC-3', 5' -end of c strand: 5 '-GGG-3'. (7): b 3' end of strand: 5' -CCG-3', the 5' end of the c chain: 5 '-CGG-3'; (8): a 5' end of the chain: 5' -CCCA-3', 3' end of c chain: 5 '-TGGG-3'; (9): b 3' end of strand: 5' -CCA-3', 5' end of c chain: 5 '-TGG-3'.
The first extension not only increases the length of any one or more of the three sequences forming the nucleic acid nanostructure, but also the first extension composed of GC bases further improves the stability of the formed nanoparticles. Moreover, the first extension segment composed of the sequence also keeps higher self-assembly activity and efficiency of the sequence a, the sequence b and the sequence c.
From the viewpoint of the size of the formed nucleic acid nanoparticles and the stability thereof when transported in vivo as a drug delivery vehicle, it is desirable to be able to transport the drug while trying not to be filtered out by the kidney until reaching the target cells. In a preferred embodiment, the nucleic acid domain further comprises a second extension located 5 'and/or 3' to any of the a sequence, the b sequence and the c sequence, the second extension being a Watson-Crick paired extension; more preferably, the second extension is an extension of a CG base pair; further preferably, the second extension is an extension sequence of 1-10 CG base pairs.
In a preferred embodiment, the above-mentioned nucleic acid domain further comprises at least one set of second stretches: a first group: a 5' end of the chain: 5' -CGCGCG-3 ', 3' end of c chain: 5 '-CGCGCG-3'; second group: a 3' end of the chain: 5' -CGCCGC-3 ', 5' -end of b chain: 5 '-GCGGCG-3'; third group: b 3' end of strand: 5' -GGCGGC-3 ', 5' -end of c chain: 5 '-GCCGCC-3'. This second extension renders the nanoparticle non-immunogenic and non-existent in the case of secondary structures to which each chain folds on itself.
It should be noted that the extension may also be separated by unpaired base pairs.
In order to make the nucleic acid nanoparticle capable of carrying a bioactive substance with a larger molecular weight (see introduction of bioactive substances below), increasing drug loading rate and maintaining necessary stability, in a preferred embodiment, the second extension is an extension containing both CG base pairs and AT/AU base pairs, preferably the second extension is an extension of 2-50 base pairs. Here, the "/" in "AT/AU base" is in the relationship of or, specifically, the second extension is an extended sequence containing both CG base pairs and AT base pairs, or the second extension is an extended sequence containing both CG base pairs and AU base pairs.
More specifically, the sequences a, b and c after adding the above second extension may be the following sequences, respectively:
sequence a is (SEQ ID NO: 49):
Figure BDA0002223702040000151
b is (SEQ ID NO: 50):
Figure BDA0002223702040000152
sequence c is (SEQ ID NO: 51):
Figure BDA0002223702040000153
m in the sequence a, the sequence b and the sequence c is U or T, and when M is T, the synthesis cost of the sequences is greatly reduced.
In practical application, the specific arrangement positions of the CG base pairs and the extended sequences of the AT/AU base pairs can be reasonably adjusted according to actual needs. In a more preferred embodiment, the second extension is an extension sequence formed by alternating a sequence of 2 to 8 CG base pairs and a sequence of 2 to 8 AT/AU base pairs; or the second extension is an extension sequence with 1 CG base pair sequence and 1 AT/AU base pair sequence arranged alternately.
Specifically, the positions of the CGCGCG extension and CGCCGC extension in the sequence a shown by the SEQ ID NO. 49 and the AAAAAA extension are interchanged, the positions of the GCGGCG extension and GGCGGC extension and TTTTTT extension in the sequence b shown by the SEQ ID NO. 50 and the positions of the GCCGCC extension and AAAAAAAA extension in the sequence c shown by the SEQ ID NO. 51 are interchanged, and the CGCCGC extension and TTTTTT extension are interchanged. The nucleic acid nanoparticles formed by self-assembly of the sequences are suitable for carrying bioactive substances with indole molecular structures (indole molecules are preferably combined with A).
Three major challenges that have existed as building materials for widespread use in RNA over the past years include: 1) susceptibility to rnase degradation; 2) susceptibility to dissociation after systemic injection; 3) toxicity and adverse immune response. These three challenges have been largely overcome at present: 1) 2 '-fluoro (2' -F) or 2 '-O-methyl (2' -OMe) modification of the ribose-OH group can chemically stabilize RNA in serum; 2) certain naturally occurring ligation motifs are thermodynamically stable and can keep the entire RNA nanoparticle intact at ultra-low concentrations; 3) the immunogenicity of the RNA nanoparticles is sequence and shape dependent and can be adjusted to allow the RNA nanoparticles to stimulate the production of inflammatory cytokines or to render the RNA nanoparticles non-immunogenic and non-toxic for repeated intravenous administration of 30 mg/kg.
Therefore, in order to further reduce the susceptibility of the nucleic acid nanoparticles to rnase degradation and increase the stability during transportation, in a preferred embodiment, the bases, ribose and phosphate in the a sequence, the b sequence and the c sequence have at least one modifiable site, and any modifiable site is modified by any one of the following modification linkers: -F, methyl, amino, disulfide, carbonyl, carboxyl, mercapto and aldehyde groups; preferably, the sequence a, sequence b and sequence C have 2' -F modifications at the C or U bases. When the modified joint is sulfydryl, the modified joint belongs to sulfo modification, the modification strength is weak, and the cost is low.
The daunorubicin can be mounted through physical connection and/or covalent connection. When daunorubicin is simultaneously linked to the nucleic acid domain by both physical insertion and covalent linkage, the physical insertion is usually between GC base pairs, and the number of preferred insertion sites is 1-100: the ratio of 1 was inserted. When covalent attachment is used, daunorubicin will usually react with the amino group outside the G ring to form a covalent attachment. More preferably, the molar ratio of daunorubicin to nucleic acid nanoparticles is 2-300: 1, preferably 2-290: 1, more preferably 2-29: 1, even more preferably 10-50: 1, and most preferably 15-25: 1.
In addition to the daunorubicin-containing drug provided by the present application, the nucleic acid nanoparticle serves as a delivery vehicle for daunorubicin, and in a preferred embodiment, the nucleic acid nanoparticle further comprises a bioactive substance, and the bioactive substance is connected with the nucleic acid domain according to different drug purposes. The bioactive substances are one or more of targets, fluorescein, siRNA (interfering nucleic acid), miRNA, ribozymes, riboswitches, aptamers, RNA antibodies, proteins, polypeptides, flavonoids, glucose, natural salicylic acid, monoclonal antibodies, vitamins, phenols, lecithin and small molecule drugs except daunorubicin.
In order to improve the efficiency of loading and carrying nucleic acid nanoparticles with respect to the loaded bioactive substances, the relative molecular weights of the nucleic acid domains and the relative molecular weights of daunorubicin and bioactive substances are preferably matched. In a preferred embodiment, the relative molecular weight of the nucleic acid domains is denoted as N1The total relative molecular weight of daunorubicin and biologically active substance is denoted as N2,N1/N2≥1:1。
The daunorubicin-containing drugs in the present application have different performance optimization depending on the kind of the specific bioactive substance to be carried. For example, when the bioactive substance is biotin or folic acid, it serves to target the daunorubicin-containing drug, e.g., specifically to cancer cells. When the bioactive substance is fluorescein, it acts to provide a luminescent tracer effect to the nucleic acid nanoparticles, such as may be one or more of FAM, CY3, CY5, or Quasar670, and the like. When the bioactive substances are certain siRNA, miRNA, protein, polypeptide, RNA antibody and micromolecule drugs except daunorubicin, the daunorubicin-containing drugs can become new products with specific treatment effects, such as drugs with more excellent performance, according to different biological functions.
In a preferred embodiment, the bioactive substances are target heads, fluorescein and miRNA, wherein the target heads are located on any sequence of a, b and c sequences, preferably on the 5' end or the 3' end of any sequence of a, b and c, or are inserted between GC bonds of the nucleic acid structure domain, the miRNA is anti-miRNA, the fluorescein is modified on the 5' end or the 3' end of the anti-miRNA, and the miRNA is located at any one or more positions of the 3' end of the a sequence, the 5' end and the 3' end of the c sequence; preferably, the target head is folic acid or biotin, the fluorescein is any one or more of FAM, CY5 and CY3, and the anti-miRNA is anti-miR-21.
The target head can be connected to any sequence of a sequence, b sequence and c sequence through a linker covalent connection mode, and the available linker is selected from disulfide bond, p-azido group, bromopropyne or PEG. As used herein, "on any sequence" refers to any base position of any sequence of a, b, c, and is more convenient to attach to the 5 'end or 3' end, and is more widely applicable. Folate modification can be either physical intercalation mode of ligation or physical intercalation + covalent ligation.
The fluorescein may be any one or more of conventional fluorescein, preferably FAM, CY5 and CY 3.
The miRNA can be miRNA with cancer inhibiting effect, or anti-miRNA capable of inhibiting corresponding diseases, and is reasonably selected according to medical needs in practical application. The anti-miRNA may be synthesized at any one or more of the 3' end of the a sequence, the 5' end and the 3' end of the c sequence. When anti-miRNA is synthesized at all of the above three positions, the inhibitory effect of the anti-miRNA on the corresponding miRNA is relatively stronger.
Preferably, the miR-21 is resistant to miR-21, and miR-21 is involved in the initiation and progression of various cancers and is a main oncogene for invasion and metastasis. The anti-miR-21 can effectively and simultaneously regulate a wide range of target genes, and is beneficial to solving the problem of heterogeneity of cancers. Thus, in the preferred nucleic acid nanoparticles, the target head, such as folate or biotin, can specifically target cancer cells, and after internalization in combination with the cancer cells, the anti-miR-21 is complementary to miR-21 base with very high affinity and specificity, thereby effectively reducing the expression of oncogenic miR-21. Therefore, the anti-miR-21 can be synthesized at any one or more of the 3' end of the a sequence, the 5' end and the 3' end of the c sequence according to actual needs. When the anti-miR-21 is synthesized at all three positions, the inhibition effect of the anti-miR-21 on miR-21 is relatively stronger.
When the bioactive substances capable of being carried are other small-molecule drugs except daunorubicin, the drugs include, but are not limited to, drugs for treating liver cancer, gastric cancer, lung cancer, breast cancer, head and neck cancer, uterine cancer, ovarian cancer, melanoma, leukemia, senile dementia, ankylosing spondylitis, malignant lymphoma, bronchial cancer, rheumatoid arthritis, HBV hepatitis B, multiple myeloma, pancreatic cancer, non-small cell lung cancer, prostate cancer, nasopharyngeal carcinoma, esophageal cancer, oral cancer and lupus erythematosus disease according to the types of diseases which can be treated by different drugs; preferably, the head and neck cancer is brain cancer, neuroblastoma or glioblastoma.
When the bioactive substance capable of being carried is a small molecule drug other than daunorubicin, the bioactive substance includes, but is not limited to, drugs containing any one or more of the following groups according to differences in molecular structures of the drugs or differences in characteristic groups possessed by the drugs: amino groups, hydroxyl groups, carboxyl groups, mercapto groups, phenyl ring groups, and acetamido groups.
In a preferred embodiment, the protein is one or more of antibodies or aptamers to SOD (superoxide dismutase), Survivin (Survivin), hTERT (human telomerase reverse transcriptase) and EGFR (epidermal growth factor receptor), PSMA (prostate specific membrane antigen); the vitamin is levo-C and/or esterified C; the phenols are tea polyphenols and/or grape polyphenols.
In a preferred embodiment, the particle size of the nucleic acid nanoparticles is 1 to 100nm, preferably 5 to 50nm, more preferably 10 to 30nm, and further preferably 10 to 15 nm. Within this range the size is suitable both for entering the cell membrane by cell surface receptor mediated phagocytosis and for being removed by renal filtration avoiding non-specific cell permeation, and therefore the favourable particle size contributes to improved pharmacokinetic, pharmacodynamic, biological and toxicological profiles.
According to a second aspect of the present application, there is also provided a method for preparing the daunorubicin-containing medicament described above, comprising the steps of: providing any one of the nucleic acid nanoparticles described above; the daunorubicin is carried on the nucleic acid nanoparticles in a physical connection and/or covalent connection mode to obtain the daunorubicin-containing medicine.
When physical attachment is used, daunorubicin is typically inserted between the GC base pairs by physical intercalation. When covalent attachment is used, daunorubicin will usually react with the amino group outside the G ring to form a covalent attachment. The medicine containing daunorubicin prepared by the method has better targeting property after being modified by the target head, can stably deliver the daunorubicin and has high reliability.
In a preferred embodiment, the step of mounting daunorubicin by means of physical attachment comprises: mixing and stirring daunorubicin, nucleic acid nanoparticles and a first solvent to obtain a premixed system; and precipitating the premixed system to obtain the medicine containing daunorubicin. The dosage of the daunorubicin and the nucleic acid nanoparticles can be adjusted according to the change of the loading amount, which can be understood by those skilled in the art and will not be described herein.
In order to improve the efficiency and stability of physical connection, the amount of daunorubicin added per liter of first solvent is preferably 0.1-1 g. Preferably, the first solvent is selected from one or more of DCM, DCC, DMAP, Py, DMSO, PBS and glacial acetic acid. Preferably, the step of precipitating the premixed system to obtain the daunorubicin-containing medicament comprises: precipitating the premixed system to obtain precipitates; washing the precipitate to remove impurities to obtain the medicine containing daunorubicin. More preferably, the premix system is mixed with absolute ethyl alcohol and then precipitated at a temperature of less than 10 ℃ to obtain a precipitate, and still more preferably, the precipitate is precipitated at a temperature of 0 to 5 ℃ to obtain a precipitate. More preferably, absolute ethyl alcohol with the volume 6-12 times that of the precipitate is adopted to wash and remove impurities, and the medicine containing daunorubicin is obtained.
In a preferred embodiment, the step of loading daunorubicin by covalent attachment comprises: preparing a daunorubicin solution; enabling the daunorubicin solution to react with the amino outside the G ring of the nucleic acid nanoparticles under the mediated action of formaldehyde to obtain a reaction system; purifying the reaction system to obtain the medicine containing daunorubicin.
By formaldehyde-mediated form, the following reactions can occur:
Figure BDA0002223702040000181
preferably, the step of reacting comprises: mixing the daunorubicin solution, the paraformaldehyde solution and the nucleic acid nanoparticles, and reacting under a dark condition to obtain a reaction system. The paraformaldehyde solution can release formaldehyde small molecules so as to participate in the chemical reaction. In order to improve the reaction efficiency, the concentration of the paraformaldehyde solution is preferably 3.7-4 wt%, the paraformaldehyde solution is preferably a solution formed by mixing paraformaldehyde and a second solvent, and the second solvent is one or more of DCM, DCC, DMAP, Py, DMSO, PBS and glacial acetic acid.
In the above preparation method, the nucleic acid nanoparticles may be prepared by a self-assembly form such as: (1) mixing RNA or DNA single strands a, b and c at the same time, and dissolving in DEPC water or TMS buffer solution; (2) heating the mixed solution to 80 ℃/95 ℃ (wherein the RNA assembly temperature is 80 ℃, and the DNA assembly temperature is 95 ℃), keeping for 5min, and then slowly cooling to room temperature at the speed of 2 ℃/min; (3) loading the product on 8% (m/V) native PAGE gel and electrophoretically purifying the complex at 100V in TBM buffer at 4 ℃; (4) cutting off a target band, eluting in RNA/DNA elution buffer solution at 37 ℃, precipitating with ethanol overnight, and volatilizing at low temperature under reduced pressure to obtain a self-assembly product, namely a nucleic acid structural domain, thereby obtaining the nucleic acid nanoparticles.
In order to provide the daunorubicin-containing drug with other functions as required for practical use, in a preferred embodiment, after obtaining the nucleic acid domain, the preparation method further comprises: the aforementioned bioactive substances are carried on the nucleic acid domain by means of physical linkage and/or covalent linkage, thereby obtaining the nucleic acid nanoparticles. The biologically active substance may also be attached by physical and/or covalent attachment. Forms of covalent attachment include, but are not limited to, mounting by solvent covalent attachment, linker covalent attachment, or click linkage; preferably, the solvent is a third solvent used in the covalent attachment as the attachment medium, and the third solvent is selected from one or more of paraformaldehyde, DCM, DCC, DMAP, Py, DMSO, PBS, and glacial acetic acid; preferably, the linker is selected from the group consisting of disulfide bond, p-azido, bromopropyne, or PEG; preferably, click-linking is performed by alkynyl or azido modification of the biologically active substance precursor and the nucleic acid domain simultaneously, followed by click-linking.
The above classification does not mean that a certain bioactive substance is linked to a nucleic acid domain in only one manner. Instead, some bioactive substances may be linked to the nucleic acid domain by physical intercalation, by covalent linkage, or by click linkage. However, for a particular biologically active substance, there may be only one type of attachment, or there may be multiple types of attachment, but there may be some type of attachment that has a beneficial utility.
In the above connection method, when different drugs are physically inserted into the nucleic acid domains, the number and binding sites of the insertion are slightly different. For example, when the anthracycline and acridine drugs are inserted, the drugs are usually inserted between GC base pairs, and the number of the preferred insertion sites is 1 to 100: the ratio of 1 was inserted. When the naphthamide drug is inserted, the naphthamide drug is usually inserted between AA base pairs, the preferable number of insertion sites is different according to the number of the AA base pairs on the nucleic acid structural domain, and the pyridocarbazoles are inserted according to the difference of the number of the AA base pairs in the range of 1-200: 1, and inserting.
Specifically, the molar ratio of biologically active substance to nucleic acid domain can be reasonably selected for physical intercalation depending on the species of biologically active substance, the length of the a, b and c sequences forming the nucleic acid domain in the nucleic acid nanoparticle, and how many complementary base pairs of GC are present therein.
In a preferred embodiment, when the bioactive substance and the nucleic acid domain are physically intercalated and covalently linked, the molar ratio of the bioactive substance physically intercalated and linked to the drug covalently linked is 1-200: 1. the connection mode is suitable for anthracycline and acridine medicines. The proportion of the drugs connected in different connection modes is not limited to the range, and the drugs can be effectively suspended, have no toxic effect on cells and can be effectively released after reaching a target.
When the bioactive substance precursor and the nucleic acid structural domain are simultaneously subjected to alkynyl or azide modification and connected in a click-to-link mode, different click-to-links are selected according to different structural changes of the medicament. And the attachment position may be changed correspondingly according to the structure of the active material, which can be understood by those skilled in the art.
In a preferred embodiment, where the biologically active substance is linked to the nucleic acid domain in a click-link fashion, the site of the alkyne or azide modification of the biologically active substance precursor is selected from the group consisting of hydroxyl, carboxyl, sulfhydryl, or amino, and the site of the alkyne or azide modification of the nucleic acid domain is selected from the group consisting of amino, imino, or hydroxyl.
According to a third aspect of the present application, there is also provided a pharmaceutical composition comprising any one of the daunorubicin-containing drugs described above. Specifically, according to actual needs, a suitable combination drug or adjuvant can be selected to form a drug combination having a combined drug effect or capable of improving certain properties (such as stability) of the drug.
According to a fourth aspect of the present application, there is also provided the use of any one of the daunorubicin-containing medicaments described above in the preparation of a medicament for the treatment of a tumor. Further, the tumor is acute lymphocytic leukemia or granulocytic leukemia. Specific application can be to improve the medicament per se on the basis of the medicament to obtain a new medicament, or to prepare the medicament as a main active ingredient into a preparation with a proper dosage form and the like.
According to a fifth aspect of the present application, there is also provided a method of preventing and/or treating a tumor, the method comprising: providing any one of the daunorubicin-containing medicaments or pharmaceutical compositions described above; administering an effective amount of the above daunorubicin-containing medicament or pharmaceutical composition to a patient with a tumor. Further, the tumor is acute lymphocytic leukemia or granulocytic leukemia.
An effective amount herein includes a prophylactically effective amount and/or a therapeutically effective amount, by which is meant an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result, e.g., reduction of symptoms. In a particular embodiment, the dosage may be adjusted to provide an optimal therapeutically responsive dose, and the therapeutically effective amount may vary depending on the following factors: the disease state, age, sex, weight of the individual and the ability of the formulation to elicit a desired response in the individual. A therapeutically effective amount is also meant to include an amount by which the beneficial effect of the treatment exceeds its toxic or detrimental effects. A prophylactically effective amount refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result, such as prevention or inhibition of leukemia development. A prophylactically effective amount can be determined according to the description of a therapeutically effective amount above. For any particular subject, specific dosages may be adjusted over time according to the individual need and the professional judgment of the person to whom they are administered.
It should be noted that the nucleic acid nanoparticles formed by self-assembly of the sequences or sequence variants provided herein can also be used as basic building blocks, and can be further polymerized to form multimers, such as dimers, trimers, tetramers, pentamers, hexamers, heptamers, etc., according to the practical application.
The advantageous effects of the present application will be further described with reference to specific examples.
Assembly of nucleic acid nanoparticles
Example 1
One, RNA and DNA nanoparticle vector:
(1) the three polynucleotide base sequences that make up the RNA nanoparticles are shown in table 1:
table 1:
Figure BDA0002223702040000211
(2) three polynucleotide base sequences of DNA nanoparticles
The DNA has the same sequence as that of the RNA described above except that T is substituted for U. Wherein the molecular weight of the a chain is 8802.66, the molecular weight of the b chain is 8280.33, and the molecular weight of the c chain is 9605.2.
The strands a, b and c of the RNA nanoparticles and DNA nanoparticles were synthesized by Competition Biotechnology, Inc. (Shanghai).
II, self-assembly experiment steps:
(1) mixing RNA or DNA single strands a, b and c at the same time according to the molar ratio of 1:1:1, and dissolving in DEPC water or TMS buffer solution;
(2) heating the mixed solution to 80 ℃/95 ℃ (wherein the RNA assembly temperature is 80 ℃, and the DNA assembly temperature is 95 ℃), keeping for 5min, and then slowly cooling to room temperature at the speed of 2 ℃/min;
(3) loading the product on 8% (m/V) native PAGE gel and electrophoretically purifying the complex at 100V in TBM buffer at 4 ℃;
(4) cutting off a target band, eluting in an RNA/DNA elution buffer solution at 37 ℃, precipitating with ethanol overnight, and volatilizing at low temperature under reduced pressure to obtain a self-assembly product;
(5) and (5) electrophoretic analysis detection.
Third, self-assembly experimental results
Results of electrophoresis
The result of electrophoresis detection of the RNA self-assembly product is shown in FIG. 1. In fig. 1, lanes 1 to 3 are, from left to right: a strand, b strand, RNA self-assembly product. As can be seen, the RNA self-assembly products are slightly dispersed, but clearly seen as a single band. And the molecular weight is the molecular weight after the assembly, and is larger than that of the single chain, so that the position of the band lags behind the a chain and the b chain, the actual situation is consistent with the theory, and the stable composite structure is formed by the self-assembly of the RNA single chains, and the RNA nano-particles are formed.
The electrophoresis detection result of the DNA self-assembly product is shown in FIG. 2. In FIG. 2, lanes 1 to 3 are, from left to right: a chain, b chain, DNA self-assembly product. As can be seen from the figure, the bands of the DNA self-assembly products are bright and clear, and are single bands, which proves that the DNA single strands form a stable composite structure through self-assembly, and form DNA nanoparticles.
In this example, it was verified by gel electrophoresis that: the sequences a, b and c including RNA core sequence SEQ ID NO 1, SEQ ID NO 3 and SEQ ID NO 5 can be successfully self-assembled into RNA nano-particles. Sequences a, b, and c, including the DNA core sequence SEQ ID NO 2, SEQ ID NO 4, and SEQ ID NO 6, can also successfully self-assemble into DNA nanoparticles.
The sequences a, b and c of the RNA nanoparticles and the DNA nanoparticles include various extension sequences (including drug-loading binding sequences) that facilitate the function of loading the nucleic acid domains, and a targeting head or fluorescein linked to the nucleic acid domains, in addition to the core sequence forming the nucleic acid domains. It can be seen that the presence of substances other than these core sequences does not affect the formation of nucleic acid domains and the successful self-assembly of nucleic acid nanoparticles. The self-assembled nucleic acid nanoparticles can have a targeting type under the guidance of a target head, and the fluorescein can enable the nucleic acid nanoparticles to have visibility and traceability.
Example 2
One, 7 groups of short sequence RNA nano-particle carriers:
(1)7 groups of three polynucleotide base sequences composing the RNA nano-particle are respectively shown in tables 2 to 8:
table 2: r-1
Figure BDA0002223702040000221
Table 3: r-2
Figure BDA0002223702040000231
Table 4: r-3
Figure BDA0002223702040000232
Table 5: r-4
Figure BDA0002223702040000233
Table 6: r-5
Figure BDA0002223702040000241
Table 7: r-6
Figure BDA0002223702040000242
Table 8: r-7
Figure BDA0002223702040000243
The single strands of the 7 groups of short-sequence RNA nanoparticle carriers are synthesized by the corporation of Venezuelan Biotechnology engineering (Shanghai).
II, self-assembly experiment steps:
(1) mixing RNA single strands a, b and c at the same time according to a molar ratio of 1:1:1, and dissolving in DEPC water or TMS buffer solution;
(2) heating the mixed solution to 80 ℃, keeping the temperature for 5min, and then slowly cooling to room temperature at the speed of 2 ℃/min;
(3) loading the product on 8% (m/V) native PAGE gel and electrophoretically purifying the complex at 100V in TBM buffer at 4 ℃;
(4) cutting a target strip, eluting in an RNA elution buffer solution at 37 ℃, precipitating with ethanol overnight, and evaporating at a low temperature under reduced pressure to obtain a short-sequence RNA self-assembly product;
(5) electrophoretic analysis detection and laser scanning observation;
(6) and (6) detecting the potential.
Third, self-assembly experimental results
(1) Results of electrophoresis
The 2% agarose gel electrophoresis of the 7 sets of short sequence RNA self-assembly products is shown in FIG. 3. Lanes 1 to 7 in FIG. 3 are, from left to right: short sequences R-1, R-2, R-3, R-4, R-5, R-6 and R-7.
The 4% agarose gel electrophoresis of the 7 sets of short sequence RNA self-assembly products is shown in FIG. 4. Lanes 1 to 7 in FIG. 4 are, from left to right: short sequences R-1, R-2, R-3, R-4, R-5, R-6 and R-7.
As can be seen from the results of FIG. 3 and FIG. 4, it can be clearly seen that the bands of R-2, R-3, R-5 and R-7 in the 7 groups of short sequence self-assembly products are bright and clear, and the bands of R-1, R-4 and R-6 are still single bands, although they are relatively dispersed, indicating that the 7 groups of short sequences can be well self-assembled into RNA nanoparticle structures.
(2) Measurement of electric potential
The determination method comprises the following steps: preparing a potential sample, putting the potential sample into a sample cell, opening a sample cell cover of an instrument, and putting the instrument into the instrument;
opening software, clicking a menu measurere @ ManUal, and presenting a ManUal measurement parameter setting dialog box;
setting software detection parameters;
then clicking the setting of finishing the determination, generating a measurement dialog box, and clicking Start to Start;
and (3) measuring results: the potential detection results of 7 groups of short sequence RNA nanoparticles are shown in tables 9 to 15 below:
table 9:
Figure BDA0002223702040000251
Figure BDA0002223702040000261
table 10:
Figure BDA0002223702040000262
table 11:
Figure BDA0002223702040000263
table 12:
Figure BDA0002223702040000264
table 13:
Figure BDA0002223702040000265
table 14:
Figure BDA0002223702040000271
table 15:
Figure BDA0002223702040000272
from the potential detection data described above, it can be seen that: the 7 groups of short sequence RNA self-assembly products have good stability, and further show that the nanoparticles formed by self-assembly of the short sequence RNAs have more stable self-assembly structures.
This example shows that: the different combinations of the core sequences a, b and c can form the RNA nano-particle with the nucleic acid structure domain through self-assembly, and the structure is stable. Based on example 1, it can be seen that various functional extension fragments or connecting targeting heads, fluorescein and the like are added on the basis of different core sequence combinations, and the RNA nanoparticles can be successfully assembled, and have the performances of drug loading, cell targeting, visual tracking and the like.
To further verify these properties, an extension fragment was added to example 2, see example 3. And an extension fragment is added on the basis of the DNA core sequence corresponding to the RNA core sequence of example 2, with or without target ligation, as shown in example 4.
Example 3
One, 7 groups of conventional sequence RNA nanoparticle carriers:
(1)7 sets of three polynucleotide base sequences constituting the RNA nanoparticle:
table 16: r-8
Figure BDA0002223702040000273
Figure BDA0002223702040000281
Table 17: r-9
Figure BDA0002223702040000282
Table 18: r-10
Figure BDA0002223702040000283
Table 19: r-11
Figure BDA0002223702040000284
Figure BDA0002223702040000291
Table 20: r-12
Figure BDA0002223702040000292
Table 21: r-13
Figure BDA0002223702040000293
Table 22: r-14 (in the following a chain)uGAcAGAuAAGGAAccuGcudTdTAs survivin siRNA)
Figure BDA0002223702040000294
Figure BDA0002223702040000301
The 7 groups of conventional sequence RNA nanoparticle vectors are synthesized by commissioned Suzhou Jima company, wherein the sequences a, b and C in R-8 to R-14 are respectively extended RNA oligonucleotide sequences formed by adding extension segments on the basis of the sequences a, b and C in R-1 to R-7, targeting module fragments are not extended, and C/U base 2' F modification is carried out (the enzyme cutting resistance and stability are enhanced). In addition, a Survivin (Survivin) siRNA nucleic acid interference therapeutic fragment is modified in the RNA nanoparticle R-14, specifically, a sense strand of Survivin siRNA is extended at the 3 'end of the a strand (see the underlined part of the a strand), and an antisense strand is extended and connected at the 5' end of the b strand (see the underlined part of the b strand), so that base pair complementation is formed.
II, self-assembly experiment steps:
(1) mixing RNA single strands a, b and c at the same time according to a molar ratio of 1:1:1, and dissolving in DEPC water or TMS buffer solution;
(2) heating the mixed solution to 80 ℃, keeping the temperature for 5min, and then slowly cooling to room temperature at the speed of 2 ℃/min;
(3) loading the product on 8% (m/V) native PAGE gel and electrophoretically purifying the complex at 100V in TBM buffer at 4 ℃;
(4) cutting off a target strip, eluting in an RNA elution buffer solution at 37 ℃, precipitating with ethanol overnight, and evaporating at a low temperature under reduced pressure;
(5) electrophoretic analysis detection and laser scanning observation;
(6) and (4) measuring the potential.
Third, self-assembly experimental results
(1) Results of electrophoresis
The 2% agarose gel electrophoresis of 7 sets of conventional sequence RNA self-assembly products is shown in FIG. 5. Lanes 1 to 7 in FIG. 5 are, from left to right: the self-assembly products of the conventional sequence RNA are R-8, R-9, R-10, R-11, R-12, R13 and R-14.
FIG. 6 shows the electrophoresis of 4% agarose gel of 7 sets of conventional sequence RNA self-assembly products. Lanes 1 to 7 in FIG. 6 are, from left to right: the self-assembly products of the conventional sequence RNA are R-8, R-9, R-10, R-11, R-12, R13 and R-14.
As can be seen from the results of FIG. 5 and FIG. 6, it can be clearly seen that the bands of the 7 sets of conventional sequence RNA self-assembly products are all bright and clear single bands, indicating that the 7 sets of conventional sequences can self-assemble into the nano-structure. Wherein, after a section of Survivin siRNA nucleic acid interference treatment fragment is modified in the conventional sequence RNA self-assembly product R-14, the self-assembly structure still has a stable self-assembly structure, which also indicates that the nucleic acid nano-particle can carry a nucleic acid drug and has the function of a delivery carrier of the nucleic acid drug.
(2) Measurement of electric potential
The measuring method comprises the following steps: preparing a potential sample (self-assembly product dissolved in ultrapure water) and putting the potential sample into a sample cell, opening a sample cell cover of the instrument and putting the instrument into the sample cell;
opening the software, clicking the menu measurei @ ManUal, and presenting a ManUal measurement parameter setting dialog box;
setting software detection parameters;
then clicking the setting of finishing the determination, generating a measurement dialog box, and clicking Start to Start;
and (3) measuring results: the results of the potential measurements for 7 sets of conventional sequence RNA nanoparticles are shown in tables 23 to 29 below:
table 23:
Figure BDA0002223702040000311
table 24:
Figure BDA0002223702040000312
table 25:
Figure BDA0002223702040000313
table 26:
Figure BDA0002223702040000314
Figure BDA0002223702040000321
table 27:
Figure BDA0002223702040000322
table 28:
Figure BDA0002223702040000323
table 29:
Figure BDA0002223702040000324
from the potential detection data described above, it is found that: the 7 groups of conventional sequence RNA self-assembly products have good stability, and further show that the nanoparticles formed by the self-assembly of the conventional sequence RNA have stable self-assembly structures.
This example shows that: on the basis of RNA core sequences of different combinations, the RNA nano-particles with stable structures can be successfully self-assembled by adding the extension segments. Meanwhile, the added extension segment enables the RNA nanoparticles to have excellent drug-carrying performance (see example 5 in particular).
Example 4
One, 7 groups of conventional sequence DNA nanoparticle carriers:
(1)7 sets of three polynucleotide base sequences constituting the DNA nanoparticles are shown in tables 30 to 36:
the EGFRatt or PSMAaptt (A9L) target is extended in part a strand:
EGFRapt(SEQ ID NO:97):GCCTTAGTAACGTGCTTTGATGTCGATTCGACAGGAGGC;
PSMAapt(A9L,SEQ ID NO:98):
GGGCCGAAAAAGACCTGACTTCTATACTAAGTCTACGTCCC。
table 30: d-1
Figure BDA0002223702040000331
Table 31: d-2
Figure BDA0002223702040000332
Figure BDA0002223702040000341
Table 32: d-3
Figure BDA0002223702040000342
Table 33: d-4
Figure BDA0002223702040000343
Table 34: d-5
Figure BDA0002223702040000351
Table 35: d-6
Figure BDA0002223702040000352
Table 36: d-7
Figure BDA0002223702040000353
Figure BDA0002223702040000361
The single strands of the 7 sets of conventional sequence DNA nanoparticles were synthesized by hong, sozhou entrusted, where:
d-1 is a regular-sequence DNA nanoparticle formed after adding an extended sequence comprising the EGFRatt target head (see underlined section below) to the core sequence (8) (a sequence: 5'-GGAGCGTTGG-3', b sequence: 5'-CCTTCGCCG-3', c sequence: 5'-CGGCCATAGCCC-3') described previously;
d-2 is a regular-sequence DNA nanoparticle formed after adding an extended sequence comprising the EGFRapt target head (see underlined section below) to the core sequence (9) (a sequence: 5'-GCAGCGTTCG-3', b sequence: 5'-CGTTCGCCG-3', c sequence: 5'-CGGCCATAGCGC-3') described above;
d-3 is a regular-sequence DNA nanoparticle formed after adding an extended sequence comprising the EGFRept target head (see underlined section below) to the core sequence (10) (a sequence: 5'-CGAGCGTTGC-3', b sequence: 5'-GCTTCGCCG-3', c sequence: 5'-CGGCCATAGCCG-3') described above;
d-4 is a regular-sequence DNA nanoparticle formed after adding an extension sequence comprising a PSMAapt target head (see underlined section below) to the core sequence (11) (a sequence: 5'-GGAGCGTTGG-3', b sequence: 5'-CCTTCGGGG-3', c sequence: 5'-CCCCCATAGCCC-3') described above;
d-5 is a regular-sequence DNA nanoparticle formed after adding an extension sequence comprising a PSMAapt target head (see underlined section below) to the core sequence (12) (a sequence: 5'-GCAGCGTTCG-3', b sequence: 5'-CGTTCGGCG-3', c sequence: 5'-CGCCCATAGCGC-3') described previously;
d-6 is the core sequence (13) (a sequence: 5'-GCAGCGTTCG-3', b sequence: 5'-CGTTCGGCC-3', c sequence: 5'-GGCCCATAGCGC-3') added with an extension sequence not containing the targeting structure; the formed conventional sequence DNA nanoparticles;
d-7 is an extension sequence not containing the targeting domain, added to the core sequence (14) (a sequence: 5'-CGAGCGTTGC-3', b sequence: 5'-GCTTCGGCG-3', c sequence: 5'-CGCCCATAGCCG-3') described above; and forming the conventional sequence DNA nano-particles.
II, self-assembly experiment steps:
(1) mixing and dissolving the DNA single strands a, b and c in DEPC water or TMS buffer solution at the same time according to the molar ratio of 1:1: 1;
(2) heating the mixed solution to 95 ℃, keeping the temperature for 5min, and then slowly cooling to room temperature at the speed of 2 ℃/min;
(3) loading the product on 8% (m/V) native PAGE gel and electrophoretically purifying the complex at 100V in TBM buffer at 4 ℃;
(4) cutting off a target band, eluting in a DNA elution buffer solution at 37 ℃, precipitating with ethanol overnight, and volatilizing at low temperature under reduced pressure to obtain a conventional sequence DNA self-assembly product;
(5) electrophoretic analysis and detection;
(7) measuring the particle size;
(8) and (5) observing by using a transmission electron microscope.
Third, self-assembly experimental results
(1) Results of electrophoresis
The 2% agarose gel electrophoresis pattern of the 7 sets of conventional sequence DNA self-assembly products is shown in FIG. 7. Lanes 1 to 7 in FIG. 7 are, from left to right: the self-assembly products of the conventional sequence DNA are D-1, D-2, D-3, D-4, D-5, D-6 and D-7.
The electrophoresis pattern of 4% agarose gel of the 7 sets of conventional sequence DNA self-assembly products is shown in FIG. 8. Lanes 1 to 7 in FIG. 8 are, from left to right: the self-assembly products of the conventional sequence DNA are D-1, D-2, D-3, D-4, D-5, D-6 and D-7.
As can be seen from the results of FIG. 7 and FIG. 8, it can be clearly seen that the bands of the 7 groups of conventional sequence DNA self-assembly products are all bright and clear, indicating that the 7 groups of conventional sequence DNA strands complete the self-assembly and form a stable nanoparticle structure. The two groups of self-assembly structures D-6 and D-7 have slightly lower molecular weight because of carrying EGFRept or PSMAept target heads, the positions of the bands of the self-assembly structures are obviously more forward than those of other bands, and the actual and theoretical conditions completely conform to the conditions, thereby further proving the stability of the self-assembly structures.
This example shows that: when various functional extension fragments are added on the basis of different DNA core sequence combinations or are simultaneously connected with a target head, the DNA nano-particles can be successfully assembled, and the DNA nano-particles also have the performances of drug loading, cell targeting, visual tracking and the like.
(2) Determination of potential
The determination method comprises the following steps: preparing a potential sample (self-assembly product dissolved in ultrapure water) and putting the potential sample into a sample cell, opening a sample cell cover of the instrument and putting the instrument into the sample cell;
opening software, clicking a menu measurere @ ManUal, and presenting a ManUal measurement parameter setting dialog box;
setting software detection parameters;
then clicking the setting of finishing the determination, generating a measurement dialog box, and clicking Start to Start;
and (3) measuring results: the potential detection results of 3 groups of conventional sequence DNA nanoparticles are shown in tables 37 to 39 below:
table 37:
Figure BDA0002223702040000371
table 38:
Figure BDA0002223702040000381
table 39:
Figure BDA0002223702040000382
from the potential detection data described above, it is found that: the 3 groups of conventional sequence RNA self-assembly products have good stability, and further show that the nanoparticles formed by self-assembly of the conventional sequence RNA have a stable self-assembly structure.
(3) Particle size measurement
1. Preparing a potential sample (a conventional sequence DNA self-assembly product D-7) and putting the potential sample into a sample cell, opening a sample cell cover of an instrument, and putting the instrument into the instrument;
2. opening software, clicking a menu, and displaying a manual measurement parameter setting dialog box;
3. setting software detection parameters;
4. then click on the ok setting, the measurement dialog box appears, click Start, DLS measurements of hydrodynamic size of self-assembled product D-7 result in table 40 below:
table 40:
Figure BDA0002223702040000383
(4) observation result of transmission electron microscope
And (3) carrying out transmission electron microscope irradiation on the conventional sequence DNA self-assembly product D-7, and comprising the following steps:
1. taking a drop of sample to suspend on a 400-mesh carbon film-coated copper net, and keeping the temperature at room temperature for 1 minute;
2. sucking the liquid by filter paper;
3. dyeing for 1 minute by using 2% uranium acetate;
4. sucking dry by filter paper, and drying at room temperature;
5. JEM-1400 transmission electron microscope was used for 120kv observation and photographing.
As a result, as shown in FIG. 9, it is apparent that the product D-7 of the conventional DNA sequence is a whole structure and can be clearly seen to have a T-type structure.
Example 5
Daunorubicin mounting experiment
Carrying by a chemical method:
first, experimental material and experimental method
1. Experimental materials and reagents:
(1) nucleic acid nanoparticles (molecular weight 29550): similar to the RNA nanoparticles in example 1, except that the fluorescent label on the c-strand is Cy 5.
(2) DEPC water: biyun Tian.
(3) PBS buffer: cellgro.
(4) 4% Paraformaldehyde
(5) Daunorubicin.
(6) Chloroform: and (4) carrying out north transformation.
(7) Anhydrous ethanol: and (6) north transformation.
2. The experimental method comprises the following steps:
(1) daunorubicin (0.85mg, 1.354 μmoL) was precisely weighed and dissolved in DEPC water (1.0mL) and PBS buffer (1.25mL), and a 4% paraformaldehyde aqueous solution (0.25mL) was added to mix well under cooling in an ice-water bath, and the mixture was mixed well with RNA nanoparticles (1mg, 33.84nmoL) and reacted at 4 ℃ for 72 hours in the dark.
(2) Taking 10 mu L of reaction solution to dilute by 10 times, taking 50 mu M daunorubicin aqueous solution and 310 ng/mu L RNA nano-particles as controls, and carrying out HPLC analysis according to the equal volume injection. The reaction conversion can be judged to be basically complete according to the peak area ratio of each component.
(3) The reaction mixture was extracted with chloroform (10mL x3), followed by addition of 25mL of absolute ethanol, mixing, and then sufficiently precipitating the product by keeping the mixture at 4 ℃ in the dark (4 hours). Centrifuging (10000/min, 10min), transferring supernatant, washing solid product with ethanol (50mL) again, and evaporating solvent under reduced pressure at low temperature to obtain dark red solid product.
(4) And (3) calculating the mounting rate:
1. preparing a daunorubicin-PBS standard solution with a known concentration: 2. mu.M, 4. mu.M, 6. mu.M, 8. mu.M, 10. mu.M, each 100. mu.L;
2. dissolving the daunorubicin carrier product in 100 mu L PBS;
3. placing the standard solution and the daunorubicin carrier product in a PCR plate, heating at 85 ℃ for 5min, and then cooling to room temperature;
4. measuring the absorbance of daunorubicin at 492nm by using a microplate reader, drawing a standard curve (as shown in figure 10), and calculating the molar concentration of daunorubicin in the mounted product;
5. measuring the absorbance of RNA at 260nm by using a spectrophotometer to obtain the mass concentration of the daunorubicin-carrying product contained in each sample;
6. and calculating the mounting rate according to the measured daunorubicin molar concentration and the daunorubicin mounting product mass concentration.
The specific calculation process is as follows:
CRNAh-1=58.8ug/ml,MRNAh≈30000,100ul;Cdaunorubicin-1=11.76uM,100ul;
CRNAh-2=39.8ug/ml,MRNAh≈30000,100ul;CDaunorubicin-2=7.506uM,100ul;
Figure BDA0002223702040000401
The average value of the two vectors is taken to obtain that the daunorubicin-RNAh loading rate is about 6, which shows that each nucleic acid nanoparticle carrier can be loaded with about 6 daunorubicin molecules.
In addition, on the basis of daunorubicin carried by the RNA nanoparticles, other small molecule drugs can be further carried for the second time according to the same method as the method for carrying daunorubicin, for example, folic acid is further carried by the present application to obtain RNA nanoparticles carrying two small molecule drugs daunorubicin and folic acid together, and the carrying rates of the two drugs can be detected by the above method (values not shown).
Example 5 shows that the RNA nanoparticles (in example 1) with the extension fragment, the targeting end and the fluorescein have the function of drug loading, and the small molecule drug daunorubicin can be loaded in a covalent connection mode (paraformaldehyde-solvent covalent) and can also be loaded together with other small molecule drugs.
Example 6
Confocal microscope experiment for detecting cell binding capacity of medicine-carrying RNA nanoparticles
Firstly, experimental materials and experimental methods:
1. the samples to be tested are shown in table 41:
table 41:
Figure BDA0002223702040000411
note: in the table, RNAh-Bio-670 is used as a control, which refers to nanoparticles prepared by Biotin modification at the 5 'ends of the a-and b-strands and quasar670 fluorescein modification at the 3' end of the c-strand according to the self-assembly method in example 1, and RNAh-Bio-670-DNR refers to nanoparticles formed after further daunorubicin loading (loading according to the chemical method in example 5).
2. The experimental reagents used and their sources were as follows:
RPMI-1640 medium (Gibco, C11875500BT-500 mL); fetal Bovine Serum (FBS) (ExCell Bio, FNA500-500 mL); Penicillin/Streptomycin (Penicilin/Streptomyces, PS) (Gibco,15140-122-100 mL); PBS buffer (Gibco, C20012500BT-500 mL); Trypsin-EDTA (Stemcell, 07901-; DMSO (Sigma, D5879-1L); prolong Gold antibody mount anti-quencher (Thermo, P36941-2 mL); DAPI (Yeasen,36308ES11-4 mL).
3. The experimental equipment used was as follows:
inverted Microscope (Inverted Microscope) (Olympus BX53, U-RFL-T); BD Falcon (Corning, 354118); cytospin (Cytospin) (TXD 3).
4. The experimental method comprises the following steps:
(1) MCF-7 cells (acute leukemia cell line) in RPMI1640+ 10% FBS + 1% PS medium at 37 ℃ and 5% CO2Culturing under the condition.
(2) Cells were collected and washed once with PBS at 1x10 per well5Individual cells were added to 48-well plates.
(3) Cells were incubated with 200nM and 400nM of RNAh-Bio-670 and RNAh-Bio-670-DNR nanoparticles at 37 ℃ and 5% CO2And (4) incubating for 2h and 4 h.
(4) After MCF-7 cells were washed with PBS, the cells were mounted on a glass slide by centrifugation and treated with an anti-quencher (Long Gold antibody mount) overnight at room temperature.
(5) The cells were stained with DAPI at room temperature for 5min and mounted.
(6) Cell binding and internalization were assessed using the DAPI and FAM channels of a laser scanning confocal microscope, photographed under a microscope, and stored.
Second, experimental results
The results of the experiment are shown in FIG. 11. As can be seen from FIG. 11, the results of the cell binding and internalization experiments indicate that both the RNAh-Bio-670 and RNAh-Bio-670-DNR nanoparticles carry the target head, Biotin (Biotin), and are thus capable of binding to and internalizing into cells. The result shows that the medicine RNAh-Bio-670-DNR nano-particle containing daunorubicin has stronger binding and internalization capacity with MCF-7 cells.
Example 7
Flow cytometry for detecting cell binding capacity of drug-loaded RNA nanoparticles
Firstly, a sample to be measured
Targeting drugs: RNAh-Biotin-Cy5-DNR, wherein RNAh-Biotin-Cy5 is prepared by the same method as RNAh-Biotin-quasar670 except that the fluorescent substance is replaced by Cy5 from the quasar 670. RNAh-Biotin-Cy5-DNR is nanoparticles formed after further DNR loading by RNAh-Biotin-Cy5 (loaded as in example 5).
Second, the experimental cells and culture conditions (MCF-7 cells, which are the same as the confocal microscope experiment described in example 6, and are not described here again)
Third, fluorescence detection
The conditions for fluorescence detection were as follows:
excitation light 640nm, emission light 675nm, detection height 7mm, measurement value/data point 10, detection speed: normal, prolonged: 100 ms.
Fourth, the testing result (see table 42)
Table 42:
Figure BDA0002223702040000421
as can be seen from Table 42, the binding rate of the RNAh-Biotin-Cy5-DNR nanoparticles and MCF-7 cells can reach more than 84% under the condition of proper treatment time and concentration, and compared with a blank control containing only a culture medium, the RNA drug-loaded particles and the MCF-7 cells have stronger binding and internalization capacity.
Example 8
Testing the stability of daunorubicin-containing drugs loaded on nucleic acid nanoparticles in serum
First, experimental material and experimental method
1. A sample to be tested: RNAh-Bio-670-DNR nanoparticles prepared in example 5 dissolved in PBS solution.
2. Experimental reagent:
RPMI-1640 medium (Gibco, C11875500BT-500 mL); fetal Bovine Serum (FBS) (ExCell Bio, FNA500-500 mL); Penicillin/Streptomycin (Penicilin/Streptomyces, PS) (Gibco,15140-122-100 mL); PBS buffer (Gibco, C20012500BT-500 mL); novexTM Tris-Glycine Native Sample Buffer(2X)(Invitrogen,LC2673-20mL);Novex TM8% Tris-Glycine Mini Gels (Invitrogen, XP00080BOX-1.0 mm); Tris-Glycine Native Running buffer (10 ×) (Life science, LC2672-500 mL); g250 staining solution (Beyotime, P0017-250 mL).
3. An experimental instrument:
spectrophotometer (Spectrophotometer) (Thermo, ND 2000C); mini Gel Tank (Invitrogen, PS 0301); imaging System (Imaging System) (Bio-Rad, ChemiDoc MP).
4. The experimental method comprises the following steps:
(1) mu.L of 100. mu.M RNAh-Bio-670-DNR nanoparticles were incubated in 99. mu.L RPMI1640 medium containing 10% serum.
(2) Samples were taken after incubation at 37 ℃ for 10min, 1h, 12h, 36h, respectively.
(3) After quantification by the NanoDrop, 200ng of RNA nanoparticles were taken and added to the same volume of Tris-Glycine SDS sample buffer (2X), and mixed well.
(4) Get a block Novex TM8% Tris-Glycine Mini gel, according to the sequence, set program 200V, 30min, start electrophoresis.
(5) And after the electrophoresis is finished, G250 staining is carried out, the mixture is placed on a horizontal shaking table for 30min, and photographing imaging is carried out.
Second, experimental results
Table 43: quantitative results and sample volume
Figure BDA0002223702040000431
The results of the electrophoretic detection are shown in FIGS. 12 and 13. In this figure 12 shows the results of electrophoresis on 8% non-denatured Gel (Coomassie Blue program) and figure 13 shows the results of electrophoresis on 8% non-denatured Gel (Stain Free Gel program). The result of the serum stability test shows that: the RNAh-Bio-670-DNR nanoparticle sample bands have no obvious difference at different time lengths of 0min, 10min, 1h, 12h and 36h, which shows that the sample bands are relatively stable and have no obvious degradation in a 1640 culture medium of 10% FBS.
Example 9
Study of cytotoxicity of RNAh-Bio-670-DNR nanoparticles in MCF-7 cells
First, experimental material and experimental method
1. Experimental materials:
a sample to be tested: small molecule drugs DNR and RNAh-Bio-670-DNR nanoparticles;
2. experimental reagent:
(Promega); RPMI-1640 medium (Gibco, C11875500BT-500 mL); fetal Bovine Serum (FBS) (ExCell Bio, FNA500-500 mL); Penicillin/Streptomycin (Penicilin/Streptomyces, PS) (Gibco,15140-122-100 mL); PBS buffer (Gibco, C20012500BT-500 mL); Trypsin-EDTA (Stemcell, 07901-; DMSO (Sigma, D5879-1L); CellTiter-Glo Luminescent Cell vitality Assay kit (CTG) (Promega, G7572-100 mL).
3. An experimental instrument:
inverted Microscope (Inverted Microscope) (Olympus IX71, No. 112A-1); 96-well Plate Reader (96-well Plate Reader) (Molecular Devices, Flexstation 3).
4. The experimental method comprises the following steps:
1) MCF-7 cells in DMEM + 10% FBS + 1% PS medium at 37 ℃ and 5% CO2Culturing under the condition.
2) The cells were collected, centrifuged at 800rpm for 5 minutes, the medium was resuspended, the cell concentration was adjusted, and the cell concentration was added to a 96-well plate in a volume of 90. mu.L of 5000 cells.
3) The next day, the test samples were diluted with medium at 200nM per well, 4 replicates.
4) After culturing for 72h, adding 100 μ L of CTG reagent into each well, shaking for 2min, standing at room temperature for 10min, and keeping the whole process away from light.
5) Finally using SoftMax Pro5 software readings.
II, experimental results:
table 44: cell viability (%)
Figure BDA0002223702040000441
Figure BDA0002223702040000451
The experimental results are shown in Table 44 and FIG. 14, and it can be seen from Table 44 and FIG. 14 that the RNAh-Bio-670-DNR nanoparticles have significant inhibitory effect on MCF-7 cell proliferation, and have slightly stronger inhibitory effect on cell proliferation than the small molecule drug Daunorubicin (DNR).
Further, in order to confirm that the vector itself has no obvious toxicity to MCF-7 cells, the application further designs a toxicity test of the RNAh-Bio-FAM targeted fluorescent vector to MCF-7 cells, 10% PBS is used as a negative control, and the culture medium is used as a blank control, and the specific result is shown in FIG. 15. As can be seen in FIG. 15, the targeting fluorescent vector itself was not significantly toxic to MCF-7 cells.
Assembly of nucleic acid nanoparticles
Example 10
One, 7 groups of extended segment deformation + core short sequence RNA nano particle carriers:
(1)7 groups of three polynucleotide base sequences which form the RNA nano-particle with the extension segment deformation and the core short sequence:
table 45: r-15:
Figure BDA0002223702040000452
table 46: r-16:
Figure BDA0002223702040000453
Figure BDA0002223702040000461
table 47: r-17:
Figure BDA0002223702040000462
table 48: r-18:
Figure BDA0002223702040000463
Figure BDA0002223702040000471
table 49: r-19:
Figure BDA0002223702040000472
TABLE 50: r-20:
Figure BDA0002223702040000473
Figure BDA0002223702040000481
TABLE 51: r-21:
Figure BDA0002223702040000482
II, self-assembly testing:
(1) mixing RNA single strands a, b and c at the same time according to a molar ratio of 1:1:1, and dissolving in DEPC water or TMS buffer solution;
(2) heating the mixed solution to 80 ℃, keeping the temperature for 5min, and then slowly cooling to room temperature at the speed of 2 ℃/min;
(3) loading the product on 8% (m/V) native PAGE gel and electrophoretically purifying the complex at 100V in TBM buffer at 4 ℃;
(4) cutting off target bands, eluting in RNA elution buffer solution at 37 ℃, precipitating with ethanol overnight, and evaporating at low temperature under reduced pressure;
(5) electrophoresis analysis detection and laser scanning observation.
Third, self-assembly test results
(1) Electrophoretic detection
The main reagents and instruments were as follows:
table 52:
name of reagent Goods number Manufacturer(s) of
6×DNA Loading buffer TSJ010 Organisms of Onychidae
20bp DNA Ladder 3420A TAKARA
10000 SolarGelRed nucleic acid dye E1020 solarbio
8% native PAGE gel / Self-matching
1 × TBE Buffer (No RNAse) / Self-matching
Table 53:
Figure BDA0002223702040000491
the method comprises the following steps:
the RNA nanoparticles were diluted with ultrapure water according to the method of Table 54 below.
Table 54:
measured concentration (μ g/mL)
R-15 165.937
R-16 131.706
R-17 144.649
R-18 164.743
R-19 126.377
R-20 172.686
R-21 169.455
② mixing 10 microliter (500ng) of the treated sample with 2 microliter of 6 multiplied by DNA Loading Buffer, operating on ice and marking.
③ taking 8% non-denaturing PAGE gel, applying a piece of gel on samples with different incubation times, completely applying 12 mu L of processed samples, and setting the program to run gel for 40min at 100V.
And fourthly, dyeing after glue running is finished, placing the dyed fabric on a horizontal shaking table for 30min, and photographing and imaging.
And (3) detection results:
the results of the native PAGE running gel of 7 sets of extended stretch-deformed + core short sequence RNA self-assembled products are shown in FIG. 16. Lanes 1 to 7 in FIG. 16 are, from left to right: 7 groups of self-assembly products of the RNA with the extension segment deformation and the core short sequence, R-15, R-16, R-17, R-18, R-19, R-20 and R-21.
The results in fig. 16 clearly show that the bands of the 7 sets of extended stretch-deformed + core short sequence RNA self-assembly products are bright and clear, which indicates that the 7 sets of extended stretch-deformed + core short sequence RNA strands complete self-assembly and form a stable nanoparticle structure.
(2) Determination of potential
The determination method comprises the following steps: preparing a potential sample (a self-assembly product is dissolved in ultrapure water) and putting the potential sample into a sample cell, opening a sample cell cover of the instrument and putting the instrument into the sample cell;
opening the software, clicking the menu measurei @ ManUal, and presenting a ManUal measurement parameter setting dialog box;
setting software detection parameters;
then clicking to finish setting, appearing a measurement dialog box, and clicking Start to Start;
and (3) measuring results: the potential detection results at 25 ℃ of 7 groups of extended segment deformation + core short sequence RNA nanoparticles are as follows:
table 55:
Figure BDA0002223702040000501
table 56:
Figure BDA0002223702040000502
table 57:
Figure BDA0002223702040000503
Figure BDA0002223702040000511
table 58:
Figure BDA0002223702040000512
table 59:
Figure BDA0002223702040000513
table 60:
Figure BDA0002223702040000514
table 61:
Figure BDA0002223702040000515
Figure BDA0002223702040000521
from the potential detection data described above, it is found that: the 7 groups of the extended segment deformation and core short sequence RNA nanoparticles have good stability, and further show that the nanoparticles formed by the extended segment deformation and the core short sequence RNA through self-assembly have a stable self-assembly structure.
(3) Particle size measurement
1. Preparing a potential sample (7 groups of extension sections and core short sequence RNA) and putting the potential sample into a sample cell, opening a sample cell cover of the instrument and putting the instrument into the sample cell;
2. opening software, clicking a menu, and displaying a manual measurement parameter setting dialog box;
3. setting software detection parameters;
4. then click on the confirmed setting, a measurement dialog box appears, and Start is clicked, and the results of DLS measurement values of hydrodynamic sizes of 7 groups of extended stretch variants + core short sequence RNAs are as follows:
table 62:
average particle diameter (nm)
R-15 6.808
R-16 6.978
R-17 7.592
R-18 7.520
R-19 6.936
R-20 7.110
R-21 6.720
(4) TM value detection
And (3) detecting the TM values of the 7 groups of the extended section deformation and core short sequence RNA nanoparticles by adopting a dissolution curve method, wherein the sample is consistent with the potential sample.
Reagents and instrumentation were as follows:
table 63:
name of reagent Goods number Manufacturer(s) of
AE buffer / Takara
SYBR Green I dyes / Self-matching
Table 64:
name (R) Model number Manufacturer of the product
Real-Time System CFX Connect Bio-rad
Super clean bench HDL BEIJING DONGLIAN HAR INSTRUMENT MANUFACTURING Co.,Ltd.
The method comprises the following steps:
after diluting the sample with ultrapure water, 5. mu.g of the diluted sample was mixed with 2. mu.L of SYBR Green I dye (1: 200 dilution) to a final volume of 20. mu.L, at the following dilution concentrations:
table 65:
Figure BDA0002223702040000531
incubating for 30min at room temperature in a dark place;
and thirdly, detecting on a computer, setting a program to start at 20 ℃, raising the temperature to between 0.1 and 95 ℃ per second, and reading once every 5 seconds.
And (3) detection results:
the TM values of 7 sets of extended length modified + core short sequence RNA nanoparticles are shown in the following, wherein the dissolution curve of R-15 is shown in FIG. 17, the dissolution curve of R-16 is shown in FIG. 18, the dissolution curve of R-17 is shown in FIG. 19, the dissolution curve of R-18 is shown in FIG. 20, the dissolution curve of R-19 is shown in FIG. 21, the dissolution curve of R-20 is shown in FIG. 22, and the dissolution curve of R-21 is shown in FIG. 23. Because of the specificity of the RNA sample, the temperature corresponding to 1/2RFUmax within the temperature range of 20-90 ℃ is taken as the Tm value of the sample in the detection.
Table 66:
Figure BDA0002223702040000532
Figure BDA0002223702040000541
the TM values of 7 groups of extension segment deformation and core short sequence RNA nanoparticles are higher, which indicates that the self-assembly product has good structural stability.
Example 11
The first and the 7 groups of the extended segment deformation + core short sequence DNA nano particle carriers:
(1)7 groups of three polynucleotide base sequences which form the extension segment deformation + core short sequence DNA nano-particles:
table 67: d-8:
Figure BDA0002223702040000542
table 68: d-9:
Figure BDA0002223702040000543
Figure BDA0002223702040000551
table 69: d-10:
Figure BDA0002223702040000552
table 70: d-11:
Figure BDA0002223702040000553
table 71: d-12:
Figure BDA0002223702040000561
table 72: d-13:
Figure BDA0002223702040000562
table 73: d-14:
Figure BDA0002223702040000563
Figure BDA0002223702040000571
II, self-assembly testing:
(1) mixing and dissolving the DNA single strands a, b and c in DEPC water or TMS buffer solution at the same time according to the molar ratio of 1:1: 1;
(2) heating the mixed solution to 95 ℃, keeping the temperature for 5min, and then slowly cooling to room temperature at the speed of 2 ℃/min;
(3) loading the product on 8% (m/V) native PAGE gel and electrophoretically purifying the complex at 100V in TBM buffer at 4 ℃;
(4) cutting off a target band, eluting in a DNA elution buffer solution at 37 ℃, precipitating with ethanol overnight, and volatilizing at low temperature under reduced pressure to obtain a DNA self-assembly product;
(5) electrophoretic analysis detection and laser scanning observation;
(6) detecting the potential;
(7) detecting the particle size;
(8) and (5) detecting the TM value.
Third, self-assembly test results
(1) Electrophoretic detection
The main reagents and instruments were as follows:
table 74:
name of reagent Goods number Manufacturer(s) of
6×DNA Loading buffer TSJ010 Organisms of Onychidae
20bp DNA Ladder 3420A TAKARA
10000 SolarGelRed nucleic acid dye E1020 solarbio
8% native PAGE gel / Self-matching
1 × TBE Buffer (No RNAse) / Self-matching
Table 75:
Figure BDA0002223702040000572
Figure BDA0002223702040000581
the method comprises the following steps:
the DNA nanoparticles were diluted with ultrapure water according to the following method.
Table 76:
Figure BDA0002223702040000582
② mixing 10 microliter (500ng) of the treated sample with 2 microliter of 6 multiplied by DNA Loading Buffer, operating on ice and marking.
③ taking 8% non-denaturing PAGE gel, applying a piece of gel on samples with different incubation times, completely applying 12 mu L of processed samples, and setting the program to run gel for 40min at 100V.
And fourthly, dyeing after glue running is finished, placing the dyed fabric on a horizontal shaking table for 30min, and photographing and imaging.
And (3) detection results:
the results of native PAGE gel of 7 sets of extended stretch-deformed + core short sequence DNA self-assembly products are shown in FIG. 24. Lanes 1 to 7 in FIG. 24 are, from left to right: 7 groups of extension segment deformation + core short sequence DNA self-assembly products D-8, D-9, D-10, D-11, D-12, D-13 and D-14.
It can be clearly seen from the results of fig. 24 that the bands of the 7 sets of extended stretch-deformed + core short sequence DNA self-assembly products are bright and clear, which indicates that the 7 sets of extended stretch-deformed + core short sequence DNA strands complete self-assembly and form a stable nanoparticle structure.
(2) Determination of potential
The determination method comprises the following steps: preparing a potential sample (self-assembly product dissolved in ultrapure water) and putting the potential sample into a sample cell, opening a sample cell cover of the instrument and putting the instrument into the sample cell;
opening the software, clicking the menu measurei @ ManUal, and presenting a ManUal measurement parameter setting dialog box;
setting software detection parameters;
then clicking the setting of finishing the determination, generating a measurement dialog box, and clicking Start to Start;
and (3) measuring results: the potential detection results at 25 ℃ of 7 groups of extension segment deformation + core short sequence DNA nanoparticles are as follows:
table 77:
Figure BDA0002223702040000591
table 78:
Figure BDA0002223702040000592
table 79:
Figure BDA0002223702040000593
table 80:
Figure BDA0002223702040000594
Figure BDA0002223702040000601
table 81:
Figure BDA0002223702040000602
table 82:
Figure BDA0002223702040000603
table 83:
Figure BDA0002223702040000604
from the potential detection data described above, it can be seen that: the 7 groups of extension segment deformation and core short sequence DNA nanoparticles have good stability, and further show that the nanoparticles formed by the extension segment deformation and the core short sequence DNA through self-assembly have a stable self-assembly structure.
(3) Particle size measurement
Firstly, preparing a potential sample (7 groups of extension segment deformation and core short sequence DNA) to be placed in a sample cell, opening a sample cell cover of an instrument, and placing the instrument;
opening software, clicking a menu, and displaying a manual measurement parameter setting dialog box;
setting software detection parameters;
and fourthly, clicking the setting after determination, generating a measurement dialog box, clicking Start, and obtaining the results of the DLS measurement values of the hydrodynamic sizes of 7 groups of the extended segment deformation and the core short sequence RNA as follows:
table 84:
average particle diameter (nm)
D-8 7.460
D-9 7.920
D-10 7.220
D-11 7.472
D-12 6.968
D-13 7.012
D-14 6.896
(4) TM value detection
And (3) detecting the TM values of the 7 groups of extension segment deformation + core short sequence DNA nanoparticles by adopting a dissolution curve method, wherein the sample is consistent with the potential sample.
Reagents and instrumentation were as follows:
table 85:
name of reagent Goods number Manufacturer(s) of
AE buffer / Takara
SYBR Green I dye / Self-matching
Table 86:
name (R) Model number Manufacturer of the product
Real-Time System CFX Connect Bio-rad
Super clean bench HDL BEIJING DONGLIAN HAR INSTRUMENT MANUFACTURING Co.,Ltd.
The method comprises the following steps:
② after samples were diluted with ultrapure water, 5. mu.g of the diluted sample was mixed with 2. mu.L of SYBR Green I dye (1: 200 dilution), the final volume was 20. mu.L, the dilution concentration was as follows:
table 87:
Figure BDA0002223702040000621
② incubating for 30min at room temperature in dark place;
and thirdly, detecting on a computer, setting a program to start at 20 ℃, raising the temperature to between 0.1 and 95 ℃ per second, and reading once every 5 seconds.
And (3) detection results:
the TM values of 7 sets of extended stretch modified + core short sequence DNA nanoparticles are shown in FIG. 25 for the dissolution profile of D-8, FIG. 26 for the dissolution profile of D-9, FIG. 27 for the dissolution profile of D-10, FIG. 28 for the dissolution profile of D-11, FIG. 29 for the dissolution profile of D-12, FIG. 30 for the dissolution profile of D-13, and FIG. 31 for the dissolution profile of D-14.
Table 88:
TM value (. degree. C.)
D-8 48.5
D-9 52.5
D-10 54.5~55.0
D-11 48.7
D-12 51.5
D-13 51.0
D-14 49.2
As can be seen from the dissolution curves of the 7 sets of extended length modified + core short sequence DNA nanoparticles shown in FIGS. 25 to 31, the TM values are all higher, indicating that the sample purity is higher and the self-assembly structure is stable.
Detecting stability of nucleic acid nanoparticles in serum
Example 12
And (3) characterizing the stability of the 7 groups of the extended segment deformation + core short sequence RNA nanoparticles in serum by adopting a non-denaturing PAGE method.
The main reagents and instruments were as follows:
table 89:
name of reagent Goods number Manufacturer of the product
6×DNA Loading buffer TSJ010 Organisms of Onychidae
20bp DNA Ladder 3420A TAKARA
10000 SolarGelRed nucleic acid dye E1020 solarbio
8% non-denaturing PAGE gel / Self-matching
1 XTBE Buffer (No RNase) / Self-matching
Serum (FBS) / Excel
RPMI 1640 / GBICO
Table 90:
Figure BDA0002223702040000631
the method comprises the following steps:
firstly, preparing the RNA nanoparticles into the concentrations shown in the following table, then diluting the prepared sample according to the method shown in the following table, diluting for 5 tubes, and carrying out water bath on the diluted sample at 37 ℃ for different time (0, 10min, 1h, 12h and 36 h);
table 91:
Figure BDA0002223702040000632
Figure BDA0002223702040000641
secondly, mixing 10 mu L of the treated sample with 2 mu L of 6 multiplied DNA Loading Buffer uniformly, operating on ice and marking;
thirdly, 8% non-denaturing PAGE gel is taken, samples with different incubation times are coated with a piece of gel, all samples processed by 12 mu L are loaded, and the procedure of 100V gel running is set for 40 min;
fourthly, dyeing is carried out after glue running is finished, the dyeing is placed on a horizontal shaking table to be slowly oscillated for 30min, and photographing and imaging are carried out.
The electrophoresis detection result of R-15 is shown in FIG. 32, the electrophoresis detection result of R-16 is shown in FIG. 33, the electrophoresis detection result of R-17 is shown in FIG. 34, the electrophoresis detection result of R-18 is shown in FIG. 35, the electrophoresis detection result of R-19 is shown in FIG. 36, the electrophoresis detection result of R-20 is shown in FIG. 37, and the electrophoresis detection result of R-21 is shown in FIG. 38. In fig. 32 to 38, lanes from left to right are M: marker; 1: 36 h; 2: 12 h; 3: 1 h; 4: 10 min; 5: and (5) 0 min. From the results of the serum stability test, it can be seen that: the non-denatured gel fruits of 10min, 1h, 12h and 36h showed no significant difference in the RNA nanoparticle sample bands at different times, indicating that the RNA nanoparticles R-15 to R-21 were relatively stable in 1640 medium of 50% FBS without significant degradation.
Example 13
The stability of 7 groups of extended length modified + core short sequence DNA nanoparticles in serum was characterized by non-denaturing PAGE.
The main reagents and instruments were as follows:
table 92:
name of reagent Goods number Manufacturer(s) of
6×DNA Loading buffer TSJ010 Organisms of Onychidae
20bp DNA Ladder 3420A TAKARA
10000 SolarGelRed nucleic acid dye E1020 solarbio
8% non-denaturing PAGE gel / Self-matching
1 XTBE Buffer (No RNase) / Self-matching
Serum (FBS) / Excel
RPMI 1640 / GBICO
Table 93:
Figure BDA0002223702040000642
the method comprises the following steps:
preparing the DNA nanoparticles into the concentration shown in the following table, diluting the prepared sample by the method shown in the following table for 5 tubes, and carrying out water bath on the diluted sample at 37 ℃ for different time (0, 10min, 1h, 12h and 36 h);
table 94:
Figure BDA0002223702040000651
secondly, mixing 5 mu L of the treated sample with 1 mu L of 6 multiplied DNA Loading Buffer uniformly, operating on ice and marking;
thirdly, 8% non-denaturing PAGE gel is taken, samples with different incubation times are coated with a piece of gel, all samples processed by 6 mu L are loaded, and the procedure of 100V gel running is set for 40 min;
fourthly, dyeing is carried out after glue running is finished, the dyeing is placed on a horizontal shaking table to be slowly oscillated for 30min, and photographing and imaging are carried out.
The electrophoresis detection result of D-8 is shown in FIG. 39, the electrophoresis detection result of D-9 is shown in FIG. 40, the electrophoresis detection result of D-10 is shown in FIG. 41, the electrophoresis detection result of D-11 is shown in FIG. 42, the electrophoresis detection result of D-12 is shown in FIG. 43, the electrophoresis detection result of D-13 is shown in FIG. 44, and the electrophoresis detection result of D-14 is shown in FIG. 45. In fig. 39 to 45, lanes from left to right are M: marker; 1: 36 h; 2: 12 h; 3: 1 h; 4: 10 min; 5: and (5) 0 min. From the results of the serum stability test, it can be seen that: the 10min, 1h, 12h and 36h non-denatured gel fruits showed no significant difference in the bands of the DNA nanoparticle samples at different times, indicating that the DNA nanoparticles D-8 to D-14 were relatively stable in 1640 medium with 50% FBS and had no significant degradation.
Nucleic acid nanoparticle-loaded drug assay
Example 14
Doxorubicin mounting experiment:
according to the chemical method of attachment of example 5 (except for the specific limitation, the same method as example 5), RNA nanoparticles formed by self-assembly of R-15, R-16, R-17, R-18, R-19, R-20 and R-21 in example 10, and DNA nanoparticles formed by self-assembly of D-8, D-9, D-10, D-11, D-12, D-13 and D-14 in example 11 were used as the doxorubicin attachment carrier, and the doxorubicin attachment rates were measured as follows:
the adriamycin loading rate of the RNA nano-particle R-15 is 20.5;
the adriamycin loading rate of the RNA nano-particle R-16 is 29.4;
the adriamycin loading rate of the RNA nano-particle R-17 is 30.9;
the adriamycin loading rate of the RNA nano-particle R-18 is 34.1;
the adriamycin loading rate of the RNA nano-particle R-19 is 27.1;
the adriamycin loading rate of the RNA nano-particle R-20 is 30.2;
the adriamycin loading rate of the RNA nano-particle R-21 is 20.1;
the adriamycin loading rate of the DNA nano-particle D-8 is 28.0;
the adriamycin loading rate of the DNA nano-particle D-9 is 27.9;
the adriamycin loading rate of the DNA nano-particle D-10 is 18.9;
the adriamycin loading rate of the DNA nano-particle D-11 is 26.8;
the adriamycin loading rate of the DNA nano-particle D-12 is 27.6;
the adriamycin loading rate of the DNA nano-particle D-13 is 31.8;
the adriamycin loading rate of the DNA nanoparticle D-14 was 32.
Flow cytometry (FACS) experiment for detecting cell binding capacity of DNA nanoparticles and carrier drug
Example 15
First, cell information
HepG2 (Source synergy cell bank), DMEM + 10% FBS + 1% double antibody (gibco, 15140-122), culture conditions at 37 ℃ and 5% CO2And saturation humidity.
Second, the object to be measured
Blank vector: the DNA nanoparticle carriers formed by self-assembly of D-8, D-9, D-10, D-11, D-12, D-13 and D-14 in the foregoing example 11.
Carrier drug: according to the chemical method of example 5 (except for special limitation, the method is the same as example 5), the DNA nanoparticles formed by self-assembly of D-8, D-9, D-10, D-11, D-12, D-13 and D-14 in the previous example 11 are used to carry doxorubicin, which is respectively marked as D-8-doxorubicin, D-9-doxorubicin, D-10-doxorubicin, D-11-doxorubicin, D-12-doxorubicin, D-13-doxorubicin and D-14-doxorubicin.
Third, main equipment and consumable
Table 95:
Figure BDA0002223702040000671
four, main reagent
Table 96:
name of reagent Manufacturer of the product Goods number Remarks to note
DMEM (Biotin free) Providing all the drugs Zhida YS3160
1%BSA-PBS Self-matching
And fifthly, an experimental method:
1. adjusting the cell state to logarithmic phase, changing the culture medium to a biotin-free and folic acid-free culture medium, and placing the culture medium in an incubator at 37 ℃ for overnight incubation;
2. after incubation, cell suspension was collected by trypsinization, centrifuged at 1000rmp for 5min, adjusted to concentration, and 2X 10 cells were collected5-5×105cells/EP tube, wash 2 times with 1 mL/tube of 1% BSA-PBS, and observe the tube bottom cells to prevent aspiration.
3. Dissolving the object to be tested, and diluting the object to be tested to the use concentration;
4. completely sucking cell supernatant, sequentially adding 100 mu L of corresponding samples into each tube, keeping out of the sun, and incubating for 2h at 37 ℃;
5. washed 2 times with 1% BSA-PBS; centrifuging at 1000rmp for 5 min;
6. finally resuspending the cell pellet with 300. mu.L PBS and detecting it on flow machine (blank vector used in this example was labeled by Quasar670, whereas doxorubicin in the vector drug is self-fluorescent and therefore can be detected by FL4-APC and FL2-PE, respectively);
7. and (6) analyzing the data.
Sixth, experimental results
1. The results of the experiment are shown in the following table:
table 97:
Figure BDA0002223702040000681
Figure BDA0002223702040000691
2. conclusion
After incubation of HepG2 cells with D-8-adriamycin (vector medicine) and D-8 (blank vector), the binding rate is very high (93.1% -98.4%).
After incubation of HepG2 cells with D-9-adriamycin (vector drug) and D-9 (blank vector), the binding rate is very high (88.6% -98.1%).
After incubation of HepG2 cells with D-10-adriamycin (vector medicine) and D-10 (blank vector), the binding rate is high (89.4% -98.3%).
After incubation of HepG2 cells with D-11-adriamycin (carrier drug) and D-11 (blank carrier), the binding rate is high (89.3% -97.8%).
After incubation of HepG2 cells with D-12-adriamycin (vector drug) and D-12 (blank vector), the binding rate is very high (94.6% -97.1%).
After incubation of HepG2 cells with D-13-adriamycin (vector medicine) and D-13 (blank vector), the binding rate is high (89.6% -98.2%).
After incubation of HepG2 cells with D-14-adriamycin (vector medicine) and D-14 (blank vector), the binding rate is very high (90.3% -98.3%).
Study of cytotoxicity of DNA nanoparticles and vector drugs in HepG2 cells
Example 16
The toxicity of the DNA nanoparticles and the carrier drug to HepG2 is detected by a CCK8 method.
First, main reagent
Table 98:
Figure BDA0002223702040000692
Figure BDA0002223702040000701
second, main consumables and instrument
TABLE 99:
name (R) Manufacturer of the product Model number
96-well cell culture plate NEST 701001
Biological safety cabinet Beijing Dong Bihaer Instrument manufacturing Co Ltd BSC-1360 Ⅱ A2
Low-speed centrifugal machine Zhongke Zhongjia Instrument Co., Ltd SC-3612
CO2Culture box Thermo 3111
Inverted microscope UOP DSZ2000X
Enzyme mark instrument SHANGHAI OYIN EXPERIMENT EQUIPMENT Co.,Ltd. K3
III, cell information
HepG2 (Source synergy cell bank), DMEM + 10% FBS + 1% double antibody (gibco, 15140-122), culture conditions at 37 ℃ and 5% CO2And saturation humidity.
Fourth, experimental materials
1. Sample to be tested
Blank vector: the DNA nanoparticle carriers formed by self-assembly of D-8, D-9, D-10, D-11, D-12, D-13 and D-14 in the foregoing example 11 were respectively denoted as: d-8, D-9, D-10, D-11, D-12, D-13 and D-14.
Carrier drug: according to the chemical method of example 5 (except for special limitation, the method is the same as example 5), the DNA nanoparticles formed by self-assembly of D-8, D-9, D-10, D-11, D-12, D-13 and D-14 in the previous example 11 are used to carry doxorubicin, which is respectively marked as D-8-doxorubicin, D-9-doxorubicin, D-10-doxorubicin, D-11-doxorubicin, D-12-doxorubicin, D-13-doxorubicin and D-14-doxorubicin.
A bulk drug of doxorubicin.
DMSO。
Fifth, the experimental procedure
1.HepG2 cells in the logarithmic growth phase were collected, counted using trypan blue staining for Cell viability of 98.3%, plated at 5000 cells/well in a volume of 100. mu.L/well in 8 96-well plates, 57 wells per plate, and incubated overnight at 37 ℃.
2. The samples to be tested were diluted and added as follows: removing original culture medium, adding 100 μ L culture medium of samples to be tested with different concentrations, and repeating each group for 3 multiple wells.
TABLE 100:
number of holes C9 C8 C7 C6 C5 C4 C3 C2 C1
Final concentration of drug-carried 10μM 3.16μM 1μM 316nM 100nM 31.6nM 10nM 3.16nM 1nM
Final concentration of empty vector 1μM 316nM 100nM 31.6nM 10nM 3.16nM 1nM 0.316nM 0.1nM
Final concentration of parent doxorubicin 10μM 3.16μM 1μM 316nM 100nM 31.6nM 10nM 3.16nM 1nM
DMSO(%) 0.1 0.0316 0.01 0.00316 0.001 0.00036 0.0001 0.000036 0.00001
In this example, each of the drug-loaded and blank vehicles was first prepared as a 100 μ M stock solution in PBS and then diluted in complete medium (biotin-free DMEM). The technical doxorubicin is prepared into a stock solution of 100 μ M with DMSO and then diluted with complete medium (biotin-free DMEM). DMSO was directly diluted with complete medium (biotin-free DMEM).
3. Adding a sample to be detected, and putting a 96-well plate into 5% CO at 37 DEG C2Incubate in incubator for 72 h.
4. The kit was removed and thawed at room temperature, and 10. mu.L of CCK-8 solution was added to each well, or CCK8 solution was mixed with the medium at a ratio of 1:9 and then added to the wells at a rate of 100. mu.L/well.
5. The incubation is continued for 4h in the cell culture box, and the time is determined according to the experimental conditions such as the type of the cells, the density of the cells and the like.
6. Absorbance was measured at 450nm using a microplate reader.
7. And (3) calculating: cell viability (%) (OD experimental-OD blank) × 100%/(OD control-OD blank), IC calculated from GraphPad Prism 5.050
Sixth, experimental results
Table 101:
Figure BDA0002223702040000711
Figure BDA0002223702040000721
and (4) conclusion:
as can be seen from the above table and FIGS. 46a, 46b, 46c, 46D, 46e, 46f, 46g, and 46h, the original doxorubicin and the drug-loaded D-8-doxorubicin, D-9-doxorubicin, D-10-doxorubicin, D-11-doxorubicin, D-12-doxorubicin,IC of D-13-Doxorubicin and D-14-Doxorubicin on HepG2 cells500.2725. mu.M, 0.05087. mu.M, 0.0386, 0.03955, 0.04271, 0.02294, 0.03017 and 0.03458, respectively; IC of DMSO on HepG2 cells50Is composed of>0.1 percent; IC of HepG2 cells acted on by D-8 (blank vector), D-9 (blank vector), D-10 (blank vector), D-11 (blank vector), D-12 (blank vector), D-13 (blank vector) and D-14 (blank vector)50Are all made of>1 μ M. The results show that compared with the pure blank vectors D-8, D-9, D-10, D-11, D-12, D-13 and D-14, the original drug adriamycin of the small molecule drug and the drug-loaded D-8-adriamycin, D-9-adriamycin, D-10-adriamycin, D-11-adriamycin, D-12-adriamycin, D-13-adriamycin and D-14-adriamycin are toxic to HepG2 cells of the HepG2 cell line, and the carried medicines of D-8-adriamycin, D-9-adriamycin, D-10-adriamycin, D-11-adriamycin, D-12-adriamycin, D-13-adriamycin and D-14-adriamycin have obvious synergistic effect compared with the original medicine of adriamycin.
Example 17
According to the chemical method of the mounting method of example 5 (except for special limitation, the method is the same as example 5), the DNA nanoparticles formed by self-assembly of D-10 and D-14 in the previous example 11 were used as the daunorubicin mounting carrier. The absorbance of daunorubicin at 492nm was measured using a microplate reader, and a standard curve was plotted (as shown in FIG. 47).
The daunorubicin carrying rates are respectively measured as follows:
the daunorubicin loading rate of the DNA nanoparticles D-10 was 24.0;
the daunorubicin loading rate of the DNA nanoparticle D-14 was 25.1.
From the above description, it can be seen that the above-mentioned embodiments of the present application achieve the following technical effects: the present application provides a series of nucleic acid nanoparticle carriers with thermodynamic stability, chemical stability, high loading rate, and that can be combined with multiple modules. The unique modular design of this type of vector results in a core modular structure that retains natural compatible affinities, yet has highly stable properties and diverse combinatorial features. The structure can flexibly and efficiently integrate various functional modules, including a targeting module, an imaging and probe module, a treatment module and other composite intelligent modules, so that the structure can be used for targeting delivery in vivo and realizing accurate diagnosis and treatment.
The daunorubicin-containing medicine is formed by loading the small-molecule medicine daunorubicin on the nucleic acid nanoparticle carrier provided by the application, so that the delivery stability of the daunorubicin can be improved, and under the condition that the nucleic acid nanoparticles carry target heads, on one hand, the daunorubicin is delivered to target cells in a targeted mode, the bioavailability of the medicine is improved, on the other hand, toxic and side effects on non-target cells or tissues are reduced due to targeted delivery, the local medicine concentration is reduced, and the toxic and side effects caused by high medicine concentration are further reduced.
The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> Baiyazhida (Beijing) NanoBiotechnology Ltd
<120> daunorubicin-containing medicine, preparation method, pharmaceutical composition and application thereof
<130> PN114933BYZD
<141> 2019-09-30
<150> 201811161984.6
<151> 2018-09-30
<160> 171
<170> SIPOSequenceListing 1.0
<210> 1
<211> 10
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(10)
<223> a1 sequence
<400> 1
ccagcguucc 10
<210> 2
<211> 10
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> mRNA
<222> (1)..(10)
<223> a1 sequence
<400> 2
ccagcgttcc 10
<210> 3
<211> 9
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(9)
<223> b1 sequence
<400> 3
gguucgccg 9
<210> 4
<211> 9
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(9)
<223> b1 sequences
<400> 4
ggttcgccg 9
<210> 5
<211> 12
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(12)
<223> c1 sequence
<400> 5
cggccauagc gg 12
<210> 6
<211> 12
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(12)
<223> c1 sequence
<400> 6
cggccatagc gg 12
<210> 7
<211> 10
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(10)
<223> a sequence
<400> 7
ggagcguugg 10
<210> 8
<211> 9
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(9)
<223> b sequences
<400> 8
ccuucgccg 9
<210> 9
<211> 12
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(12)
<223> c sequence
<400> 9
cggccauagc cc 12
<210> 10
<211> 10
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(10)
<223> a sequence
<400> 10
gcagcguucg 10
<210> 11
<211> 9
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(9)
<223> b sequences
<400> 11
cguucgccg 9
<210> 12
<211> 12
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(12)
<223> c sequence
<400> 12
cggccauagc gc 12
<210> 13
<211> 10
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(10)
<223> a sequence
<400> 13
cgagcguugc 10
<210> 14
<211> 9
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(9)
<223> b sequences
<400> 14
gcuucgccg 9
<210> 15
<211> 12
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(12)
<223> c sequence
<400> 15
cggccauagc cg 12
<210> 16
<211> 10
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(10)
<223> a sequence
<400> 16
ggagcguugg 10
<210> 17
<211> 9
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(9)
<223> b sequence
<400> 17
ccuucgggg 9
<210> 18
<211> 12
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(12)
<223> c sequence
<400> 18
cccccauagc cc 12
<210> 19
<211> 10
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(10)
<223> a sequence
<400> 19
gcagcguucg 10
<210> 20
<211> 9
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(9)
<223> b sequence
<400> 20
cguucggcg 9
<210> 21
<211> 12
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(12)
<223> c sequence
<400> 21
cgcccauagc gc 12
<210> 22
<211> 10
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(10)
<223> a sequence
<400> 22
gcagcguucg 10
<210> 23
<211> 9
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(9)
<223> b sequence
<400> 23
cguucggcc 9
<210> 24
<211> 12
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(12)
<223> c sequence
<400> 24
ggcccauagc gc 12
<210> 25
<211> 10
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(10)
<223> a sequence
<400> 25
cgagcguugc 10
<210> 26
<211> 9
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(9)
<223> b sequences
<400> 26
gcuucggcg 9
<210> 27
<211> 12
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(12)
<223> c sequence
<400> 27
cgcccauagc cg 12
<210> 28
<211> 10
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(10)
<223> a sequence
<400> 28
ggagcgttgg 10
<210> 29
<211> 9
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(9)
<223> b sequence
<400> 29
ccttcgccg 9
<210> 30
<211> 12
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(12)
<223> c sequence
<400> 30
cggccatagc cc 12
<210> 31
<211> 10
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(10)
<223> a sequence
<400> 31
gcagcgttcg 10
<210> 32
<211> 9
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(9)
<223> b sequence
<400> 32
cgttcgccg 9
<210> 33
<211> 12
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(12)
<223> c sequence
<400> 33
cggccatagc gc 12
<210> 34
<211> 10
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(10)
<223> a sequence
<400> 34
cgagcgttgc 10
<210> 35
<211> 9
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(9)
<223> b sequence
<400> 35
gcttcgccg 9
<210> 36
<211> 12
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(12)
<223> c sequence
<400> 36
cggccatagc cg 12
<210> 37
<211> 10
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(10)
<223> a sequence
<400> 37
ggagcgttgg 10
<210> 38
<211> 9
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(9)
<223> b sequences
<400> 38
ccttcgggg 9
<210> 39
<211> 12
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(12)
<223> c sequence
<400> 39
cccccatagc cc 12
<210> 40
<211> 10
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(10)
<223> a sequence
<400> 40
gcagcgttcg 10
<210> 41
<211> 9
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(9)
<223> b sequence
<400> 41
cgttcggcg 9
<210> 42
<211> 12
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(12)
<223> c sequence
<400> 42
cgcccatagc gc 12
<210> 43
<211> 10
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(10)
<223> a sequence
<400> 43
gcagcgttcg 10
<210> 44
<211> 9
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(9)
<223> b sequence
<400> 44
cgttcggcc 9
<210> 45
<211> 12
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(12)
<223> c sequence
<400> 45
ggcccatagc gc 12
<210> 46
<211> 10
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(10)
<223> a sequence
<400> 46
cgagcgttgc 10
<210> 47
<211> 9
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(9)
<223> b sequence
<400> 47
gcttcggcg 9
<210> 48
<211> 12
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(12)
<223> c sequence
<400> 48
cgcccatagc cg 12
<210> 49
<211> 77
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(77)
<223> a sequence
<220>
<221> misc_feature
<222> (1)..(77)
<223> wherein M is U or T
<400> 49
cgcgcgaaaa aacgcgcgaa aaaacgcgcg cccaccagcg mmccgggcgc gcgaaaaaac 60
gcgcgaaaaa acgcgcg 77
<210> 50
<211> 75
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(75)
<223> b sequence
<220>
<221> misc_feature
<222> (1)..(75)
<223> wherein M is U or T
<400> 50
cgcgcgmmmm mmcgcgcgmm mmmmcgcgcg cccggmmcgc cgccagccgc cmmmmmmgcc 60
gccmmmmmmg ccgcc 75
<210> 51
<211> 78
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(78)
<223> c sequence
<220>
<221> misc_feature
<222> (1)..(78)
<223> wherein M is U or T
<400> 51
ggcggcaaaa aaggcggcaa aaaaggcggc aggcggcama gcggmgggcg cgcgmmmmmm 60
cgcgcgmmmm mmcgcgcg 78
<210> 52
<211> 29
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(29)
<223> a chain
<220>
<221> modified_base
<222> (1)..(1)
<223> 5'Biotin
<400> 52
cgcgcgccca ccagcguucc gggcgccgc 29
<210> 53
<211> 27
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(27)
<223> b chain
<220>
<221> modified_base
<222> (1)..(1)
<223> 5'Biotin
<400> 53
gcggcgcccg guucgccgcc aggcggc 27
<210> 54
<211> 31
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(31)
<223> c chain
<220>
<221> modified_base
<222> (1)..(1)
<223> 5'CY3
<400> 54
gccgccaggc ggccauagcg gugggcgcgc g 31
<210> 55
<211> 10
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(10)
<223> a chain
<400> 55
ggagcguugg 10
<210> 56
<211> 9
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(9)
<223> b chain
<400> 56
ccuucgccg 9
<210> 57
<211> 12
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(12)
<223> c chain
<400> 57
cggccauagc cc 12
<210> 58
<211> 10
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(10)
<223> a chain
<400> 58
gcagcguucg 10
<210> 59
<211> 9
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(9)
<223> b chain
<400> 59
cguucgccg 9
<210> 60
<211> 12
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(12)
<223> c chain
<400> 60
cggccauagc gc 12
<210> 61
<211> 10
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(10)
<223> a chain
<400> 61
cgagcguugc 10
<210> 62
<211> 9
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(9)
<223> b chain
<400> 62
gcuucgccg 9
<210> 63
<211> 12
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(12)
<223> c chain
<400> 63
cggccauagc cg 12
<210> 64
<211> 10
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(10)
<223> a chain
<400> 64
ggagcguugg 10
<210> 65
<211> 9
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(9)
<223> b chain
<400> 65
ccuucgggg 9
<210> 66
<211> 12
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(12)
<223> c chain
<400> 66
cccccauagc cc 12
<210> 67
<211> 10
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(10)
<223> a chain
<400> 67
gcagcguucg 10
<210> 68
<211> 9
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(9)
<223> b chain
<400> 68
cguucggcg 9
<210> 69
<211> 12
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(12)
<223> c chain
<400> 69
cgcccauagc gc 12
<210> 70
<211> 10
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(10)
<223> a chain
<400> 70
gcagcguucg 10
<210> 71
<211> 9
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(9)
<223> b chain
<400> 71
cguucggcc 9
<210> 72
<211> 12
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(12)
<223> c chain
<400> 72
ggcccauagc gc 12
<210> 73
<211> 10
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(10)
<223> a chain
<400> 73
cgagcguugc 10
<210> 74
<211> 9
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(9)
<223> b chain
<400> 74
gcuucggcg 9
<210> 75
<211> 12
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(12)
<223> c chain
<400> 75
cgcccauagc cg 12
<210> 76
<211> 29
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(29)
<223> a chain
<400> 76
cgcgcgccca ggagcguugg cgggcggcg 29
<210> 77
<211> 27
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(27)
<223> b chain
<400> 77
cgccgcccgc cuucgccgcc agccgcc 27
<210> 78
<211> 31
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(31)
<223> c chain
<400> 78
ggcggcaggc ggccauagcc cugggcgcgc g 31
<210> 79
<211> 29
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(29)
<223> a chain
<400> 79
cgcgcgccca gcagcguucg cgggcggcg 29
<210> 80
<211> 27
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(27)
<223> b chain
<400> 80
cgccgcccgc guucgccgcc agccgcc 27
<210> 81
<211> 31
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(31)
<223> c chain
<400> 81
ggcggcaggc ggccauagcg cugggcgcgc g 31
<210> 82
<211> 29
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(29)
<223> a chain
<400> 82
cgcgcgccca cgagcguugc ggggcggcg 29
<210> 83
<211> 27
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(27)
<223> b chain
<400> 83
cgccgccccg cuucgccgcc agccgcc 27
<210> 84
<211> 31
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(31)
<223> c chain
<400> 84
ggcggcaggc ggccauagcc gugggcgcgc g 31
<210> 85
<211> 29
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(29)
<223> a chain
<400> 85
cgcgcgccca ggagcguugg cccgcggcg 29
<210> 86
<211> 27
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(27)
<223> b chain
<400> 86
cgccgcgggc cuucggggcc agccgcc 27
<210> 87
<211> 31
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(31)
<223> c chain
<400> 87
ggcggcaggc ccccauagcc cugggcgcgc g 31
<210> 88
<211> 29
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(29)
<223> a chain
<400> 88
cgcgcgccca gcagcguucg ccccgccgc 29
<210> 89
<211> 27
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(27)
<223> b chain
<400> 89
gcggcggggc guucggcggc aggcggc 27
<210> 90
<211> 31
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(31)
<223> c chain
<400> 90
gccgccagcc gcccauagcg cugggcgcgc g 31
<210> 91
<211> 29
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(29)
<223> a chain
<400> 91
cgcgcgccca gcagcguucg gggcgccgc 29
<210> 92
<211> 28
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(28)
<223> b chain
<400> 92
gcggcgcccc guucggccgg caggcggc 28
<210> 93
<211> 32
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(32)
<223> c chain
<400> 93
gccgccagcc ggcccauagc gcugggcgcg cg 32
<210> 94
<211> 40
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(40)
<223> a chain
<400> 94
cgcgcgcgag cguugcaaug acagauaagg aaccugcutt 40
<210> 95
<211> 36
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(36)
<223> b chain
<400> 95
ggcagguucc uuaucuguca aagcuucggc ggcagc 36
<210> 96
<211> 23
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(23)
<223> c chain
<400> 96
gcagccgccc auagccgcgc gcg 23
<210> 97
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(39)
<223> EGFRapt
<400> 97
gccttagtaa cgtgctttga tgtcgattcg acaggaggc 39
<210> 98
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(41)
<223> PSMAapt
<400> 98
gggccgaaaa agacctgact tctatactaa gtctacgtcc c 41
<210> 99
<211> 68
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(68)
<223> a chain
<400> 99
cgcgcgccca ggagcgttgg cgggcggcgg ccttagtaac gtgctttgat gtcgattcga 60
caggaggc 68
<210> 100
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(27)
<223> b chain
<400> 100
cgccgcccgc cttcgccgcc agccgcc 27
<210> 101
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(31)
<223> c chain
<400> 101
ggcggcaggc ggccatagcc ctgggcgcgc g 31
<210> 102
<211> 68
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(68)
<223> a chain
<400> 102
cgcgcgccca gcagcgttcg cgggcggcgg ccttagtaac gtgctttgat gtcgattcga 60
caggaggc 68
<210> 103
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(27)
<223> b chain
<400> 103
cgccgcccgc gttcgccgcc agccgcc 27
<210> 104
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(31)
<223> c chain
<400> 104
ggcggcaggc ggccatagcg ctgggcgcgc g 31
<210> 105
<211> 68
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(68)
<223> a chain
<400> 105
cgcgcgccca cgagcgttgc ggggcggcgg ccttagtaac gtgctttgat gtcgattcga 60
caggaggc 68
<210> 106
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(27)
<223> b chain
<400> 106
cgccgccccg cttcgccgcc agccgcc 27
<210> 107
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(31)
<223> c chain
<400> 107
ggcggcaggc ggccatagcc gtgggcgcgc g 31
<210> 108
<211> 71
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(71)
<223> a chain
<400> 108
cgcgcgccca ggagcgttgg cccgcggcgt gggccgaaaa agacctgact tctatactaa 60
gtctacgtcc c 71
<210> 109
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(27)
<223> b chain
<400> 109
cgccgcgggc cttcggggcc agccgcc 27
<210> 110
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(31)
<223> c chain
<400> 110
ggcggcaggc ccccatagcc ctgggcgcgc g 31
<210> 111
<211> 71
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(71)
<223> a chain
<400> 111
cgcgcgccca gcagcgttcg ccccgccgct gggccgaaaa agacctgact tctatactaa 60
gtctacgtcc c 71
<210> 112
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(27)
<223> b chain
<400> 112
gcggcggggc gttcggcggc aggcggc 27
<210> 113
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(31)
<223> c chain
<400> 113
gccgccagcc gcccatagcg ctgggcgcgc g 31
<210> 114
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(29)
<223> a chain
<400> 114
cgcgcgccca gcagcgttcg gggcgccgc 29
<210> 115
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(20)
<223> b chain
<400> 115
gcggcgcccc gttcggccgg caggcggc 28
<210> 116
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(32)
<223> c chain
<400> 116
gccgccagcc ggcccatagc gctgggcgcg cg 32
<210> 117
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(29)
<223> a chain
<400> 117
cgcgcgccca cgagcgttgc gggcgccgc 29
<210> 118
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(27)
<223> b chain
<400> 118
gcggcgcccg cttcggcggc aggcggc 27
<210> 119
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (1)..(31)
<223> c chain
<400> 119
gccgccagcc gcccatagcc gtgggcgcgc g 31
<210> 120
<211> 37
<212> RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(37)
<223> a chain
<400> 120
gcggcgagcg gcgaggagcg uuggggccgg aggccgg 37
<210> 121
<211> 31
<212> RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(37)
<223> b chain
<400> 121
ccggccuccg gccccuucgg ggccagccgc c 31
<210> 122
<211> 35
<212> RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(35)
<223> c chain
<400> 122
ggcggcaggc ccccauagcc cucgccgcuc gccgc 35
<210> 123
<211> 37
<212> RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(37)
<223> a chain
<400> 123
gcggcgagcg gcgagcagcg uucgggccgg aggccgg 37
<210> 124
<211> 31
<212> RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(31)
<223> b chain
<400> 124
ccggccuccg gcccguucgc cgccagccgc c 31
<210> 125
<211> 35
<212> RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(35)
<223> c chain
<400> 125
ggcggcaggc ggccauagcg cucgccgcuc gccgc 35
<210> 126
<211> 37
<212> RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(37)
<223> a chain
<400> 126
gcggcgagcg gcgaggagcg uuggggccgg aggccgg 37
<210> 127
<211> 31
<212> RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(31)
<223> b chain
<400> 127
ccggccuccg gccccuucgc cgccagccgc c 31
<210> 128
<211> 35
<212> RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(35)
<223> c chain
<400> 128
ggcggcaggc ggccauagcc cucgccgcuc gccgc 35
<210> 129
<211> 37
<212> RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(37)
<223> a chain
<400> 129
gcggcgagcg gcgagcagcg uucgggccgg aggccgg 37
<210> 130
<211> 31
<212> RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(31)
<223> b chain
<400> 130
ccggccuccg gcccguucgg cgccagccgc c 31
<210> 131
<211> 35
<212> RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(35)
<223> c chain
<400> 131
ggcggcaggc gcccauagcg cucgccgcuc gccgc 35
<210> 132
<211> 37
<212> RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(37)
<223> a chain
<400> 132
gcggcgagcg gcgagcagcg uucgggccgg aggccgg 37
<210> 133
<211> 31
<212> RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(31)
<223> b chain
<400> 133
ccggccuccg gcccguucgg ccccagccgc c 31
<210> 134
<211> 35
<212> RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(35)
<223> c chain
<400> 134
ggcggcaggg gcccauagcg cucgccgcuc gccgc 35
<210> 135
<211> 37
<212> RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(37)
<223> a chain
<400> 135
gcggcgagcg gcgacgagcg uugcggccgg aggccgg 37
<210> 136
<211> 31
<212> RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(31)
<223> b chain
<400> 136
ccggccuccg gccgcuucgc cgccagccgc c 31
<210> 137
<211> 35
<212> RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(35)
<223> c chain
<400> 137
ggcggcaggc ggccauagcc gucgccgcuc gccgc 35
<210> 138
<211> 37
<212> RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(37)
<223> a chain
<400> 138
gcggcgagcg gcgacgagcg uugcggccgg aggccgg 37
<210> 139
<211> 31
<212> RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(31)
<223> b chain
<400> 139
ccggccuccg gccgcuucgg cgccagccgc c 31
<210> 140
<211> 35
<212> RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(35)
<223> c chain
<400> 140
ggcggcaggc gcccauagcc gucgccgcuc gccgc 35
<210> 141
<211> 37
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(37)
<223> a chain
<400> 141
gcggcgagcg gcgaggagcg ttggggccgg aggccgg 37
<210> 142
<211> 31
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(31)
<223> b chain
<400> 142
ccggcctccg gccccttcgg ggccagccgc c 31
<210> 143
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(35)
<223> c chain
<400> 143
ggcggcaggc ccccatagcc ctcgccgctc gccgc 35
<210> 144
<211> 37
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(37)
<223> a chain
<400> 144
gcggcgagcg gcgagcagcg ttcgggccgg aggccgg 37
<210> 145
<211> 31
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(31)
<223> b chain
<400> 145
ccggcctccg gcccgttcgc cgccagccgc c 31
<210> 146
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(35)
<223> c chain
<400> 146
ggcggcaggc ggccatagcg ctcgccgctc gccgc 35
<210> 147
<211> 37
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(37)
<223> a chain
<400> 147
gcggcgagcg gcgaggagcg ttggggccgg aggccgg 37
<210> 148
<211> 31
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(31)
<223> b chain
<400> 148
ccggcctccg gccccttcgc cgccagccgc c 31
<210> 149
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(35)
<223> c chain
<400> 149
ggcggcaggc ggccatagcc ctcgccgctc gccgc 35
<210> 150
<211> 37
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(37)
<223> a chain
<400> 150
gcggcgagcg gcgagcagcg ttcgggccgg aggccgg 37
<210> 151
<211> 31
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(31)
<223> b chain
<400> 151
ccggcctccg gcccgttcgg cgccagccgc c 31
<210> 152
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(35)
<223> c chain
<400> 152
ggcggcaggc gcccatagcg ctcgccgctc gccgc 35
<210> 153
<211> 37
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(37)
<223> a chain
<400> 153
gcggcgagcg gcgagcagcg ttcgggccgg aggccgg 37
<210> 154
<211> 31
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(31)
<223> b chain
<400> 154
ccggcctccg gcccgttcgg ccccagccgc c 31
<210> 155
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(35)
<223> c chain
<400> 155
ggcggcaggg gcccatagcg ctcgccgctc gccgc 35
<210> 156
<211> 37
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(37)
<223> a chain
<400> 156
gcggcgagcg gcgacgagcg ttgcggccgg aggccgg 37
<210> 157
<211> 31
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(31)
<223> b chain
<400> 157
ccggcctccg gccgcttcgc cgccagccgc c 31
<210> 158
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(35)
<223> c chain
<400> 158
ggcggcaggc ggccatagcc gtcgccgctc gccgc 35
<210> 159
<211> 37
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(37)
<223> a chain
<400> 159
gcggcgagcg gcgacgagcg ttgcggccgg aggccgg 37
<210> 160
<211> 31
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(31)
<223> b chain
<400> 160
ccggcctccg gccgcttcgg cgccagccgc c 31
<210> 161
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(35)
<223> c chain
<400> 161
ggcggcaggc gcccatagcc gtcgccgctc gccgc 35
<210> 162
<211> 14
<212> DNA/RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(14)
<223> first extension segment
<400> 162
gcggcgagcg gcga 14
<210> 163
<211> 14
<212> DNA/RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(14)
<223> first extension segment
<400> 163
ucgccgcucg ccgc 14
<210> 164
<211> 13
<212> DNA/RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(13)
<223> first extension segment
<400> 164
ggccggaggc cgg 13
<210> 165
<211> 13
<212> DNA/RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(13)
<223> first extension segment
<400> 165
ccggccuccg gcc 13
<210> 166
<211> 9
<212> DNA/RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(9)
<223> first extension segment
<400> 166
ccagccgcc 9
<210> 167
<211> 9
<212> DNA/RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(9)
<223> first extension segment
<400> 167
ggcggcagg 9
<210> 168
<211> 14
<212> DNA/RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(14)
<223> first extension segment
<400> 168
gcggcgagcg gcga 14
<210> 169
<211> 14
<212> DNA/RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(14)
<223> first extension segment
<400> 169
tcgccgctcg ccgc 14
<210> 170
<211> 13
<212> DNA/RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(13)
<223> first extension segment
<400> 170
ggccggaggc cgg 13
<210> 171
<211> 13
<212> DNA/RNA
<213> Artificial Sequence
<220>
<221> misc_feature
<222> (1)..(13)
<223> first extension segment
<400> 171
ccggcctccg gcc 13

Claims (46)

1. A daunorubicin-containing medicament, comprising a nucleic acid nanoparticle and daunorubicin, wherein the daunorubicin is carried on the nucleic acid nanoparticle;
the nucleic acid nanoparticle comprises a nucleic acid domain comprising a sequence a comprising a variant sequence of a1 sequence, a sequence b comprising a variant sequence of b1 sequence, and a sequence c comprising a variant sequence of c1 sequence;
wherein the sequence a1 is SEQ ID NO: 1: 5'-CCAGCGUUCC-3' or SEQ ID NO: 2: 5'-CCAGCGTTCC-3', respectively;
the b1 sequence is SEQ ID NO: 3: 5 '-GGUUCGCCG-3' or SEQ ID NO: 4: 5 '-GGTTCGCCG-3';
the c1 sequence is SEQ ID NO: 5'-CGGCCAUAGCGG-3' or SEQ ID NO: 6: 5'-CGGCCATAGCGG-3';
the sequence a, the sequence b and the sequence c self-assemble to form a structure shown in formula (1):
Figure DEST_PATH_IMAGE002
… … … formula (1) is shown,
wherein W-C represents a Watson-Crick pair, N and N' represent non-Watson-Crick pairs, and W-C at any position is independently selected from C-G or G-C;
in the a sequence, the first N from the 5' end is A, the second N is G, the third N is U or T, and the fourth N is any one of U, T, A, C or G;
in the b sequence, the first N 'from the 5' end is any one of U, T, A, C or G; the second N 'is U or T, and the third N' is C;
in the c sequence, the NNNN sequence along the direction from the 5 'end to the 3' end is CAUA or CATA;
the sequence a, the sequence b and the sequence c are any one of the following groups:
(1) a sequence: 5'-GGAGCGUUGG-3', and the adhesive tape is used for adhering the film to a substrate,
b sequence: 5'-CCUUCGCCG-3',
c sequence: 5'-CGGCCAUAGCCC-3';
(2) a sequence: 5'-GCAGCGUUCG-3', and the adhesive tape is used for adhering the film to a substrate,
b sequence: 5'-CGUUCGCCG-3',
c sequence: 5'-CGGCCAUAGCGC-3', respectively;
(3) a sequence: 5'-CGAGCGUUGC-3', and the adhesive tape is used for adhering the film to a substrate,
b sequence: 5'-GCUUCGCCG-3',
c sequence: 5'-CGGCCAUAGCCG-3';
(4) a sequence: 5'-GGAGCGUUGG-3' the flow of the air in the air conditioner,
b sequence: 5 '-CCUUCGGG-3',
c sequence: 5'-CCCCCAUAGCCC-3', respectively;
(5) a sequence: 5'-GCAGCGUUCG-3', and the adhesive tape is used for adhering the film to a substrate,
b sequence: 5'-CGUUCGGCG-3',
c sequence: 5'-CGCCCAUAGCGC-3', respectively;
(6) a sequence: 5'-GCAGCGUUCG-3', and the adhesive tape is used for adhering the film to a substrate,
b sequence: 5'-CGUUCGGCC-3',
c sequence: 5'-GGCCCAUAGCGC-3', respectively;
(7) a sequence: 5'-CGAGCGUUGC-3' the flow of the air in the air conditioner,
b sequence: 5'-GCUUCGGCG-3',
c sequence: 5'-CGCCCAUAGCCG-3', respectively;
(8) a sequence: 5'-GGAGCGTTGG-3' the flow of the air in the air conditioner,
b sequence: 5'-CCTTCGCCG-3',
c sequence: 5'-CGGCCATAGCCC-3';
(9) a sequence: 5'-GCAGCGTTCG-3' the flow of the air in the air conditioner,
b sequence: 5'-CGTTCGCCG-3',
c sequence: 5'-CGGCCATAGCGC-3';
(10) a sequence: 5'-CGAGCGTTGC-3', and the adhesive tape is used for adhering the film to a substrate,
b sequence: 5'-GCTTCGCCG-3',
c sequence: 5'-CGGCCATAGCCG-3';
(11) a sequence: 5'-GGAGCGTTGG-3' the flow of the air in the air conditioner,
b sequence: 5'-CCTTCGGGG-3',
c sequence: 5'-CCCCCATAGCCC-3', respectively;
(12) a sequence: 5'-GCAGCGTTCG-3', and the adhesive tape is used for adhering the film to a substrate,
b sequence: 5'-CGTTCGGCG-3',
c sequence: 5'-CGCCCATAGCGC-3';
(13) a sequence: 5'-GCAGCGTTCG-3', and the adhesive tape is used for adhering the film to a substrate,
b sequence: 5'-CGTTCGGCC-3',
c sequence: 5'-GGCCCATAGCGC-3';
(14) a sequence: 5'-CGAGCGTTGC-3', and the adhesive tape is used for adhering the film to a substrate,
b sequence: 5'-GCTTCGGCG-3',
c sequence: 5'-CGCCCATAGCCG-3' are provided.
2. The agent of claim 1, wherein the nucleic acid domain further comprises a first extension that is a Watson-Crick paired extension located 5 'and/or 3' to any of the a, b, and c sequences.
3. The medicament according to claim 2,
the first extension is selected from any one of the following:
(1): a 5' end of the chain: 5' -CCCA-3', 3' end of c strand: 5 '-UGGG-3';
(2): a 3' end of chain: 5' -GGG-3', 5' end of b chain: 5 '-CCC-3';
(3): b 3' end of strand: 5' -CCA-3', 5' end of c chain: 5 '-UGG-3';
(4): a 5' end of chain: 5' -CCCG-3', 3' end of c strand: 5 '-CGGG-3';
(5): a 5' end of the chain: 5' -CCCC-3', 3' end of c strand: 5 '-GGGG-3';
(6): b 3' end of strand: 5' -CCC-3', 5' -end of c chain: 5 '-GGG-3';
(7): b 3' end of strand: 5' -CCG-3', the 5' end of the c chain: 5 '-CGG-3';
(8): a 5' end of the chain: 5' -CCCA-3', 3' end of c strand: 5 '-TGGG-3';
(9): b 3' end of strand: 5' -CCA-3', 5' end of c chain: 5 '-TGG-3'.
4. The agent of any one of claims 1 to 3, wherein the nucleic acid domain further comprises a second extension located 5 'and/or 3' to any of the a, b, and c sequences, wherein the second extension is a Watson-Crick paired extension.
5. The agent of claim 4, wherein said second extension is an extension of CG base pairs.
6. The drug of claim 5, wherein the second extension is an extension of 1 to 10 CG base pairs.
7. The agent of claim 4, wherein said nucleic acid domain further comprises at least one second extension selected from the group consisting of:
a first group: a 5' end of chain: 5' -CGCGCG-3 ', 3' -end of c chain: 5 '-CGCGCG-3';
second group: a 3' end of chain: 5' -CGCCGC-3 ', 5' -end of b chain: 5 '-GCGGCG-3';
third group: b 3' end of strand: 5' -GGCGGC-3 ', 5' -end of c chain: 5 '-GCCGCC-3'.
8. The agent of claim 4, wherein said second extension is an extended sequence comprising both CG base pairs and AT/AU base pairs.
9. The agent of claim 8, wherein the second extension is an extended sequence of 2 to 50 base pairs.
10. The drug of claim 8, wherein the second extension is an extension in which a sequence of 2 to 8 CG base pairs in succession alternates with a sequence of 2 to 8 AT/AU base pairs in succession; or the second extension is an extension sequence formed by alternating a sequence of 1 CG base pair and a sequence of 1 AT/AU base pair.
11. The agent according to any one of claims 1 to 3, wherein the bases, ribose and phosphate in the a sequence, the b sequence and the c sequence have at least one modifiable site, and any of the modifiable sites is modified by any one of the following modifying linkers: -F, methyl, amino, disulfide, carbonyl, carboxyl, mercapto and aldehyde groups.
12. The agent of claim 11, wherein the sequence a, the sequence b and the sequence C have 2' -F modifications at the C or U bases.
13. The drug according to any one of claims 1 to 3, wherein the daunorubicin is carried on the nucleic acid nanoparticles in a physically and/or covalently linked form, and the molar ratio between the daunorubicin and the nucleic acid nanoparticles is 2-300: 1.
14. The drug according to claim 13, wherein the molar ratio between the daunorubicin and the nucleic acid nanoparticles is 10-50: 1.
15. The medicament of claim 14, wherein the molar ratio between the daunorubicin and the nucleic acid nanoparticles is 15-25: 1.
16. The drug of any one of claims 1 to 3, wherein the nucleic acid nanoparticle further comprises a biologically active substance attached to the nucleic acid domain, the biologically active substance being one or more of a target, a fluorescein, an interfering nucleic acid siRNA, a miRNA, a ribozyme, a riboswitch, an aptamer, an RNA antibody, a protein, a polypeptide, a flavonoid, glucose, natural salicylic acid, a monoclonal antibody, a vitamin, a phenol, lecithin, and a small molecule drug other than daunorubicin;
17. the drug of claim 16, wherein the bioactive agent is one or more of the target head, the fluorescein and the miRNA, wherein the target head is located at the 5' end or the 3' end of any of the a, b and c sequences or is inserted between GC bonds of the nucleic acid domain, the miRNA is an anti-miRNA, the fluorescein is modified at the 5' end or the 3' end of the anti-miRNA, and the miRNA is located at any one or more of the 3' end of the a sequence, the 5' end and the 3' end of the c sequence.
18. The medicament of claim 17, wherein the target head is folic acid or biotin, the fluorescein is any one or more of FAM, CY5 and CY3, and the anti-miRNA is anti-miR-21;
19. the drug of claim 16, wherein the small molecule drug other than daunorubicin is a drug comprising any one or more of the following groups: amino groups, hydroxyl groups, carboxyl groups, mercapto groups, phenyl ring groups, and acetamido groups.
20. The medicament of claim 16, wherein the protein is one or more of SOD, survivin, hTERT, EGFR, and PSMA; the vitamin is levo-C and/or esterified C; the phenols are tea polyphenols and/or grape polyphenols.
21. The agent of claim 16, wherein the relative molecular weight of the nucleic acid domains is recorded as N1The total relative ratio of daunorubicin to the biologically active substance is dividedThe quantum is denoted as N2,N1/ N2≥1:1。
22. The drug according to claim 1, wherein the nucleic acid nanoparticles have a particle size of 1 to 100 nm.
23. The drug of claim 22, wherein the nucleic acid nanoparticles have a particle size of 5 to 50 nm.
24. The drug of claim 23, wherein the nucleic acid nanoparticles have a particle size of 10-30 nm.
25. The drug of claim 24, wherein the nucleic acid nanoparticles have a particle size of 10-15 nm.
26. A preparation method of a medicine containing daunorubicin is characterized by comprising the following steps:
providing a nucleic acid nanoparticle in the medicament of any one of claims 1 to 25;
and (2) carrying daunorubicin on the nucleic acid nanoparticles in a physical connection and/or covalent connection mode to obtain the daunorubicin-containing medicine.
27. The method of claim 26, wherein the step of loading daunorubicin by physical attachment comprises:
mixing and stirring the daunorubicin, the nucleic acid nanoparticles and the first solvent to obtain a premixed system;
and precipitating the premixed system to obtain the medicine containing daunorubicin.
28. The method of claim 27, wherein the first solvent is selected from one or more of DCM, DCC, DMAP, Py, DMSO, PBS and glacial acetic acid;
29. the method of claim 27, wherein the step of precipitating the premixed system to obtain the daunorubicin-containing drug comprises;
precipitating the premixed system to obtain a precipitate;
and washing the precipitate to remove impurities to obtain the medicine containing daunorubicin.
30. The method of claim 29,
and mixing the premixed system with absolute ethyl alcohol, and then carrying out precipitation at the temperature lower than 10 ℃ to obtain the precipitate.
31. The method of claim 30, wherein,
and (3) precipitating at the temperature of 0-5 ℃ to obtain the precipitate.
32. The method of claim 29,
and (3) washing the precipitate by adopting absolute ethyl alcohol with the volume of 6-12 times to remove impurities, thus obtaining the medicine containing daunorubicin.
33. The method of claim 26, wherein the step of loading daunorubicin by covalent attachment comprises:
preparing a daunorubicin solution;
reacting the daunorubicin solution with the amino outside the G ring of the nucleic acid nano-particles under the mediation of formaldehyde to obtain a reaction system;
purifying the reaction system to obtain the medicine containing daunorubicin.
34. The method of claim 33,
the step of reacting comprises:
and mixing the daunorubicin solution, the paraformaldehyde solution and the nucleic acid nanoparticles, and reacting under a dark condition to obtain the reaction system.
35. The method according to claim 34, wherein the concentration of the paraformaldehyde solution is 3.7 to 4 wt%.
36. The method according to claim 35, wherein the paraformaldehyde solution is a mixture of paraformaldehyde and a second solvent, and the second solvent is one or more of DCM, DCC, DMAP, Py, DMSO, PBS and glacial acetic acid.
37. The production method according to any one of claims 26 to 36, further comprising a step of producing the nucleic acid nanoparticle, which comprises: the nucleic acid domain is obtained by self-assembly of corresponding single strands of the nucleic acid domain in the medicament of any one of claims 1 to 25.
38. The method of claim 37,
after obtaining the nucleic acid domain, the method of making further comprises: the nucleic acid nanoparticle is obtained by mounting a bioactive substance in the drug according to any one of claims 16 to 21 on the nucleic acid domain by means of physical and/or covalent attachment.
39. The method according to claim 37, wherein the biologically active substance is immobilized by covalent bonding by solvent covalent bonding, linker covalent bonding or click bonding.
40. The method according to claim 39, wherein a third solvent used in the covalent linkage of the solvents is used as a linking medium, and the third solvent is one or more selected from paraformaldehyde, DCM, DCC, DMAP, Py, DMSO, PBS and glacial acetic acid.
41. The method of claim 39, wherein the linker is selected from the group consisting of disulfide bond, p-azido group, bromopropyne, and PEG.
42. The method of claim 39, wherein the click-through linkage is performed by modifying the nucleic acid domain and the bioactive substance precursor with an alkynyl or azide modification at the same time and then by click-through linkage.
43. The method of claim 42, wherein the biologically active substance is click-linked to the nucleic acid domain, the site of the biologically active substance precursor for the alkynyl or azido modification is selected from the group consisting of a 2 ' hydroxyl, a carboxyl or an amino group, and the site of the nucleic acid domain for the alkynyl or azido modification is selected from the group consisting of a G exocyclic amino, a 2 ' -hydroxyl, an A amino or a 2 ' -hydroxyl group.
44. A pharmaceutical composition comprising the daunorubicin-containing medicament of any one of claims 1 to 25.
45. Use of a daunorubicin-containing medicament of any one of claims 1 to 25 in the manufacture of a medicament for the treatment of a tumor.
46. The use of claim 45, wherein the tumor is acute lymphocytic leukemia or granulocytic leukemia.
CN201910944097.4A 2018-09-30 2019-09-30 Medicine containing daunorubicin, preparation method thereof, medicine composition and application thereof Active CN110960689B (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN2018111619846 2018-09-30
CN201811161984 2018-09-30

Publications (2)

Publication Number Publication Date
CN110960689A CN110960689A (en) 2020-04-07
CN110960689B true CN110960689B (en) 2022-07-22

Family

ID=70029644

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910944097.4A Active CN110960689B (en) 2018-09-30 2019-09-30 Medicine containing daunorubicin, preparation method thereof, medicine composition and application thereof

Country Status (1)

Country Link
CN (1) CN110960689B (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103403189A (en) * 2011-06-08 2013-11-20 辛辛那提大学 PRNA mutlivalent junction domain for use in stable multivalent RNA nanoparticles
CN104327141A (en) * 2014-10-16 2015-02-04 上海交通大学 RNA nanoparticle and application of RNA nanoparticle in preventing and curing stomach cancer
WO2016145008A2 (en) * 2015-03-09 2016-09-15 University Of Kentucky Research Foundation Mirna for treatment of breast cancer
WO2016145005A1 (en) * 2015-03-09 2016-09-15 University Of Kentucky Research Foundation Rna nanoparticles for brain tumor treatment
CN107614685A (en) * 2015-04-17 2018-01-19 肯塔基大学研究基金会 RNA nano particles and its application method

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103403189A (en) * 2011-06-08 2013-11-20 辛辛那提大学 PRNA mutlivalent junction domain for use in stable multivalent RNA nanoparticles
CN104327141A (en) * 2014-10-16 2015-02-04 上海交通大学 RNA nanoparticle and application of RNA nanoparticle in preventing and curing stomach cancer
WO2016145008A2 (en) * 2015-03-09 2016-09-15 University Of Kentucky Research Foundation Mirna for treatment of breast cancer
WO2016145005A1 (en) * 2015-03-09 2016-09-15 University Of Kentucky Research Foundation Rna nanoparticles for brain tumor treatment
CN107614685A (en) * 2015-04-17 2018-01-19 肯塔基大学研究基金会 RNA nano particles and its application method

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Methods for construction and characterization of simple or special multifunctional RNA nanoparticles based on the 3WJ of phi29 DNA packaging motor;Sijin Guo et al.;《Methods》;20180309;第143卷;第121-133页 *
RNA nanoparticles harboring annexin A2 aptamer can target ovarian cancer for tumor-specific doxorubicin delivery;Fengmei Pi et al.;《Nanomedicine:Nanotechnology,Biology and Medicine》;20180401;第13卷(第3期);第1183-1193页 *

Also Published As

Publication number Publication date
CN110960689A (en) 2020-04-07

Similar Documents

Publication Publication Date Title
US20220226473A1 (en) Nucleic acid nanocarrier drug and preparation method thereof, pharmaceutical composition and application thereof
CN110711253B (en) Medicine containing adriamycin and preparation method thereof
TWI743518B (en) Nucleic acid nanoparticles, pharmaceutical composition thereof, medicine comprising doxorubicin and preparation method thereof
US20210393785A1 (en) Nucleic acid nanocarrier drug and preparation method thereof
CN111150852B (en) Cisplatin-containing medicine, preparation method thereof, pharmaceutical composition and application thereof
CN110960683B (en) Medicine containing methotrexate, preparation method thereof, pharmaceutical composition and application thereof
CN111096965B (en) Medicine containing dihydroartemisinin, preparation method thereof, medicine composition and application thereof
CN110960534B (en) Medicine containing pentafluorouracil, preparation method thereof, pharmaceutical composition and application thereof
CN110960530B (en) Tacrine-containing medicine, preparation method thereof, pharmaceutical composition and application thereof
CN111053915B (en) Lenalidomide-containing medicine, preparation method thereof, medicine composition and application
CN111053765B (en) Medicine containing paclitaxel, preparation method, pharmaceutical composition and application thereof
CN111053913B (en) Cytarabine-containing medicine, preparation method thereof, pharmaceutical composition and application thereof
CN110960689B (en) Medicine containing daunorubicin, preparation method thereof, medicine composition and application thereof
CN110960691B (en) Gemcitabine-containing medicine, preparation method thereof, pharmaceutical composition and application
CN110960690B (en) Medicine containing epirubicin, preparation method thereof, pharmaceutical composition and application thereof
CN110960542B (en) Medicament containing pirarubicin, preparation method thereof, pharmaceutical composition and application thereof
CN111068065B (en) Drug containing oxaliplatin, preparation method thereof, pharmaceutical composition and application thereof
CN111053919B (en) Medicine containing idarubicin, preparation method thereof, pharmaceutical composition and application thereof
CN111084887B (en) Flavone-containing medicine, preparation method thereof, medicine composition and application
CN110960684B (en) Medicine containing 10-hydroxycamptothecin, preparation method thereof, pharmaceutical composition and application thereof
CN111097051B (en) Medicine containing vincristine, preparation method thereof, medicine composition and application thereof
CN111053914B (en) Mitoxantrone-containing medicine, preparation method thereof, medicine composition and application thereof
CN110960536B (en) Aspirin-containing medicine, preparation method, pharmaceutical composition and application thereof
CN111166894B (en) Docetaxel-containing medicine, preparation method thereof, medicine composition and application
CN110711254B (en) Nucleic acid nanoparticles and pharmaceutical compositions comprising the same

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CP03 Change of name, title or address

Address after: Room 403, 4th Floor, Room 102206, Unit 6-12, 1st Floor, No. 8 Life Park Road, Life Science Park, Changping District, Beijing, China

Patentee after: Baiyao Zhida (Beijing) nano Biotechnology Co.,Ltd.

Country or region after: China

Address before: 100080 8-1-1, floor 8, No. 21, Haidian South Road, Haidian District, Beijing

Patentee before: Baiyao Zhida (Beijing) nano Biotechnology Co.,Ltd.

Country or region before: China

CP03 Change of name, title or address