CN113018433B - Immune medicine and application thereof in tumor immunotherapy - Google Patents

Immune medicine and application thereof in tumor immunotherapy Download PDF

Info

Publication number
CN113018433B
CN113018433B CN202110263141.2A CN202110263141A CN113018433B CN 113018433 B CN113018433 B CN 113018433B CN 202110263141 A CN202110263141 A CN 202110263141A CN 113018433 B CN113018433 B CN 113018433B
Authority
CN
China
Prior art keywords
aptamer
nucleic acid
protein
dna
specific binding
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110263141.2A
Other languages
Chinese (zh)
Other versions
CN113018433A (en
Inventor
聂舟
唐瑞
魏平
付禹豪
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hunan University
Original Assignee
Hunan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hunan University filed Critical Hunan University
Priority to CN202110263141.2A priority Critical patent/CN113018433B/en
Publication of CN113018433A publication Critical patent/CN113018433A/en
Application granted granted Critical
Publication of CN113018433B publication Critical patent/CN113018433B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/44—Antibodies bound to carriers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/65—Peptidic linkers, binders or spacers, e.g. peptidic enzyme-labile linkers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2809—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against the T-cell receptor (TcR)-CD3 complex
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K19/00—Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/80—Vaccine for a specifically defined cancer
    • A61K2039/804—Blood cells [leukemia, lymphoma]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/33—Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies

Abstract

The invention firstly provides an immune medicament, which is a dual-specificity immune medicament comprising a specific binding protein and a nucleic acid aptamer, wherein the specific binding protein and the nucleic acid aptamer are connected in a direct or indirect mode, the specific binding protein is a protein structure, the nucleic acid aptamer is a nucleic acid structure, the specific binding protein is used for being specifically bound with an immune cell receptor or a target cell receptor, and the corresponding nucleic acid aptamer is used for being specifically bound with the target cell receptor or the immune cell receptor. The invention also provides application of the immune medicament in tumor immunotherapy. The invention broadens the types of immunotherapy drugs, and the current bispecific antibody is evolved into a chimeric form with DNA involved. The invention takes the aptamer as a target cell recognition element, and can be assembled into a nano structure in a programmed way by virtue of the advantages of wide targeting range, so as to realize targeting of various tumor cells and improve the binding affinity and specificity of the aptamer and the tumor cells.

Description

Immune medicine and application thereof in tumor immunotherapy
Technical Field
The invention relates to the technical field of tumor immunotherapy drugs, and particularly provides a novel immunotherapy drug for mediating T cell to kill tumor cells in a targeted manner, a preparation method thereof and application thereof in tumor immunotherapy.
Background
Cancer immunotherapy can activate the immune system of a patient to prevent immune evasion by cancer, and has great potential in reducing cancer metastasis and recurrence for a long time. Unlike traditional chemotherapy or radiotherapy, tumor immunotherapy has greater selectivity and lower toxicity in tumor therapy, while providing long-term immunity through immunological memory. Recent studies have shown that T cells can redirect and eliminate tumors by bispecific molecules that bind tumor-specific antigens. Of these, people have attracted special attention due to the advantage that Bispecific T-cell engagement (BiTE) antibodies can selectively kill tumor cells bypassing MHC restrictions when they mediate killing. BiTE is essentially a single polypeptide chain comprising single chain (sc) Fv domains of two different antibodies, one to recognize CD3e expressed on any T cell, and the other to bind to a tumor-associated antigen expressed by a tumor cell. Despite their remarkable success, since BiTE belongs to the protein class of drugs, bites for the treatment of different tumor cells must be genetically engineered by means of existing DNA sequences, a process which is not only time and labor consuming but also whose stability and activity cannot be guaranteed. Meanwhile, customized medical treatment cannot be quickly realized according to the actual condition of a patient. In addition, the in vivo is a multicellular environment, the types of molecules on the surface of tumor cells are the same as those on the surface of normal cells, and only the difference of expression amount exists, so that the composition of the BiTE structure is fixed at present, so that the BiTE structure can kill the normal cells in the immunotherapy process, and certain side effects exist. From this point of view, aptamers (aptamers) can solve the problems of the existing BiTE. Aptamers are called "chemical antibodies" and are considered to be an ideal choice for targeted therapy of tumors because of their small size, ease of preparation, and good targeting properties. Thereby expanding the cancer treatment range and accelerating the drug generation and development process. In addition, the aptamer can be rapidly assembled into a DNA nanostructure with other DNA in a test tube by virtue of the base complementary pairing principle. DNA nanostructures are widely used in the biomedical field due to their programmability, easy modification, and high biocompatibility. And different structures of the antigen can combine different numbers of aptamers, thereby improving the tumor recognition capability and reducing the side effect of immunotherapy.
Therefore, there is an urgent need in the art to develop an immunopharmaceutical that recognizes tumor cell surface molecules using nucleic acids, which is used to solve the problems of time and labor consuming development of the existing immunotherapy, limited subjects and side effects.
Disclosure of Invention
In the invention, the aptamer is used for replacing an antibody structure domain in the current BiTE to identify the molecules on the surface of tumor cells, and the antibody-nucleic acid chimera obtained by research and development can solve the problems in the prior art as a novel bispecific drug.
Therefore, the invention firstly provides an immune medicament, the immune medicament is a dual-specificity immune medicament (1) comprising a specific binding protein (11) and a nucleic acid aptamer (12), and the specific binding protein (11) and the nucleic acid aptamer (12) are connected in a direct or indirect mode, the specific binding protein (11) is a protein structure, the nucleic acid aptamer (12) is a nucleic acid structure, the specific binding protein (11) is used for specifically binding with an immune cell receptor or a target cell receptor, and correspondingly, the nucleic acid aptamer (12) is used for specifically binding with the target cell receptor or the immune cell receptor.
In a specific embodiment, a covalent linking protein (13) and a covalent linking DNA (14) are linked between the specific binding protein (11) and the aptamer (12), the covalent linking protein (13) is linked to the specific binding protein (11), the covalent linking DNA (14) is linked directly or indirectly to the aptamer (12), and the covalent binding between the covalent linking protein (13) and the covalent linking DNA (14).
In a particular embodiment, a linking structure is also linked between the covalently linked DNA (14) and the aptamer (12), the linking structure also being composed of nucleotides.
In a particular embodiment, the covalent linking protein (13) is a HUH family protein, preferably a DCV protein.
In a specific embodiment, the immunopharmaceutical comprises one aptamer (12) or a plurality of identical or different aptamers (12), preferably the immunopharmaceutical comprises 3 to 100 identical or different aptamers.
In a specific embodiment, the specific binding protein (11) is α CD3.
In a specific embodiment, the aptamer (12) is one or more of sgc8, TE02, SYL3C, MUC and C-MET.
In a specific embodiment, the covalently linked DNA (14) has the sequence aagtattaccagaaa.
The invention also provides application of the immune medicament in tumor immunotherapy.
In a specific embodiment, the immunopharmaceutical is targeted to inhibit tumor cell growth in vivo.
The invention also provides a preparation method of the immune medicament, the immune medicament is a dual-specificity immune medicament (1) comprising the specific binding protein (11) and the aptamer (12), and the specific binding protein (11) and the aptamer (12) are indirectly connected, the specific binding protein (11) is a protein structure, the aptamer (12) is a nucleic acid structure, the specific binding protein (11) is used for specifically binding with an immune cell receptor or a target cell receptor, and correspondingly, the aptamer (12) is used for specifically binding with the target cell receptor or the immune cell receptor; a covalent linking protein (13) and a covalent linking DNA (14) are connected between the specific binding protein (11) and the aptamer (12), the covalent linking protein (13) is directly or indirectly connected with the specific binding protein (11), the covalent linking DNA (14) is directly or indirectly connected with the aptamer (12), and the covalent binding is formed between the covalent linking protein (13) and the covalent linking DNA (14); the preparation method comprises the following steps of,
step A: preparing a fusion protein containing the specific binding protein (11) and the covalent linking protein (13);
and B: preparing a nucleic acid construct comprising said aptamer (12) and covalently linked DNA (14);
step A and step B can be carried out simultaneously or in any sequence;
and C: and (C) incubating the fusion protein prepared in the step (A) and the nucleic acid structure obtained in the step (B) together, and enabling the covalent link protein (13) and the covalent link DNA (14) to be covalently bound to obtain the immune drug.
In a specific embodiment, the nucleic acid sequence of the fusion protein is first synthesized in a whole gene and a recombinant plasmid is constructed, and then the active fusion protein is expressed by E.coli pronucleus.
In a specific embodiment, after step a, the purification of the resulting fusion protein is further included.
In a particular embodiment, in step B, the nucleic acid structure further comprises a linking structure for linking the aptamer (12) and covalently linking the DNA (14), the linking structure also consisting of nucleotides.
In a specific embodiment, the nucleic acid structure comprises any one of a single-stranded aptamer, a Y-type DNA nanoparticle and a dendritic DNA nanoparticle, wherein the single-stranded aptamer comprises 1 aptamer (12), the Y-type DNA nanoparticle comprises 2 aptamers (12), the dendritic DNA nanoparticle comprises 3-100 aptamers (12), and the aptamers (12) contained in the Y-type DNA nanoparticle and the dendritic DNA nanoparticle are the same or different.
In a specific embodiment, the Y-shaped DNA nanoparticles are prepared by an enzyme-free self-assembly process, and the dendritic DNA nanoparticles are synthesized in vitro by a polymeric chain reaction.
In a specific embodiment, the incubation method is to mix the fusion protein prepared in step a and the nucleic acid structure obtained in step B, and incubate them at 36-38 ℃ for more than 10 minutes to obtain the immune drug, and preferably store the obtained immune drug at 2-8 ℃ for further use.
In a specific embodiment, the covalently linked protein (13) is a HUH family protein, preferably a DCV protein, and the covalently linked DNA (14) has the sequence aagtattaccagaaa.
In a specific embodiment, the specific binding protein (11) is α CD3.
In a specific embodiment, the aptamer (12) is one or more of sgc8, TE02, SYL3C, MUC and C-MET.
The invention has at least the following beneficial effects:
1) The invention prepares the bispecific antibody-nucleic acid chimera by covalently combining the antibody single-chain-DCV fusion protein and the nucleic acid aptamer, widens the types of immunotherapy drugs, and develops the current bispecific antibody into a chimeric form with DNA participation.
2) The invention uses the antibody-nucleic acid chimera to mediate T cells to kill tumor cells, the generation process of the chimera overcomes the defect that the traditional bispecific antibody must be subjected to genetic engineering, shortens the synthesis and preparation time of the immunopharmaceuticals, and reduces the production cost.
3) The invention takes the aptamer as a target cell recognition element, depends on the advantages of more targets of the aptamer and capability of being assembled into a nano structure in a programmed manner, has various tumor recognition types, improves the binding affinity and specificity with tumor cells, and enlarges the recognition range of different tumor specificities.
4) The invention is based on the base complementary pairing principle to rapidly assemble the DNA nano structure with a specific structure and a specific valence state. Different DNA nanostructures and chimeras formed by the antibody single chains can achieve different treatment effects. There is a possibility of becoming a customized immunoreagent.
Drawings
FIG. 1 is a schematic diagram of the binding of the immunopharmaceutical of the present invention to T cells (i.e., immune cells) and target cells (i.e., tumor cells).
FIG. 2 shows the effect of the antibody-sgc 8 aptamer chimera on tumor killing measured at the cellular level.
FIGS. 3-4 are graphs demonstrating the universality of the application of the antibody-nucleic acid chimera in the field of immunotherapy.
FIGS. 5 to 8 are schematic diagrams of in vivo targeting and killing of tumor cells by the antibody-nucleic acid chimera. In which, fig. 5 and 6 are statistics of continuously measured tumor size, and fig. 7 and 8 are statistics of continuously measured mouse body weight.
In fig. 1: immune drug 1, specific binding protein 11, aptamer 12, covalent link protein 13, covalent link DNA14, T cell 2, T cell receptor 21, target cell 3, target cell receptor 31.
The features and advantages of the present invention will be further understood from the following detailed description taken in conjunction with the accompanying drawings. The examples provided are merely illustrative of the method of the present invention and do not limit the remainder of the disclosure in any way.
Detailed Description
In order that the invention may be more fully understood, a more particular description of the invention will now be rendered by reference to specific embodiments thereof that are illustrated in the appended drawings. However, the invention may be implemented in many different combinations and is not limited to the embodiments described herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.
The invention provides a novel immune medicament for tumor immunotherapy, which comprises two modules: the two modules can be covalently connected to form a chimera, and the chimera can mediate specific recognition of T cells and target cells and inhibit growth of tumor cells in a targeted manner in vitro and in vivo. The antibody-nucleic acid chimera has the structure shown in FIG. 1.
The invention also aims to provide a preparation method of the antibody-nucleic acid chimera, which comprises the following steps: the antibody is illustrated by DCV-alpha CD3 fusion protein;
firstly), preparing an antibody;
1) Recombinant plasmids containing antibody sequences, such as pET28 a-DCV-alpha CD3, were synthesized in their entirety.
2) Prokaryotic expression of active DCV-alpha CD3 fusion protein (i.e., by specific binding protein 11 and covalent linking protein 13 connected fusion protein).
Preferably, the DCV- α CD3 fusion protein expression purification method is as follows: the pET28 a-DCV-alpha CD3 recombinant plasmid is heat shocked to transform escherichia coli BL21 (DE 3) competence, 1mM IPTG induces the expression target protein, bacterial liquid is collected, and after ultrasonic disruption, an NI column purifies 6 His-DCV-alpha CD3 fusion protein.
II) preparing nucleic acid;
nucleic acids include three forms: single-stranded aptamers, Y-type DNA nanoparticles and dendritic DNA nanoparticles.
Alternatively, the single-chain aptamer of the invention is exemplified by sgc8 aptamer, and the sequence thereof is as follows:
aagtattaccagaaaaaaaaaaaaaaaATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA. Wherein aagtattaccagaaaaaaaaaaaaaaa is covalently linked DNA (14) in the present invention.
The number of aptamers (aptamers) connected to the Y-type DNA nanoparticle is 2, and the Y-type DNA nanoparticles can be the same or different. The Y-type DNA nano-particle is assembled by three nucleic acid chains, and the sequence of the Y-type DNA nano-particle is as follows:
Y1-DCV：aagtattaccagaaa TTTTTGAC CGA TGG ATG ACT TAC GAC GCA CAA GGA GAT CAT GAG；
Y2-sgc8：ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATTTTTGACCGA TGG ATG ACC TGT CTG CCT AAT GTG CGT CGT AAG；
Y3-sgc8：ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATTTTTGACCGA TGG ATG ACT CAT GAT CTC CTT TAG GCA GAC AGG。
wherein aagtattaccagaaa is covalently linked DNA (14) in the present invention.
The number n of the connected nucleic acid aptamers in the dendritic DNA nano-particles is less than 100, the specific number n can be any integer, and the DNA nano-particles can be the same or different. The structure of the dendritic DNA nanoparticles for assembling is assembled by five nucleic acid chains, and the sequence is as follows:
H1：TTAACCCACGCCGAATCCTAGACTCAAAGTAGTCTAGGATTCGGCGTGAAA AAGTGAGCACGGACG；
H2：GACGTGCAGGCTGTTTAAAGTCTAGGATTCGGCGTGGGTTAACACGCCGA ATCCTAGACTACTTTG；
Sgc8c-SH2：CAGCCTGCACGTCATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA；
DNA1(C1)NC：CGTCCGTGCTCAC；
DCV Initiator(I)：aagtattaccagaaaAGTCTAGGATTCGGCGTGGGTTAA。
the sequence aagtattaccagaaa is a DCV protein targeting DNA sequence, namely the covalent linking DNA (14) in the invention, and is used for covalent linking of an antibody and a nucleic acid structure, namely the covalent linking DNA (14) in the invention.
Thirdly), preparing an antibody-aptamer chimera;
and (3) incubating the antibody in the step one) and the nucleic acid in the step two) together to obtain the antibody-nucleic acid chimera.
The invention also provides application of the antibody-nucleic acid chimera in tumor immunotherapy.
In one embodiment of the invention, the effect of the bispecific antibody-nucleic acid chimera sgc 8-DCV-alpha CD3 on the tumor cell mediated T cell killing is detected in vitro, and the cell level is detected by using a CCK8 method to detect the target killing effect on CCRF-CEM human acute lymphoblastic leukemia cells. As a result: the prepared sgc 8-DCV-alpha CD3 chimera has the capacity of mediating T cells to kill tumor cells, and the killing effect is gradually enhanced along with the increase of the drug concentration of the sgc 8-DCV-alpha CD3 chimera.
In one embodiment of the present invention, sgc8 in the above embodiment is replaced with an antibody-nucleic acid chimera prepared from any other aptamer (TE 02, SYL3C, MUC1 and C-MET are used in this embodiment), and the cell level is tested by the CCK8 method for detecting the killing effect of T cells on different types of tumor cells. The results show that: chimeras connected with different aptamers can mediate T cells to kill tumor cells, and the method has universality in the field of immunotherapy.
In one embodiment of the present invention, the effect of antibody-aptamer nanostructure chimeras in mediating T cell killing in vitro was studied. The antibody-aptamer nano-structure chimera is used as a medicine, and the cell level is used for detecting the breast cancer targeted killing effect of the antibody-aptamer nano-structure chimera on MCF-7 human by using a CCK8 method. The result shows that the prepared antibody-dendritic aptamer nanostructure chimera has the best effect of mediating T cells to kill tumor cells, and the antibody-Y aptamer nanostructure is adopted. antibody-Y aptamer nanostructures represent bivalent DNA nanoparticles. In addition to the Y-shaped structure in this embodiment, other nanostructures to which a defined number of aptamers are attached may be used. In addition dendritic DNA nanostructures represent DNA nanostructures synthesized in vitro by the polymer chain reaction.
In one embodiment of the invention, a nude mouse model is utilized to perform a targeting experiment of an in vivo antibody-nucleic acid chimera on nude mouse subcutaneous tumor-bearing CEM, and the sgc8 aptamer is taken as an example to explore the tumor immunotherapy effect of the antibody-nucleic acid chimera with different structures. Immunotherapy effects were reflected by continuous measurement of tumor size and measurement of mouse body weight. The results show that the tumor of the experimental group injected with the antibody-nucleic acid chimera is significantly smaller than that of the control group. In the experimental group, injection of the antibody-dendritic aptamer nanostructure chimera significantly inhibited tumor growth, followed by the antibody-Y aptamer nanostructure chimera. The immunotherapy effect can be improved by constructing the DNA nanoparticles with different structures, and a new idea is provided for tumor therapy.
In summary, the antibody-nucleic acid chimera provided by the present invention is a novel immunotherapeutic drug, which is first applied to T cell-mediated immunotherapy. The medicine comprises an antibody module and a nucleic acid module, wherein the antibody module can be any antibody single chain capable of identifying immune cell surface molecules, and the nucleic acid module can also be any aptamer capable of identifying tumor cell surface molecules. In addition, the invention constructs DNA nano particles with different structures on the basis that the antibody can form chimera with nucleic acid, and applies the functionalized DNA nano particles to the field of immunotherapy. The DNA nano-particle comprises a nano-structure connected with a specific number of aptamers (such as the aptamer number n =2 of a Y-shaped structure and the like) and a nano-structure of a plurality of aptamers formed by polymerization chain Hybridization (HCR) (such as the aptamer number n < 100 of a dendritic structure), wherein multivalent DNA nano-particles can be the same DNA sequence or different DNA sequences.
The bispecific immunopharmaceutical in the present invention means that the immunopharmaceutical has specificity to both T cells (immune cells) and target cells (tumor cells). The bispecific immune drug used for connecting T cells and target cells in the prior art is either protein or nucleic acid in both modules, and the invention firstly proposes a bispecific immune drug comprising a protein module and a nucleic acid module.
The preparation method of the immune medicine comprises the following steps: in 2018, the covalent binding of covalent binding protein 13 and covalent binding DNA14 is reported, the invention prepares a covalent binding protein 13 according to the literature, then prepares a conjugate of specific binding protein 11 and covalent binding protein 13, connects covalent binding DNA14 matched with the covalent binding protein 13 and aptamer 12 to form a nucleic acid structure (the nucleic acid structure can be customized by a nucleic acid manufacturer), and then obtains the whole immune drug comprising the specific binding protein 11, the aptamer 12, the covalent binding protein 13 and the covalent binding DNA14 by utilizing the covalent binding of the covalent binding protein 13 and the covalent binding DNA14, wherein the structure of the immune drug sequentially comprises the specific binding protein 11, the covalent binding protein 13, the covalent binding DNA14 and the aptamer 12 from one end to the other end. In the present invention, the covalent binding protein 13 may be specifically a HUH protein, more specifically a DCV protein, but may be a protein belonging to many families other than HUH, and can covalently bind to DNA.
The specific binding protein 11 of the present invention may bind to a receptor of a T cell, in which case the aptamer 12 binds to a receptor of a target cell, or the reverse, in which the aptamer 12 binds to a receptor of a T cell, and the specific binding protein 11 binds to a receptor of a target cell.
The aptamer 12 of the present invention is indispensable, and the aptamer is essentially nucleic acid, and ordinary DNA is also nucleic acid, but ordinary DNA cannot be used in the present invention because it does not have the ability of the aptamer to specifically recognize a receptor.
In addition, because it is difficult to directly connect the common protein with the common nucleic acid chain, the specific binding protein 11 and the aptamer 12 are connected by specifically adopting the covalent connection protein 13 and the covalent connection DNA14, and the covalent connection protein 13 reported in the literature is a DCV protein of the HUH family, which belongs to a protein member of duck circovirus, compared with other similar proteins, such as: PCV (porcine virus) has the highest efficiency of connecting DCV with DNA, so that the corresponding DCV protein is expressed according to the literature in the invention firstly.
Example 1
This example is the preparation of DNA nanoparticles.
One, single-chain aptamers.
A DCV protein recognition sequence is added at the 5' end of the published aptamer sequence and is named as DCV-aptamer. The nucleic acid synthesis mechanism sent to the Shanghai synthesizes a single-stranded aptamer.
Secondly, preparing the Y-type DNA nano-particles.
1, three nucleotide chains are ordered: YA-sgc8, yb-DCV and YC-sgc8.
2, synthesizing Y-type DNA nano-particles: the Y-shaped DNA macromolecules are prepared by an enzyme-free self-assembly process. First, a Y-junction scaffold (Y-DNA) was prepared as a building block. In the experiment, the three oligonucleotide chains contain the aptamer and the target sequence of the DCV protein (YA-sgc 8, yb-DCV, YC-sgc8 sequence), which is PBS-MgCl 2 Solution (10 mM, pH 7.4, containing 150mM NaCl and 2mM MgCl 2 ) Dissolved at a concentration of 10mM. The DNA mixed solution is heated in boiling water for 5min, then slowly cooled to room temperature, and kept in a refrigerator at 4 ℃ for later use.
Thirdly, preparing the dendritic DNA nano particles.
1, order the five nucleotide strands required for building the structure, namely H1, H2, sgc8C-SH2, DNA1 (C1) NC and DCV Initiator (I) as described above.
2, using PBS-MgCl to make the above-mentioned five chains 2 The solution was dissolved and diluted to a final concentration of 10mM by first mixing and diluting H1, H2, sgc8C-SH2 and DNA1 (C1) NC in equal amounts to a final concentration of 20. Mu.M, heating the DNA mixture solution in boiling water for 5min, and then slowly cooling to room temperature. After cooling, 4. Mu.M of DCV initiator (I) was added to the DNA mixture and the mixture was allowed to stand at 37 ℃ for overnight reaction. And placing the assembled DNA nano particles in a refrigerator at 4 ℃ for later use.
Example 2
This example is the preparation of an antibody-nucleic acid chimera.
The DCV-alpha CD3 fusion protein is added into DCV-sgc8 aptamer, mixed in equal amount, and cultured for 15min at 37 ℃. Then stored at 4 ℃ for later use.
Example 3
This example is the application and detection of antibody-nucleic acid chimera in vitro and in vivo for tumor targeted killing. Take DCV-sgc8 (aptamer for human acute lymphoblastic leukemia) as an example to prepare "aptamer-DCV-alpha CD3 chimera".
Firstly, a cell level CCK8 method detects the T cell target killing mediated by the aptamer-DCV-alpha CD3 chimera.
1, CCRF-CEM cells (5% FBS + 1640) and PBMC cells (5% FBS +1640+ IL2) well raised in advance;
2, taking the CEM cells (2 x 10) 4 Individual cells) and PBMC cells (human peripheral blood mononuclear cells) (1 x 10) 5 Individual cells) and different concentrations of sgc8-DCV- α CD3 were incubated at 37 ℃ for 24 hours.
3, detecting the reduction amount of the cell number of the sgc 8-DCV-alpha CD3 mediated T cells in the target lysis CEM cells by using a CCK-8 kit (cargo number: C0039, biyun day) so as to judge the killing effect. CCRF-CEM human acute lymphoblastic leukemia was plated per well in 96-well plates. The control group was set up to include only T cells and CEM cells (human acute lymphoblastic leukemia cells) as well as the negative cells Ramos. The effect of the ratio of the number of tumor cells and effector cells, CEM cells (2 x 10) was simultaneously evaluated 4 Individual cells) with different numbers of PBMC cells (0,1 x 10) 5 ，2*10 5 ) And 100nm sgc8-DCV-. Alpha.CD 3 chimera were incubated at 37 ℃ for 24 hours.
After 4,24h, 20ul of CCK-8 solution was added per well. After incubation at 37 ℃ for 2 hours, the absorbance at 570nm was measured using Bio-Tek, SYNERGYMx. The cytotoxicity was calculated by the method of cell killing rate (%) =100 (experimental value-experimental low control)/(high control-low control).
As a result: the novel immune drug prepared by the method (taking sgc 8-DCV-alpha CD3 as an example) has the capacity of mediating T cells to kill tumor cells, and the killing effect is gradually enhanced along with the increase of the concentration of sgc 8-DCV-alpha CD3. As shown in fig. 2. In FIG. 2, CEM is human acute lymphocytic leukemia cell, and Ramos is negative cell.
Fig. 3 and 4 are both to verify the universality of the application of the antibody-nucleic acid chimera in the field of immunotherapy. NC, sgc8, TE02, SYL3C, MUC and C-MET belong to aptamers, MCF-7 in FIG. 4 is a human breast cancer cell, hela is a cervical cancer cell, hepG2 cell is a liver cancer cell, LO2 is a human normal liver cell, and SH-SY5Y is a human neuroblastoma cell.
Secondly, the targeted killing effect of the sgc 8-DCV-alpha CD3 chimera on CCRF-CEM human acute lymphoblastic leukemia is detected at the living body level.
1, female nude mice aged 4-6 weeks on day 0, subcutaneous tumor-bearing CCRF-CEM,1 x 10 6 One/one;
2, on day 7, tumor-bearing nude mice were randomly divided into two groups, a group a was a PBS control group, a group b was an injection T cell group, and a group b was subdivided into 5 groups: a blank control group, a DCV-alpha CD3 antibody control group, an sgc 8-DCV-alpha CD3 experimental group, a bivalent sgc 8-DCV-alpha CD3 experimental group and a multivalent sgc 8-DCV-alpha CD3 experimental group.
3, measuring the size of the tumor once every 2 days by using a vernier caliper and recording the size of the tumor in the whole experiment;
4, recording the weight of the tumor-bearing nude mice in the whole experiment process;
5, until 32 days end the experiment.
The results of the experiment are shown in FIGS. 5 to 8. Wherein, fig. 5 and fig. 6 are statistical results of continuously measuring tumor sizes, and the results show that the tumors of the sgc8-DCV- α CD3 injection experimental group are significantly smaller than those of the protein injection only experimental group. Meanwhile, the tumor of the multivalent sgc 8-DCV-alpha CD3 (dendritic DNA nanostructure) experimental group is obviously smaller than that of the bivalent sgc 8-DCV-alpha CD3 (Y-type DNA nanostructure) experimental group and sgc 8-DCV-alpha CD3 (linear single-chain) experimental group. The improvement of the valence state can improve the immunotherapy effect. Fig. 7 and 8 are statistical results of continuously measuring the body weight of tumor-bearing nude mice, and the results show that the injected medicament does not affect the life activities of the tumor-bearing nude mice.
In conclusion, the antibody-nucleic acid chimera constructed by the invention can mediate T cells to kill tumors in a targeted manner when being used as a medicament. And the immunotherapy effect can be customized and adjusted by building a DNA nano structure in vitro.
The foregoing is a more detailed description of the invention in connection with specific preferred embodiments and it is not intended that the invention be limited to these specific details. For those skilled in the art to which the invention pertains, numerous and varied simplifications or substitutions may be made without departing from the spirit of the invention, which should be construed as falling within the scope of the invention.
Sequence listing
<110> university of Hunan
<120> immune medicine and application thereof in tumor immunotherapy
<130> 2021
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 15
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
Aagtattaccagaaa 15
<210> 2
<211> 68
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
aagtattaccagaaaaaaaaaaaaaaaATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA 68
<210> 3
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
aagtattaccagaaaaaaaaaaaaaaa 27
<210> 4
<211> 59
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
aagtattaccagaaa TTTTTGAC CGA TGG ATG ACT TAC GAC GCA CAA GGA GAT CAT GAG 59
<210> 5
<211> 85
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATTTTTGACCGA TGG ATG ACC TGT CTG CCT AAT GTG CGT CGT AAG 85
<210> 6
<211> 85
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATTTTTGACCGA TGG ATG ACT CAT GAT CTC CTT TAG GCA GAC AGG 85
<210> 7
<211> 66
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
TTAACCCACGCCGAATCCTAGACTCAAAGTAGTCTAGGATTCGGCGTGAAA A AGTGAGCACGGACG 66
<210> 8
<211> 66
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
GACGTGCAGGCTGTTTAAAGTCTAGGATTCGGCGTGGGTTAACACGCCGAAT CCTAGACTACTTTG 66
<210> 9
<211> 54
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
CAGCCTGCACGTCATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA 54
<210> 10
<211> 13
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
CGTCCGTGCTCAC 13
<210> 11
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
aagtattaccagaaaAGTCTAGGATTCGGCGTGGGTTAA 39

Claims (5)

1. An immunopharmaceutical which is a bispecific immunopharmaceutical (1) comprising a specific binding protein (11) and a nucleic acid aptamer (12), and the specific binding protein (11) and the nucleic acid aptamer (12) are linked by direct or indirect means, wherein the specific binding protein (11) is a protein structure, the nucleic acid aptamer (12) is a nucleic acid structure, the specific binding protein (11) is used for specific binding with an immune cell receptor or a target cell receptor, and correspondingly, the nucleic acid aptamer (12) is used for specific binding with the target cell receptor or the immune cell receptor; a covalent linking protein (13) and a covalent linking DNA (14) are connected between the specific binding protein (11) and the aptamer (12), the covalent linking protein (13) is connected with the specific binding protein (11), the covalent linking DNA (14) is directly or indirectly connected with the aptamer (12), and the covalent binding between the covalent linking protein (13) and the covalent linking DNA (14), and the immune medicament contains a plurality of identical or different aptamers (12); the specific binding protein (11) is alpha CD3, the covalent connecting protein (13) is DCV protein, and the sequence of the covalent connecting DNA (14) is aagtattaccagaaa.
2. The immunopharmaceutical of claim 1, wherein a linking structure is further linked between the covalently linked DNA (14) and the aptamer (12), the linking structure also consisting of nucleotides.
3. The immunopharmaceutical of claim 1, wherein the immunopharmaceutical comprises 3-100 identical or different aptamers.
4. The immunopharmaceutical according to any one of claims 1-3, wherein the aptamer (12) is one or more of sgc8, TE02, SYL3C, MUC, and C-MET.
5. Use of an immunopharmaceutical according to any one of claims 1 to 4 in the manufacture of a medicament for immunotherapy of cancer.
CN202110263141.2A 2021-03-11 2021-03-11 Immune medicine and application thereof in tumor immunotherapy Active CN113018433B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110263141.2A CN113018433B (en) 2021-03-11 2021-03-11 Immune medicine and application thereof in tumor immunotherapy

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110263141.2A CN113018433B (en) 2021-03-11 2021-03-11 Immune medicine and application thereof in tumor immunotherapy

Publications (2)

Publication Number Publication Date
CN113018433A CN113018433A (en) 2021-06-25
CN113018433B true CN113018433B (en) 2023-01-17

Family

ID=76469486

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110263141.2A Active CN113018433B (en) 2021-03-11 2021-03-11 Immune medicine and application thereof in tumor immunotherapy

Country Status (1)

Country Link
CN (1) CN113018433B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115887695A (en) * 2022-12-23 2023-04-04 武汉大学 Construction method of targeting DNA macromolecule hydrogel material

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014153164A1 (en) * 2013-03-14 2014-09-25 The California Institute For Biomedical Research Targeting agent antibody conjugates and uses thereof
CN110494563A (en) * 2017-01-30 2019-11-22 奥菲尔·努斯鲍姆 Chemical entities suitable for treatment
CN110790841A (en) * 2019-11-11 2020-02-14 国家纳米科学中心 Protein nucleic acid compound and preparation method and application thereof
CN112336872B (en) * 2020-08-04 2022-05-06 华南理工大学 Nano-aptamer for multi-specific antibody delivery and application and construction method thereof

Also Published As

Publication number Publication date
CN113018433A (en) 2021-06-25

Similar Documents

Publication Publication Date Title
Kim et al. Multifunctional nanoparticles for genetic engineering and bioimaging of natural killer (NK) cell therapeutics
CN109476718A (en) The combination of MRNA and application thereof of encoding immune adjusting polypeptide
CN105177031B (en) T cell of Chimeric antigen receptor modification and application thereof
AU2021201060A1 (en) Protein/Oligonucleotide Core-Shell Nanoparticle Therapeutics
CN104244928B (en) Magnetic nanoparticle-SAMiRNA complex and preparation method thereof
CN110478322B (en) Nucleic acid drug compound and preparation method and application thereof
Ma et al. Modular-designed engineered bacteria for precision tumor immunotherapy via spatiotemporal manipulation by magnetic field
CN106795517A (en) Composition based on RNA and for preventative and therapeutic treatment adjuvant
CN107266584A (en) Change costimulation acceptor
AU2011323508A1 (en) Compositions of a peptide targeting system for treating cancer
EP3360893A1 (en) High-affinity and soluble pdl-1 molecule
BR112020018670A2 (en) IL-13 ALPHA 2 RECEPTOR CHEMICAL ANTIGEN RECEPTOR (IL13RA2) FOR IMMUNOTHERAPY WITH TUMOR-SPECIFIC T CELLS
CN109620956B (en) Intelligent macrophage tumor targeted therapy system and preparation method and application thereof
KR20190063458A (en) The chimeric antigen receptor (CARS) specific to MUC1 and its use
CN112675202A (en) Anti-tumor immune cell based on targeting ligand cell coupling technology and preparation method and application thereof
KR102023839B1 (en) Highly Efficient Aptamer Complex Containing Branched DNA and Aptamer, and Uses Thereof
CN113018433B (en) Immune medicine and application thereof in tumor immunotherapy
WO2018205755A1 (en) Multispecific protein drug and library thereof, preparing method therefor and application thereof
CN112759641A (en) High-affinity TCR for recognizing KrasG12V
KR20160090005A (en) RNA/DNA hybrid nanoparticle used for target-specific siRNA delivery and use thereof
CN111218443B (en) Method for synthesizing nucleic acid drug conjugates
CN113018432B (en) Preparation method of immune medicine
CN108611348B (en) Preparation method and application of dendritic DNA assembly
US20220033766A1 (en) Antigen-specific t lymphocytes and methods of making and using the same
KR101629362B1 (en) Composition for Cancer Diagnosis and Therapy Using Leucine Zipper Pair

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant