CN113004405A

CN113004405A - Isolated binding protein comprising NT-proBNP antigen binding domain

Info

Publication number: CN113004405A
Application number: CN201911323628.4A
Authority: CN
Inventors: 崔鹏; 何志强; 孟媛; 钟冬梅; 叶庆妮; 覃婷; 游辉; 王晨
Original assignee: Dongguan Pengzhi Biotechnology Co Ltd
Current assignee: Dongguan Pengzhi Biotechnology Co Ltd
Priority date: 2019-12-20
Filing date: 2019-12-20
Publication date: 2021-06-22
Anticipated expiration: 2039-12-20
Also published as: CN113004405B

Abstract

The invention relates to an isolated binding protein containing an NT-proBNP antigen binding structural domain, and researches on preparation, application and the like of the binding protein. The binding protein has strong activity and higher affinity with NT-proBNP, and can realize high-efficiency detection of NT-proBNP, thereby providing a basis for early diagnosis of heart failure.

Description

Isolated binding protein comprising NT-proBNP antigen binding domain

Technical Field

The invention relates to the technical field of biotechnology and medicine, in particular to an isolated binding protein containing an NT-proBNP antigen binding structural domain and application thereof.

Background

Brain Natriuretic Peptide (BNP), a polypeptide hormone with potent diuretic, vasodilatory and antihypertensive effects. BNP is secreted by ventricles with the highest heart content, proBNP (BNP precursor) containing 108 amino acids is firstly synthesized by cardiac muscle cells, and after the cardiac muscle cells are stimulated, the proBNP is cracked into an amino-terminal B-type pro-natriuretic peptide (NT-proBNP) containing 76 amino acids and no biological activity and a B-type natriuretic peptide (BNP) containing 32 amino acids and having activity under the action of endonuclease, and the two are released into the blood circulation by equimolar secretion.

It is currently believed that Brain Natriuretic Peptide (BNP) and pro-brain natriuretic peptide (NT-proBNP) are biomarkers for the diagnosis of heart failure, and the index concentrations of amino-terminal pro-brain natriuretic peptide (NT-proBNP) and BNP are abnormally increased when the cardiac volume load is increased or the cardiac function is impaired. NT-proBNP has better biological stability compared with BNP, longer half-life (120min), relatively stable concentration, long effective detection time, and about 16-20 times higher content in blood compared with BNP, so that the detection is relatively easy, and the stability of a plasma sample in vitro is long (>48h), so the NT-proBNP is the best myocardial marker for diagnosing heart failure and evaluating heart function.

With the improvement of living conditions and the aggravation of social aging, the number of patients with heart failure increases year by year, and the early diagnosis of heart failure is the most critical problem facing the current medical care. When some related early diseases are discovered, the amount of NT-proBNP in blood is accurately, sensitively, efficiently and stably measured, and a quick and accurate early diagnosis basis can be provided for the treatment and prognosis monitoring of cardiac failure and non-cardiac failure of early cardiac insufficiency, cardiac failure and dyspnea, the grading of acute coronary syndrome and the like.

The current methods for detecting the content of NT-proBNP mainly comprise gold-labeled qualitative assay, fluorescence immunoassay, enzyme-linked immunosorbent assay (ELISA) and magnetic particle chemiluminescence assay (CMIA), and all of the measurement methods need to use protein specifically bound with NT-proBNP. For a long time, mouse monoclonal antibodies produced by hybridoma technology are widely applied to scientific research, clinical diagnosis and treatment, but because the hybridoma mode production needs to adopt mouse abdominal cavity induction, the influence of mouse individuals is large, the production is unstable, the batch difference is large, the mouse autoantibody containing purification difficulty is large, and the binding protein related to the invention adopts the recombination technology, so that the problems can be completely solved. The currently commonly used NT-proBNP binding protein has the problems of poor activity, low affinity and the like, and cannot be well applied to the detection of NT-proBNP, so the NT-proBNP binding protein with good activity and high affinity in the field has strong demand.

The present invention has been made in view of the above problems.

Disclosure of Invention

The invention relates to an isolated binding protein comprising an antigen binding domain of NT-proBNP, and the research on the preparation, application and the like of the binding protein.

The antigen binding domain comprises at least one complementarity determining region selected from the group consisting of the amino acid sequences described below, or has at least 80% sequence identity with the complementarity determining region of the amino acid sequences described below and has a K with NT-proBNP_D≤5.59×10^- ⁹Affinity of mol/L;

the mutual complementarity determining region CDR-VH1 is G-F-X1-F-S-X2-Y-W-M-X3, wherein,

x1 is S or T, X2 is Q or N, X3 is K, R, Q or N;

CDR-VH2 is E-X1-R-L-K-S-X2-N-Y-A-T-H-Y-X3-E-S-X4-K-G, wherein,

x1 is I or L, X2 is E or D, X3 is A or P, X4 is I, V or L;

CDR-VH3 is T-X1-G-Y-X2-X3-M-D, wherein,

x1 is K or R, X2 is G or A, X3 is A or G;

the CDR-VL1 is H-A-S-X1-N-I-X2-V-X3-L-I, wherein,

x1 is N or Q, X2 is Q, N or H, X3 is Y, F or W;

the CDR-VL2 is K-X1-S-N-X2-H-T, wherein,

x1 is A or P, X2 is I, V or L;

the complementarity determining region CDR-VL3 is Q-X1-G-Q-X2-Y-P-X3-T, wherein,

x1 is Q, H or N, X2 is E or D, and X2 is I or L.

Further, the present invention provides an isolated binding protein of an NT-proBNP antigen binding domain, wherein:

in the complementarity determining region CDR-VH1, X2 is N;

in the complementarity determining region CDR-VH2, X1 is I;

in the complementarity determining region CDR-VH3, X1 is R;

in the complementarity determining region CDR-VL1, X1 is Q;

in the complementarity determining region CDR-VL2, X1 is A;

in the complementarity determining region CDR-VL3, X3 is L;

optionally:

in the complementarity determining region CDR-VH1, X2 is Q;

in the complementarity determining region CDR-VH2, X1 is L;

in the complementarity determining region CDR-VH3, X1 is K;

in the complementarity determining region CDR-VL1, X1 is N;

in the complementarity determining region CDR-VL2, X1 is P;

in the complementarity determining region CDR-VL3, X3 is I;

in some embodiments, in the complementarity determining region CDR-VH1, X1 is S;

in some embodiments, in the complementarity determining region CDR-VH1, X1 is T;

in some embodiments, in the complementarity determining region CDR-VH1, X3 is K;

in some embodiments, in the complementarity determining region CDR-VH1, X3 is R;

in some embodiments, in the complementarity determining region CDR-VH1, X3 is Q;

in some embodiments, in the complementarity determining region CDR-VH1, X3 is N;

in some embodiments, in the complementarity determining region CDR-VH2, X2 is E;

in some embodiments, in the complementarity determining region CDR-VH2, X2 is D;

in some embodiments, in the complementarity determining region CDR-VH2, X3 is a;

in some embodiments, in the complementarity determining region CDR-VH2, X4 is I;

in some embodiments, in the complementarity determining region CDR-VH2, X4 is V;

in some embodiments, in the complementarity determining region CDR-VH2, X4 is L;

in some embodiments, in the complementarity determining region CDR-VH3, X2 is G;

in some embodiments, in the complementarity determining region CDR-VH3, X2 is a;

in some embodiments, in the complementarity determining region CDR-VH3, X3 is a;

in some embodiments, in the complementarity determining region CDR-VH3, X3 is G;

in some embodiments, in the complementarity determining region CDR-VL1, X2 is Q;

in some embodiments, in the complementarity determining region CDR-VL1, X2 is N;

in some embodiments, in the complementarity determining region CDR-VL1, X2 is H;

in some embodiments, in the complementarity determining region CDR-VL1, X3 is Y;

in some embodiments, in the complementarity determining region CDR-VL1, X3 is F;

in some embodiments, in the complementarity determining region CDR-VL1, X3 is W;

in some embodiments, in the complementarity determining region CDR-VL2, X2 is I;

in some embodiments, in the complementarity determining region CDR-VL2, X2 is V;

in some embodiments, in the complementarity determining region CDR-VL2, X2 is L;

in some embodiments, in the complementarity determining region CDR-VL3, X1 is Q;

in some embodiments, in the complementarity determining region CDR-VL3, X1 is H;

in some embodiments, in the complementarity determining region CDR-VL3, X1 is N;

in some embodiments, in the complementarity determining region CDR-VL3, X2 is E;

in some embodiments, in the complementarity determining region CDR-VL3, X2 is D.

In some embodiments, the mutation site of each complementarity determining region is selected from any one of the following mutations:

。

in some embodiments, the binding protein includes at least 3 CDRs therein; alternatively, the binding protein comprises at least 6 CDRs.

In some embodiments, a binding protein described herein can comprise 3 CDRs, 4 CDRs, 5 CDRs, 6 CDRs, and optionally, the CDRs can be any combination selected from a heavy chain CDR region and/or a light chain CDR region.

In some embodiments, the binding protein is one of a nanobody, a F (ab ') 2, a Fab', a Fab, a Fv, a scFv, a diabody, and an antibody minimal recognition unit.

In some embodiments, the binding protein comprises light chain framework regions FR-L1, FR-L2, FR-L3 and FR-L4 in the sequence shown in SEQ ID NOS: 1-4, and/or heavy chain framework regions FR-H1, FR-H2, FR-H3 and FR-H4 in the sequence shown in SEQ ID NOS: 5-8.

In some embodiments, the framework regions can be of human species origin to constitute humanized antibodies.

In some embodiments, the binding protein further comprises an antibody constant region sequence.

In some embodiments, the constant region sequence is selected from the group consisting of sequences of any one of the constant regions of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD.

In some embodiments, the species of the constant region is derived from a cow, horse, dairy cow, pig, sheep, goat, mouse, dog, cat, rabbit, camel, donkey, deer, mink, chicken, duck, goose, turkey, chicken fighting, or human.

In some embodiments, the constant region is derived from a mouse.

In other embodiments, the constant regions of the invention may be derived from a human to constitute a humanized antibody.

In some embodiments, the

The light chain constant region sequence is shown as SEQ ID NO. 9;

the heavy chain constant region sequence is shown in SEQ ID NO 10.

In some embodiments, the binding protein is a whole antibody comprising a variable region and a constant region.

The invention also provides a nucleic acid molecule which is DNA or RNA and codes the binding protein.

The invention also provides a vector comprising the nucleic acid molecule described above.

The invention also provides a host cell comprising the nucleic acid molecule or the vector.

In some embodiments, the host cell includes bacterial, eukaryotic, yeast and baculovirus systems.

In some embodiments, the host cell is a eukaryotic cell, further a mammalian cell.

In some embodiments, the host cell is a Chinese Hamster Ovary (CHO) cell, a HeLa cell, a young hamster kidney cell, or a mouse myeloma cell.

In some embodiments, the host cell is a Chinese Hamster Ovary (CHO) cell.

The invention also provides a method for producing the binding protein, which comprises the following steps:

the above-mentioned host cells are cultured in a medium, and the produced binding protein is recovered from the medium or from the cultured host cells.

According to one aspect of the invention, the invention also relates to a reagent or kit comprising the above-described binding protein.

In some embodiments, the reagent or kit further comprises one or more of a buffer, a stabilizer, a diluent, or a carrier.

In some embodiments, the present invention provides kits for detecting the presence of NT-proBNP protein in a subject suffering from heart failure or cardiac function assessment.

According to one aspect of the invention, the invention also relates to a method for detecting NT-proBNP in a test sample, comprising:

a) contacting NT-proBNP antigen in the test sample with a binding protein as described above under conditions sufficient for an antibody/antigen binding reaction to occur to form an immune complex; and

b) detecting the presence of the immune complex.

In some embodiments, step a) further comprises a second antibody in the immune complex, which second antibody binds to the binding protein;

in some embodiments a second antibody is further included in the immune complex of step a), said second antibody binding to the NT-proBN antigen.

In this embodiment, the binding protein is in the form of a first antibody forming a partner antibody with the second antibody for binding to a different epitope of NT-proBNP.

In some embodiments, the binding protein may be labeled with an indicator that shows the signal intensity, so that the complex is easily detected.

In some embodiments, the second antibody may be labeled with an indicator that indicates the strength of the signal, so that the complex is readily detected.

In some embodiments, the indicator that shows signal intensity is selected from a fluorescent label, an enzyme, a metal ion, an isotope, or a fluorescent microsphere.

In some embodiments, the invention also provides the use of a binding protein as described above in the manufacture of a product for the detection of heart failure or the assessment of heart function.

The NT-proBNP binding protein provided by the invention has strong activity, has high affinity with human NT-proBNP, has better affinity compared with the NT-proBNP antibody commonly on the market, and can realize high-efficiency detection on NT-proBNP, thereby providing basis for early diagnosis of heart failure and cardiovascular diseases. In addition, hybridoma cells are not required to be induced in the abdominal cavity of the mouse to produce the binding protein, so that the production difficulty is low, and the antibody function is more stable.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is an electrophoretogram of the anti-NT-proBNP antibody provided in example 1.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by manufacturers, and are all conventional products available on the market. It is also to be understood that the terminology used in the description is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

Unless defined otherwise herein, scientific and technical terms used in connection with the present invention shall have the meanings that are commonly understood by one of ordinary skill in the art. The meaning and scope of a term should be clear, however, in the event of any potential ambiguity, the definition provided herein takes precedence over any dictionary or extrinsic definition.

In order that the invention may be more readily understood, selected terms are defined below.

The terms "isolated binding protein comprising an antigen binding domain", "isolated binding protein", "binding protein" generally refer to all proteins/protein fragments comprising CDR regions, including Fab, F (ab') 2, Fd, Fv, scFv, diabodies, minimal recognition units for antibodies, and antibodies, as well as single chain derivatives of such antibodies and fragments. The term "antibody" includes polyclonal antibodies, monoclonal antibodies, and antigenic compound-binding fragments of these antibodies. The type of antibody can be selected from IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD. Furthermore, the term "antibody" includes naturally occurring antibodies as well as non-naturally occurring antibodies, including, for example, chimeric (chimeric), bifunctional (bifunctional) and humanized (humanized) antibodies, as well as related synthetic isomeric forms (isoforms). The term "antibody" is used interchangeably with "immunoglobulin".

The "F (ab ') 2" and "Fab'" moieties can be produced by treating Ig with proteases such as pepsin and papain, and includes antibody fragments produced by digestion of immunoglobulins in the vicinity of disulfide bonds that exist between hinge regions within each of the 2 heavy chains. For example, papain cleaves IgG upstream of disulfide bonds between hinge regions present within each of 2 heavy chains to produce 2 cognate antibody fragments in which a light chain consisting of VL and CL (light chain constant region) and a heavy chain fragment consisting of VH and CH γ regions (in the constant region of the heavy chain) are linked by disulfide bonds at their C-terminal regions. Each of these 2 homologous antibody fragments is called Fab'. Proteases also cleave IgG upstream of the disulfide bonds between hinge regions present within each of the 2 heavy chains to produce antibody fragments: the fragment is slightly larger than the 2 aforementioned fragments in which the Fab' is joined at the hinge region. This antibody fragment is designated F (ab') 2.

The Fab fragment also contains the constant domain of the light chain and the first constant domain of the heavy chain (CH 1). Fab' fragments differ from Fab fragments in that several residues are added at the carboxy terminus of the heavy chain CH1 domain, including one or more cysteines from the antibody hinge region. Fab '-SH is herein denoted as such a Fab': wherein the cysteine residues of the constant domain carry a free thiol group. F (ab ') 2 antibody fragments were originally produced as Fab' fragment pairs, which have a hinge cysteine between them. Other chemical couplings of antibody fragments are also known.

"Fv" refers to antibody fragments that contain an intact antigen recognition and antigen binding site. This region consists of a dimer of one heavy and one light chain variable domain tightly non-covalently or covalently bound (disulfide-linked Fv's have been described in the art, Reiter et al (1996) Nature Biotechnology 14: 1239-1245). In this configuration, the 3 CDRs of each variable domain interact to define an antigen binding site on the surface of the VH-VL dimer. The combination of one or more CDRs from each VH and VL chain together confer antigen binding specificity to the antibody.

The "variable region" or "variable domain" of an antibody refers to the amino-terminal domain of the heavy or light chain of the antibody. The variable domain of the heavy chain may be referred to as "VH". The variable domain of the light chain may be referred to as "VL". These domains are usually the most variable parts of an antibody and contain an antigen binding site. The light or heavy chain variable region is made up of framework regions interrupted by three hypervariable regions, termed "complementarity determining regions" or "CDRs". The framework regions of the antibody, which constitute the combination of the essential light and heavy chains, serve to locate and align the CDRs, which are primarily responsible for binding to the antigen.

As used herein, "framework" or "FR" regions mean regions of an antibody variable domain that are exclusive of those defined as CDRs. Each antibody variable domain framework can be further subdivided into adjacent regions separated by CDRs (FR1, FR2, FR3 and FR 4).

Typically, the variable domains of the heavy and light chains, VL/VH, may be composed of CDRs and FRs numbered as follows in a combinatorial arrangement: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR 4.

As used herein, the term "purified" or "isolated" in relation to a polypeptide or nucleic acid means that the polypeptide or nucleic acid is not in its native medium or native form. Thus, the term "isolated" includes a polypeptide or nucleic acid that is removed from its original environment, e.g., from its natural environment if it is naturally occurring. For example, an isolated polypeptide is free of at least some proteins or other cellular components that are normally bound to or normally mixed with it or in solution. Isolated polypeptides include the naturally-produced polypeptide contained in a cell lysate, the polypeptide in purified or partially purified form, recombinant polypeptides, the polypeptide expressed or secreted by a cell, and the polypeptide in a heterologous host cell or culture. In connection with a nucleic acid, the term isolated or purified indicates, for example, that the nucleic acid is not in its natural genomic context (e.g., in a vector, as an expression cassette, linked to a promoter, or artificially introduced into a heterologous host cell).

It is well known in the art that amino acid sequences in non-CDR regions can be readily altered to obtain variants with similar biological activity according to well-established, well-known protocols. Thus, the invention also includes "functional derivatives" of the binding proteins. "functional derivative" refers to a variant with amino acid substitutions, one functional derivative retaining the activity of a detectable binding protein, preferably an antibody capable of binding to NT-proBNP. "functional derivatives" may include "variants" and "fragments" which have similar biological activity as the binding proteins described in the present invention.

Exemplary embodiments of the invention

In some embodiments, the antigen binding domain has at least 85%, or 90%, or 91%, or 92%, or 93%, or 94%, or 95%, or 96%, or 97%, or 98%, or 99% sequence identity to the complementarity determining region of the above amino acid sequence and has K-proBNP with NT-proBNP_D≤5.59×10^-9mol/L，K_DThe value can also be selected to be 1 × 10^-9mol/L、2×10^-9mol/L、3×10^-9mol/L、4×10^-9mol/L、5×10^-9mol/L、6×10^-9mol/L、1×10^-10mol/L、2×10^-10mol/L、3×10^-10mol/L、4×10^-10mol/L、5×10^-10mol/L、6×10^-10mol/L、7×10^-10mol/L、8×10^-10mol/L, or 9X 10^-10mol/L; or 1.52X 10^-10mol/L≤K_D≤5.59×10^-9mol/L。

In some embodiments, the binding proteins described herein may comprise 3 CDRs, 4 CDRs, 5 CDRs, 6 CDRs, and optionally, the CDRs may be any combination selected from the group consisting of heavy chain CDR regions and/or light chain CDR regions.

In some embodiments, the binding protein is a "functional fragment" of an antibody, such as one of a nanobody, F (ab ') 2, Fab', Fab, Fv, scFv (sc ═ single chain), diabodies (diabodies), and antibody minimal recognition units.

These functional fragments typically have the same binding specificity as the antibody from which they are derived. As those skilled in the art can surmise from the description of the present invention and the means of the related art, the antibody fragment of the present invention can be obtained by methods such as enzymatic digestion (including pepsin or papain) and/or by chemical reduction cleavage of disulfide bonds.

Antibody fragments can also be obtained by peptide synthesis by recombinant genetic techniques also known to those skilled in the art or by, for example, automated peptide synthesizers, such as those sold by Applied BioSystems and the like.

In some embodiments, the framework region sequence is a human framework sequence, such that a humanized antibody is formed.

In other embodiments, the known human framework sequences may also be modified by methods known in the art to alter the selection of one or more relevant framework amino acid positions, depending on various criteria. One criterion for selecting the relevant framework amino acids for alteration may be the relative difference in amino acid framework residues between the donor and acceptor molecules. Using this approach to select relevant framework positions for alteration has the advantage of avoiding any subjective bias in residue determination or any bias in the contribution of residues to CDR binding affinity.

In some embodiments, the constant region sequences of the present application include heavy chain constant regions, such as a μ chain, δ chain, γ chain, α chain, or ε chain constant regions of an IgG1, IgG2, IgG3, IgG4, IgA, IgE, IgM, or IgD. Light chain constant regions, kappa light chain constant regions or lambda light chain constant regions may also be included.

Alternatively, in another embodiment, the constant region sequence may be substituted for at least one amino acid residue while maintaining the binding protein activity or affinity.

In this context, the term nucleic acid encompasses conservatively substituted variants thereof (e.g., substitution of degenerate codons) and complementary sequences. The terms "nucleic acid" and "polynucleotide" are synonymous and encompass genes, cDNA molecules, mRNA molecules, and fragments thereof such as oligonucleotides.

Wherein the nucleic acid sequence is operably linked to at least one regulatory sequence. "operably linked" means that the coding sequence is linked to the regulatory sequences in a manner that allows for expression of the coding sequence. Regulatory sequences are selected to direct the expression of the protein of interest in a suitable host cell and include promoters, enhancers and other expression control elements.

Herein, a vector may refer to a molecule or agent comprising a nucleic acid of the invention or a fragment thereof, capable of carrying genetic information and capable of delivering the genetic information into a cell. Typical vectors include plasmids, viruses, bacteriophages, cosmids and minichromosomes. The vector may be a cloning vector (i.e., a vector for transferring genetic information into a cell, which may be propagated and in which the genetic information may be present or absent) or an expression vector (i.e., a vector which comprises the necessary genetic elements to permit expression of the genetic information of the vector in a cell). Thus, a cloning vector may contain a selectable marker, as well as an origin of replication compatible with the cell type specified by the cloning vector, while an expression vector contains the necessary regulatory elements to effect expression in a specified target cell.

The vector may comprise a plasmid, phage, cosmid, minichromosome, or virus, as well as naked DNA that is transiently expressed only in a particular cell. The cloning and expression vectors of the invention are capable of autonomous replication and thus provide high copy numbers for high level expression or high level replication purposes for subsequent cloning. The expression vector may comprise a promoter for driving expression of the nucleic acid fragment of the invention, optionally a nucleic acid sequence encoding a signal peptide for secretion or integration of the peptide expression product into a membrane, a nucleic acid fragment of the invention, and optionally a nucleic acid sequence encoding a terminator. When the expression vector is manipulated in a production strain or cell line, the vector may or may not be integrated into the genome of the host cell when introduced into the host cell. The vector may further carry a replication site, as well as a marker sequence capable of providing phenotypic selection in transformed cells.

The expression vectors of the invention are useful for transforming host cells. Such transformed cells are also part of the invention and may be cultured cells or cell lines for propagation of the nucleic acid fragments and vectors of the invention, or for recombinant production of the polypeptides of the invention. The transformed cells of the present invention include microorganisms such as bacteria (e.g., Escherichia coli, Bacillus spp., etc.). The transformed cells are capable of replicating the nucleic acid fragments of the invention. When the peptide combination of the present invention is recombinantly produced, the expression product may be exported into the culture medium or carried on the surface of the transformed cell.

The method can be, for example, transfecting a host cell with a nucleic acid vector encoding at least a portion of the binding protein, and culturing the host cell under suitable conditions such that the binding protein is expressed. The host cell may also be transfected with one or more expression vectors, which may comprise, alone or in combination, DNA encoding at least a portion of the binding protein. The bound protein may be isolated from the culture medium or cell lysate using conventional techniques for purifying proteins and peptides, including ammonium sulfate precipitation, chromatography (e.g., ion exchange, gel filtration, affinity chromatography, etc.), and/or electrophoresis.

Construction of suitable vectors containing the coding and regulatory sequences of interest can be carried out using standard ligation and restriction techniques well known in the art. The isolated plasmid, DNA sequence or synthetic oligonucleotide is cleaved, tailed and religated as desired. Any method may be used to introduce mutations into the coding sequence to produce variants of the invention, and these mutations may comprise deletions or insertions or substitutions or the like.

The indicator for displaying signal intensity comprises any one of a fluorescent label, an enzyme, a metal ion, an isotope or a fluorescent microsphere.

In some embodiments, the fluorescent species include Alexa 350, Alexa 405, Alexa 430, Alexa488, Alexa555, Alexa 647, AMCA, aminoacridine, BODIPY 630/650, BODIPY650/665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, 5-carboxy-4 ', 5' -dichloro-2 ', 7' -dimethoxyfluorescein, 5-carboxy-2 ', 4', 5', 7' -tetrachlorofluorescein, 5-carboxyfluorescein, 5-carboxyrhodamine, 6-carboxytetramethylrhodamine, Cascade Blue, Cy2, Cy3, Cy5, Cy7, 6-FAM, dansyl chloride, fluorescein, HEX, 6-JOE, NBD (7-nitrobenz-2-oxa-1, 3-diazole), Any one of Oregon Green 488, Oregon Green 500, Oregon Green514, Pacific Blue, phthalic acid, terephthalic acid, isophthalic acid, cresol fast violet, cresol Blue violet, brilliant cresol Blue, p-aminobenzoic acid, erythrosine, phthalocyanine, azomethine, cyanine, xanthine, succinyl fluorescein, rare earth metal cryptate, europium tripyridyldiamine, europium cryptate or chelate, diamine, bispyanine, LaJolla Blue dye, allophycocyanin, allocyanonin B, phycocyanin C, phycocyanin R, thiamine, phycoerythrin R, REG, rhodamine Green, rhodamine isothiocyanate, rhodamine red, ROX, TAMRA, TET, TRIT (tetramethylrhodamine isothiol), tetramethylrhodamine, and Texas red.

In some embodiments, the radioisotope includes any of 110In, 111In, 177Lu, 18F, 52Fe, 62Cu, 64Cu, 67Ga, 68Ga, 86Y, 90Y, 89Zr, 94mTc, 94Tc, 99mTc, 120I, 123I, 124I, 125I, 131I, 154-doped 158Gd, 32P, 11C, 13N, 15O, 186Re, 188Re, 51Mn, 52mMn, 55Co, 72As, 75Br, 76Br, 82mRb, and 83 Sr.

In some embodiments, the enzyme comprises any one of horseradish peroxidase, alkaline phosphatase, and glucose oxidase.

In some embodiments, the fluorescent microspheres are: the polystyrene fluorescent microsphere is internally wrapped with rare earth fluorescent ion europium.

The following examples are provided to illustrate the present invention, but not to limit the scope of the present invention.

Example 1

1. Expression plasmid construction

Restriction enzyme, Prime Star DNA polymerase, was purchased from Takara in this example. MagExtractor-RNA extraction kit was purchased from TOYOBO. BD SMART^TMThe RACE cDNAamplification Kit was purchased from Takara. pMD-18T vector was purchased from Takara. Plasmid extraction kits were purchased from Tiangen corporation. Primer synthesis and gene sequencing were performed by Invitrogen corporation. The hybridoma cell strain secreting Anti-NT-proBNP monoclonal antibody is the existing hybridoma cell strain.

1.1 primers

5' RACE primer:

SMARTER IIAOligonucleotide

5’>AAGCAGTGGTATCAACGCAGAGTACXXXXX<3’；

5'-RACE CDS Primer(5'-CDS)：5’>(T)₂₅VN<3(N＝A，C，G，or T；V＝A，G，or C)；

Universal PrimerAMix(UPM):

5’>CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT<3’；

Nested Universal PrimerA(NUP):5’>AAGCAGTGGTATCAACGCAGAGT<3’；

mIg-kR：5’>CGCCTAACACTCATTCCTGTTGAAGC<3’；

mIg-HR：5’>CCGCTCATTTACCCGGAGACCG<3’。

1.2 antibody Gene cloning and sequencing

RNA is extracted from a hybridoma cell strain generating Anti-NT-proBNP monoclonal antibody, first strand cDNA synthesis is carried out by using SMARTERTM RACE cDNAamplification Kit and SMARTER IIAOligonucleotide and 5' -CDS primer in the Kit, and the obtained first strand cDNA product is used as PCR amplification template. The light chain was amplified with Universal Primer A Mix (UPM), Nested Universal Primer A (NUP) and mIg-kR primers and the heavy chain with Universal Primer A Mix (UPM), Nested Universal Primer A (NUP) and mIg-HR primers. The target band of the light chain is about 0.75KB, and the target band of the heavy chain is about 1.45 KB. The target band is purified and recovered by agarose gel electrophoresis, the product is added with A by rTaq DNA polymerase for reaction and then inserted into a pMD-18T vector, the product is transformed into DH5 alpha competent cells, and after colonies grow out, 4 clone genes of the Heavy Chain and Light Chain are taken respectively for sequencing.

1.3 sequence analysis of the Anti-NT-proBNP antibody variable region Gene

Putting the gene sequence obtained by sequencing in an IMGT antibody database for analysis, and analyzing by using VNTI11.5 software to determine that the genes amplified by the heavy Chain primer pair and the Light Chain primer pair are correct, wherein in the gene fragment amplified by the Light Chain, the VL gene sequence is 324bp, belongs to VkII gene family, and a leader peptide sequence of 57bp is arranged in front of the VL gene sequence; in the gene fragment amplified by the Heavy Chain primer pair, the VH gene sequence is 351bp, belongs to a VH1 gene family, and has a leader peptide sequence of 57bp in front.

1.4 construction of recombinant antibody expression plasmid

pcDNA^TM 3.4

vector is a constructed recombinant antibody eukaryotic expression vector, and multiple cloning enzyme cutting sites such as HindIII, BamHI, EcoRI and the like are introduced into the expression vector and named as pcDNA3.4A expression vector, and the vector is called as 3.4A expression vector for short in the following; according to the sequencing result of the antibody gene in the pMD-18T, the light chain and heavy chain gene specific primers of the Anti-NT-proBNP antibody with HindIII and EcoRI restriction sites and protective bases at two ends are designed, and the primer sequences are as follows:

proBNP-HF:5’>CCCAAGCTTGCCGCCACCATGAGTGTGCTCA CTCAGGTCCTGGGGT<3’；

proBNP-HR:5’>GGGGAATTCTCATTTACCCGGAGACCGGGA GATGGTCTTC<3’；

proBNP-LF:5’>CCCAAGCTTGCCGCCACCATGAAGTCACAG ACCCAGGTCTTCGTA<3’；

proBNP-LR:5’>CCCGAATTCTCAACACTCATTCCTGTTGAAG CTCTTGACGATG<3’；

and performing double enzyme digestion on the Heavy Chain gene fragment and the Light Chain gene fragment obtained by amplification respectively by adopting HindIII/EcoRI, performing double enzyme digestion on the 3.4A vector by adopting HindIII/EcoRI, and respectively connecting the Heavy Chain gene and the Light Chain gene to a3.4A expression vector after purifying and recovering the fragments and the vector to obtain the recombinant expression plasmids of the Heavy Chain and the Light Chain.

2. Cell line selection

2.1 transient transfection of recombinant antibody expression plasmids into CHO cells

Plasmid was diluted to 400ng/ml with ultrapure water and CHO cells were conditioned at 1.43X 10⁷cells/ml are put into a centrifuge tube, 100 mul of plasmid is mixed with 700 mul of cells, the mixture is transferred into an electric rotating cup and is electrically rotated, the sampling counting is carried out on 3 rd, 5 th and 7 th days, and the sampling detection is carried out on 7 th day.

Diluting the recombinant NT-proBNP antigen (a Roc biological product) to 1 μ g/ml by the coating solution, 100 μ l per well, and standing overnight at 4 ℃; the next day, washing with the washing solution for 2 times, and patting dry; adding blocking solution (20% BSA + 80% PBS), beating to dry at 37 deg.C for 1 hr, and adding blocking solution (120 μ l per well); adding diluted cell supernatant at 100 μ l/well, 37 deg.C for 30min (partial supernatant for 1 h); washing with washing solution for 5 times, and drying; adding goat anti-mouse IgG-HRP (goat anti-mouse IgG-HRP) with the concentration of 100 mu l per well at 37 ℃ for 30 min; washing with washing solution for 5 times, and drying; adding a developing solution A (50 μ l/hole), adding a developing solution B (50 μ l/hole), and standing for 10 min; adding stop solution into the mixture, wherein the concentration of the stop solution is 50 mu l/hole; OD readings were taken at 450nm (reference 630nm) on the microplate reader.

(2) Linearization of recombinant antibody expression plasmids

The following reagents were prepared: 50 mul Buffer, 100 mul DNA/tube, 10 mul Puv I enzyme, and sterile water to 500 mul, water bath enzyme digestion overnight at 37 ℃; sequentially extracting with equal volume of phenol/chloroform/isoamyl alcohol (lower layer) 25:24:1 and then chloroform (water phase); precipitating with 0.1 volume (water phase) of 3M sodium acetate and 2 volumes of ethanol on ice, rinsing with 70% ethanol, removing organic solvent, re-melting with appropriate amount of sterilized water after ethanol is completely volatilized, and finally measuring concentration.

(3) Stable transfection of recombinant antibody expression plasmid, stable cell screening

Plasmid was diluted to 400ng/ml with ultrapure water and CHO cells were conditioned at 1.43X 10⁷cells/ml are put into a centrifuge tube, 100 mul of plasmid is mixed with 700 mul of cells, and the mixture is transferred into an electric rotating cup and is electrically rotated, and the next day is counted; 25 μmol/LMSX 96 well was cultured under pressure for about 25 days.

Observing the marked clone holes with cells under a microscope, and recording the confluence degree; taking culture supernatant, and sending the culture supernatant to a sample for detection; selecting cell strains with high antibody concentration and relative concentration, transferring the cell strains into 24 holes, and transferring the cell strains into 6 holes after 3 days; after 3 days, the seeds were kept and cultured in batches, and the cell density was adjusted to 0.5X 10⁶cells/ml, 2.2ml, cell density 0.3X 10⁶cell/ml, 2ml for seed preservation; and (4) 7 days, carrying out batch culture supernatant sample sending detection in 6 holes, and selecting cell strains with small antibody concentration and cell diameter to transfer TPP for seed preservation and passage.

3. Production of recombinant antibodies

After the stable cell strain for seed preservation is recovered, the stable cell strain is cultured in a shaking bottle with the specification of 125ml, the inoculation volume is 30ml, the culture medium is 100% Dynamis culture medium, and the stable cell strain is placed in a shaking table with the rotating speed of 120r/min, the temperature of 37 ℃ and the carbon dioxide of 8%. Culturing for 72h, inoculating and expanding culture at an inoculation density of 50 ten thousand cells/ml, wherein the expanding culture volume is calculated according to production requirements, and the culture medium is 100% Dynamis culture medium. Then the culture is expanded every 72 h. When the cell amount meets the production requirement, the production is carried out by strictly controlling the inoculation density to be about 50 ten thousand cells/ml.

Shake flask parameters: the rotating speed is 120r/min, the temperature is 37 ℃, and the carbon dioxide is 8 percent. Feeding in a flowing mode: daily feeding was started when the culture was carried out for 72h in a shake flask, 3% of the initial culture volume was fed daily to HyCloneTM Cell BoostTM Feed 7a, and one thousandth of the initial culture volume was fed daily to Feed 7b, up to day 12 (day 12 feeding). Glucose was supplemented with 3g/L on the sixth day. Samples were collected on day 13.

Affinity purification was performed using a proteinA affinity column. Mu.g of the purified antibody was subjected to reducing SDS-PAGE, and 4. mu.g of an external control antibody was used as a control, and the electrophoretogram was shown in FIG. 1. Two bands were shown after reducing SDS-PAGE, one with about 28kD light chain (SEQ ID NO: 11) and one with about 50kD heavy chain (SEQ ID NO: 12).

Example 2

2.1 site-mutant antibodies

The antibody obtained in example 1 has light chain and heavy chain with sequences shown in SEQ ID NO 11 and 12, and has certain capacity of combining NT-proBNP protein, better affinity, and applicant mutates the light chain CDR and heavy chain CDR of the antibody in order to further screen the antibody with better affinity and activity.

Upon analysis, the complementarity determining region (WT) of the heavy chain:

CDR-VH1 is G-F-S (X1) -F-S-Q (X2) -Y-W-M-K (X3);

CDR-VH2 is E-L (X1) -R-L-K-S-E (X2) -N-Y-A-T-H-Y-A (X3) -E-S-I (X4) -K-G;

CDR-VH3 is T-K (X1) -G-Y-A (X2) -G (X3) -M-D;

complementarity determining region (WT) of light chain:

CDR-VL1 is H-A-S-N (X1) -N-I-H (X2) -V-Y (X3) -L-I;

CDR-VL2 is K-P (X1) -S-N-I (X2) -H-T;

CDR-VL3 is Q-Q (X1) -G-Q-D (X2) -Y-P-I (X3) -T;

wherein, X1, X2, X3 and X4 are all mutation sites.

TABLE 1 mutant sites associated with antibody Activity

Based on the CDR sequences of WT obtained by the above analysis, the above mutation was performed at the corresponding site in Table 1.

2.2 detection of site-mutated antibody Activity

Diluting the recombinant NT-proBNP antigen (a Roc biological product) to 1 mu g/ml by using the coating solution, coating the recombinant NT-proBNP antigen in a micropore plate by using 100 mu l of the coating solution per pore, and standing overnight at 4 ℃; the next day, washing with the washing solution for 2 times, and patting dry; adding blocking solution (20% BSA + 80% PBS), beating to dry at 37 deg.C for 1 hr, and adding blocking solution (120 μ l per well); adding diluted recombinant NT-proBNP antibody at 100. mu.l/well, 37 ℃ for 30min (partial supernatant for 1 h); washing with washing solution for 5 times, and drying; adding goat anti-mouse IgG-HRP (goat anti-mouse IgG-HRP) with the concentration of 100 mu l per well at 37 ℃ for 30 min; washing with washing solution for 5 times, and drying; adding a developing solution A (50 μ l/hole), adding a developing solution B (50 μ l/hole), and standing for 10 min; adding stop solution into the mixture, wherein the concentration of the stop solution is 50 mu l/hole; OD readings were taken at 450nm (reference 630nm) on the microplate reader. Some of the results are shown in the following table:

TABLE 2 antibody Activity assay data

As is clear from the above table, since the activity of mutation 1 is most effective, mutation sites having a high potency were selected by using mutation 1 as a backbone sequence, and the affinity analysis results of the corresponding binding proteins are shown in Table 4, as well as in Table 3 for some of the mutated sites.

TABLE 3 mutation sites related to antibody affinity

2.3 affinity assay

Using AMC sensors, purified antibodies were diluted to 10. mu.g/ml with PBST and NT-proBNP antigen (Fipeng Bioproduct) was diluted with PBST in a gradient: 208.3nmol/ml, 104.2nmol/ml, 52.1nmol/ml, 26nmol/ml, 13nmol/ml, 0 nmol/ml;

the operation flow is as follows: equilibrating in buffer 1(PBST) for 60s, immobilizing antibody in antibody solution for 300s, incubating in buffer 2(PBST) for 180s, binding in antigen solution for 420s, dissociating in buffer 2 for 1200s, regenerating the sensor with 10mM GLY solution pH 1.69 and buffer 3, and outputting the data. (KD represents the equilibrium dissociation constant, i.e.affinity; kon represents the association rate; kdis represents the dissociation rate.)

Table 4 affinity assay data

As can be seen from table 4, the mutation sites listed in table 3 have little effect on the affinity of the antibody.

To verify the above results, the above experiment was repeated using WT as a backbone sequence, and affinity verification of the mutation site was performed, and some results are as follows.

TABLE 5 mutations with WT as backbone

Table 6 affinity assay data

Mutations	KD(M)	kon(1/Ms)	kdis(1/s)
				WT	5.59E-09	1.10E+06	6.15E-03
WT1-1	6.12E-10	9.80E+06	6.00E-03
				WT1-2	9.33E-10	7.80E+06	7.28E-03
WT1-3	9.08E-10	8.60E+06	7.81E-03
				WT1-4	6.65E-10	9.40E+06	6.25E-03
WT1-5	1.25E-09	5.40E+06	6.75E-03
				WT1-6	9.89E-10	5.60E+06	5.54E-03
WT1-7	7.53E-10	8.90E+06	6.70E-03
				WT1-8	1.00E-09	6.20E+06	6.21E-03
WT1-9	3.26E-09	1.90E+06	6.20E-03
				WT1-10	7.88E-10	6.60E+06	5.20E-03
WT1-11	7.29E-10	7.80E+06	5.69E-03
				WT1-12	3.84E-09	1.80E+06	6.92E-03
WT1-13	1.67E-09	4.60E+06	7.69E-03
				WT1-14	9.52E-10	8.30E+06	7.90E-03

From the analysis in tables 5 and 6, the mutant sequences corresponding to the above mutant sites all have certain affinity under the premise of ensuring the antibody activity.

The antibodies are respectively placed in 4 ℃ (refrigerator), -80 ℃ (refrigerator) and 37 ℃ (thermostat) for 21 days, samples in 7 days, 14 days and 21 days are taken for state observation, and activity detection is carried out on the samples in 21 days, and the results show that no obvious protein state change is seen after the antibodies are placed in 21 days under three conditions, and the activity does not show descending and overtaking trend along with the rise of temperature, which indicates that the antibodies all have excellent stability, and the mutation of the sites has no influence on the stability of the antibodies.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.

SEQUENCE LISTING

<110> Dongguan City of Pengzhi Biotech Co., Ltd

<120> an isolated binding protein comprising an antigen binding domain of NT-proBNP

<130> 2019.12.16

<160> 12

<170> PatentIn version 3.5

<210> 1

<211> 23

<212> PRT

<213> Artificial sequence

<400> 1

Asp Ile Gln Met Asn Gln Ser Pro Ser Ser Leu Ser Ala Ser Leu Gly

1 5 10 15

Asp Thr Ile Thr Ile Thr Cys

20

<210> 2

<211> 15

<212> PRT

<213> Artificial sequence

<400> 2

Trp Tyr Gln Gln Lys Pro Gly Asn Ile Pro Lys Leu Leu Ile Tyr

1 5 10 15

<210> 3

<211> 32

<212> PRT

<213> Artificial sequence

<400> 3

Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Val Phe Thr

1 5 10 15

Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Ile Ala Thr Tyr Tyr Cys

20 25 30

<210> 4

<211> 11

<212> PRT

<213> Artificial sequence

<400> 4

Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg

1 5 10

<210> 5

<211> 25

<212> PRT

<213> Artificial sequence

<400> 5

Glu Val Asn Leu Glu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Met Lys Leu Ser Cys Val Ala Ser

20 25

<210> 6

<211> 14

<212> PRT

<213> Artificial sequence

<400> 6

Trp Val Arg Gln Ser Pro Glu Lys Gly Leu Glu Trp Ile Ala

1 5 10

<210> 7

<211> 30

<212> PRT

<213> Artificial sequence

<400> 7

Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Ser Ser Val Tyr Leu Gln

1 5 10 15

Met Asn Asn Leu Arg Ala Glu Asp Thr Gly Ile Tyr Phe Cys

20 25 30

<210> 8

<211> 12

<212> PRT

<213> Artificial sequence

<400> 8

Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser

1 5 10

<210> 9

<211> 106

<212> PRT

<213> Artificial sequence

<400> 9

Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln

1 5 10 15

Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr

20 25 30

Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln

35 40 45

Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr

50 55 60

Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg

65 70 75 80

His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro

85 90 95

Ile Val Lys Ser Phe Asn Arg Asn Glu Cys

100 105

<210> 10

<211> 336

<212> PRT

<213> Artificial sequence

<400> 10

Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Cys Gly

1 5 10 15

Asp Thr Thr Gly Ser Ser Val Thr Leu Gly Cys Leu Val Lys Gly Tyr

20 25 30

Phe Pro Glu Ser Val Thr Val Thr Trp Asn Ser Gly Ser Leu Ser Ser

35 40 45

Ser Val His Thr Phe Pro Ala Leu Leu Gln Ser Gly Leu Tyr Thr Met

50 55 60

Ser Ser Ser Val Thr Val Pro Ser Ser Thr Trp Pro Ser Gln Thr Val

65 70 75 80

Thr Cys Ser Val Ala His Pro Ala Ser Ser Thr Thr Val Asp Lys Lys

85 90 95

Leu Glu Pro Ser Gly Pro Ile Ser Thr Ile Asn Pro Cys Pro Pro Cys

100 105 110

Lys Glu Cys His Lys Cys Pro Ala Pro Asn Leu Glu Gly Gly Pro Ser

115 120 125

Val Phe Ile Phe Pro Pro Asn Ile Lys Asp Val Leu Met Ile Ser Leu

130 135 140

Thr Pro Lys Val Thr Cys Val Val Val Asp Val Ser Glu Asp Asp Pro

145 150 155 160

Asp Val Gln Ile Ser Trp Phe Val Asn Asn Val Glu Val His Thr Ala

165 170 175

Gln Thr Gln Thr His Arg Glu Asp Tyr Asn Ser Thr Ile Arg Val Val

180 185 190

Ser Thr Leu Pro Ile Gln His Gln Asp Trp Met Ser Gly Lys Glu Phe

195 200 205

Lys Cys Lys Val Asn Asn Lys Asp Leu Pro Ser Pro Ile Glu Arg Thr

210 215 220

Ile Ser Lys Ile Lys Gly Leu Val Arg Ala Pro Gln Val Tyr Ile Leu

225 230 235 240

Pro Pro Pro Ala Glu Gln Leu Ser Arg Lys Asp Val Ser Leu Thr Cys

245 250 255

Leu Val Val Gly Phe Asn Pro Gly Asp Ile Ser Val Glu Trp Thr Ser

260 265 270

Asn Gly His Thr Glu Glu Asn Tyr Lys Asp Thr Ala Pro Val Leu Asp

275 280 285

Ser Asp Gly Ser Tyr Phe Ile Tyr Ser Lys Leu Asn Met Lys Thr Ser

290 295 300

Lys Trp Glu Lys Thr Asp Ser Phe Ser Cys Asn Val Arg His Glu Gly

305 310 315 320

Leu Lys Asn Tyr Tyr Leu Lys Lys Thr Ile Ser Arg Ser Pro Gly Lys

325 330 335

<210> 11

<211> 214

<212> PRT

<213> Artificial sequence

<400> 11

Asp Ile Gln Met Asn Gln Ser Pro Ser Ser Leu Ser Ala Ser Leu Gly

1 5 10 15

Asp Thr Ile Thr Ile Thr Cys His Ala Ser Asn Asn Ile His Val Tyr

20 25 30

Leu Ile Trp Tyr Gln Gln Lys Pro Gly Asn Ile Pro Lys Leu Leu Ile

35 40 45

Tyr Lys Pro Ser Asn Ile His Thr Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Val Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln Gly Gln Asp Tyr Pro Ile

85 90 95

Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg Ala Asp Ala Ala

100 105 110

Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln Leu Thr Ser Gly

115 120 125

Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr Pro Lys Asp Ile

130 135 140

Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln Asn Gly Val Leu

145 150 155 160

Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr Tyr Ser Met Ser

165 170 175

Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg His Asn Ser Tyr

180 185 190

Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro Ile Val Lys Ser

195 200 205

Phe Asn Arg Asn Glu Cys

210

<210> 12

<211> 454

<212> PRT

<213> Artificial sequence

<400> 12

Glu Val Asn Leu Glu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Met Lys Leu Ser Cys Val Ala Ser Gly Phe Ser Phe Ser Gln Tyr

20 25 30

Trp Met Lys Trp Val Arg Gln Ser Pro Glu Lys Gly Leu Glu Trp Ile

35 40 45

Ala Glu Leu Arg Leu Lys Ser Glu Asn Tyr Ala Thr His Tyr Ala Glu

50 55 60

Ser Ile Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Ser Ser

65 70 75 80

Val Tyr Leu Gln Met Asn Asn Leu Arg Ala Glu Asp Thr Gly Ile Tyr

85 90 95

Phe Cys Thr Lys Gly Tyr Ala Gly Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Ser Val Thr Val Ser Ser Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro

115 120 125

Leu Ala Pro Gly Cys Gly Asp Thr Thr Gly Ser Ser Val Thr Leu Gly

130 135 140

Cys Leu Val Lys Gly Tyr Phe Pro Glu Ser Val Thr Val Thr Trp Asn

145 150 155 160

Ser Gly Ser Leu Ser Ser Ser Val His Thr Phe Pro Ala Leu Leu Gln

165 170 175

Ser Gly Leu Tyr Thr Met Ser Ser Ser Val Thr Val Pro Ser Ser Thr

180 185 190

Trp Pro Ser Gln Thr Val Thr Cys Ser Val Ala His Pro Ala Ser Ser

195 200 205

Thr Thr Val Asp Lys Lys Leu Glu Pro Ser Gly Pro Ile Ser Thr Ile

210 215 220

Asn Pro Cys Pro Pro Cys Lys Glu Cys His Lys Cys Pro Ala Pro Asn

225 230 235 240

Leu Glu Gly Gly Pro Ser Val Phe Ile Phe Pro Pro Asn Ile Lys Asp

245 250 255

Val Leu Met Ile Ser Leu Thr Pro Lys Val Thr Cys Val Val Val Asp

260 265 270

Val Ser Glu Asp Asp Pro Asp Val Gln Ile Ser Trp Phe Val Asn Asn

275 280 285

Val Glu Val His Thr Ala Gln Thr Gln Thr His Arg Glu Asp Tyr Asn

290 295 300

Ser Thr Ile Arg Val Val Ser Thr Leu Pro Ile Gln His Gln Asp Trp

305 310 315 320

Met Ser Gly Lys Glu Phe Lys Cys Lys Val Asn Asn Lys Asp Leu Pro

325 330 335

Ser Pro Ile Glu Arg Thr Ile Ser Lys Ile Lys Gly Leu Val Arg Ala

340 345 350

Pro Gln Val Tyr Ile Leu Pro Pro Pro Ala Glu Gln Leu Ser Arg Lys

355 360 365

Asp Val Ser Leu Thr Cys Leu Val Val Gly Phe Asn Pro Gly Asp Ile

370 375 380

Ser Val Glu Trp Thr Ser Asn Gly His Thr Glu Glu Asn Tyr Lys Asp

385 390 395 400

Thr Ala Pro Val Leu Asp Ser Asp Gly Ser Tyr Phe Ile Tyr Ser Lys

405 410 415

Leu Asn Met Lys Thr Ser Lys Trp Glu Lys Thr Asp Ser Phe Ser Cys

420 425 430

Asn Val Arg His Glu Gly Leu Lys Asn Tyr Tyr Leu Lys Lys Thr Ile

435 440 445

Ser Arg Ser Pro Gly Lys

450

Claims

1. An isolated binding protein comprising an NT-proBNP antigen binding domain, wherein said antigen binding domain comprises at least one complementarity determining region selected from the group consisting of amino acid sequences recited in seq id nos;

CDR-VH1 is G-F-X1-F-S-X2-Y-W-M-X3, wherein X1 is S or T, X2 is Q or N, X3 is K, R, Q or N;

CDR-VH2 is E-X1-R-L-K-S-X2-N-Y-A-T-H-Y-X3-E-S-X4-K-G, wherein X1 is I or L, X2 is E or D, X3 is A or P, X4 is I, V or L;

CDR-VH3 is T-X1-G-Y-X2-X3-M-D, wherein X1 is K or R, X2 is G or A, and X3 is A or G;

CDR-VL1 is H-A-S-X1-N-I-X2-V-X3-L-I, wherein X1 is N or Q, X2 is Q, N or H, X3 is Y, F or W;

CDR-VL2 is K-X1-S-N-X2-H-T, wherein X1 is A or P and X2 is I, V or L;

CDR-VL3 is Q-X1-G-Q-X2-Y-P-X3-T, wherein X1 is Q, H or N, X2 is E or D, and X3 is I or L;

preferably:

in the complementarity determining region CDR-VH1, X2 is N;

in the complementarity determining region CDR-VH2, X1 is I;

in the complementarity determining region CDR-VH3, X1 is R;

in the complementarity determining region CDR-VL1, X1 is Q;

in the complementarity determining region CDR-VL2, X1 is A;

in the complementarity determining region CDR-VL3, X3 is L;

optionally:

in the complementarity determining region CDR-VH1, X2 is Q;

in the complementarity determining region CDR-VH2, X1 is L;

in the complementarity determining region CDR-VH3, X1 is K;

in the complementarity determining region CDR-VL1, X1 is N;

in the complementarity determining region CDR-VL2, X1 is P;

in the complementarity determining region CDR-VL3, X3 is I;

preferably, in the complementarity determining region CDR-VH1, X1 is S;

preferably, in the complementarity determining region CDR-VH1, X1 is T;

preferably, in the complementarity determining region CDR-VH1, X3 is K;

preferably, in the complementarity determining region CDR-VH1, X3 is R;

preferably, in the complementarity determining region CDR-VH1, X3 is Q;

preferably, in the complementarity determining region CDR-VH1, X3 is N;

preferably, in the complementarity determining region CDR-VH2, X2 is E;

preferably, in the complementarity determining region CDR-VH2, X2 is D;

preferably, in the complementarity determining region CDR-VH2, X3 is a;

preferably, in the complementarity determining region CDR-VH2, X4 is I;

preferably, in the complementarity determining region CDR-VH2, X4 is V;

preferably, in the complementarity determining region CDR-VH2, X4 is L;

preferably, in the complementarity determining region CDR-VH3, X2 is G;

preferably, in the complementarity determining region CDR-VH3, X2 is a;

preferably, in the complementarity determining region CDR-VH3, X3 is a;

preferably, in the complementarity determining region CDR-VH3, X3 is G;

preferably, in the complementarity determining region CDR-VL1, X2 is Q;

preferably, in the complementarity determining region CDR-VL1, X2 is N;

preferably, in the complementarity determining region CDR-VL1, X2 is H;

preferably, in the complementarity determining region CDR-VL1, X3 is Y;

preferably, in the complementarity determining region CDR-VL1, X3 is F;

preferably, in the complementarity determining region CDR-VL1, X3 is W;

preferably, in the complementarity determining region CDR-VL2, X2 is I;

preferably, in the complementarity determining region CDR-VL2, X2 is V;

preferably, in the complementarity determining region CDR-VL2, X2 is L;

preferably, in the complementarity determining region CDR-VL3, X1 is Q;

preferably, in the complementarity determining region CDR-VL3, X1 is H;

preferably, in the complementarity determining region CDR-VL3, X1 is N;

preferably, in the complementarity determining region CDR-VL3, X2 is E;

preferably, in the complementarity determining region CDR-VL3, X2 is D; further, the mutation site of each complementarity determining region is selected from any one of the following sequences:

optionally, in some embodiments, the mutation site of each complementarity determining region is selected from any one of the following mutations:

optionally, the binding protein has at least 80% sequence identity to the complementarity determining region of the amino acid sequence and has K with NT-proBNP_D≤5.59×10^-9Affinity of mol/L.

2. The binding protein according to claim 1, wherein at least 3 CDRs are included in the binding protein; alternatively, the binding protein comprises at least 6 CDRs;

preferably, the binding protein is a nanobody, F (ab')₂One of, Fab', Fab, Fv, scFv, diabody, and antibody minimal recognition unit;

preferably, the binding protein comprises light chain framework regions FR-L1, FRL2, FR-L3 and FR-L4 which have the sequences shown in SEQ ID NO. 1-4 in sequence, and/or heavy chain framework regions FR-H1, FR-H2, FRH3 and FR-H4 which have the sequences shown in SEQ ID NO. 5-8 in sequence.

3. The binding protein according to any one of claims 1-2, wherein said binding protein further comprises an antibody constant region sequence;

preferably, the constant region sequence is selected from the group consisting of sequences of any one of the constant regions of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD;

preferably, the species of the constant region is from cattle, horses, cows, pigs, sheep, goats, mice, dogs, cats, rabbits, camels, donkeys, deer, mink, chickens, ducks, geese, turkeys or humans;

preferably, the constant region is of murine origin;

more preferably, it is a mixture of more preferably,

the light chain constant region sequence is shown as SEQ ID NO. 9;

the heavy chain constant region sequence is shown in SEQ ID NO 10.

4. An isolated nucleic acid molecule which is DNA or RNA encoding the binding protein of any one of claims 1 to 3.

5. A vector comprising the nucleic acid molecule of claim 4.

6. A host cell comprising the nucleic acid molecule of claim 4 or the vector of claim 5;

preferably, the host cell is a mammalian cell;

more preferably, the host cell is a Chinese Hamster Ovary (CHO) cell, a HeLa cell, a young hamster kidney cell, or an NS0 mouse myeloma cell.

7. A method of producing a binding protein according to any one of claims 1 to 3, comprising the steps of preparing a nucleic acid molecule according to claim 4 or a vector according to claim 5;

preferably comprising the steps of:

culturing the host cell of claim 6 under suitable culture conditions and recovering the binding protein so produced from the culture medium or from the cultured host cell.

8. A reagent or kit comprising the binding protein of any one of claims 1-3;

preferably, the reagent or kit further comprises one or more of a buffer, a stabilizer, a diluent or a carrier.

9. A method of detecting NT-proBNP in a test sample comprising:

a) contacting NT-proBNP antigen in the test sample with the binding protein of any one of claims 1-3 under suitable reaction conditions to form an immune complex;

b) detecting the presence of the immune complex.

Preferably, in step a), a second antibody is further included in the immune complex, the second antibody binding to the binding protein;

preferably, in step a), a second antibody is further included in the immune complex, said second antibody binding to the NT-proBNP antigen.

10. Use of a binding protein according to any one of claims 1 to 3 for the manufacture of a product for the detection of heart failure or for the assessment of heart function.