CN111217913A - anti-PG II antibody and application thereof - Google Patents

Abstract

The present invention relates to a novel isolated binding protein comprising a PGII antigen binding domain and studies on the preparation, use, etc. of the binding protein. The binding protein has strong activity and high affinity with human PGII protein, and can be widely applied to the field of detection of PGII protein.

Description

anti-PG II antibody and application thereof

Technical Field

The invention relates to the technical field of biotechnology and medicine, in particular to an anti-PG II antibody and application thereof.

Background

Pepsinogen (PG) is a precursor of pepsin in gastric juice, and the protein molecule is about 43KD and consists of 300 amino acids. According to the characteristics of biochemical and immunological activities, the two subgroups of PGI (also called PGA) and PG II (also called PGC) can be divided, pepsinogen A (PGA) is from the main cell of the gastric fundus gland and the cervical mucus cell, pepsinogen C (PGC) is from the whole gastric gland (gastric cardia gland, gastric fundus gland, gastric antrum pylorus gland) and distal duodenal Brunner gland, the prostate and pancreas also produce a small amount of PGC, the synthesized PGC of the gastric mucosa is about 25% of the total amount, the synthesized PG mostly enters the gastric cavity and is activated into pepsin under the action of acid gastric juice, only a small amount (about 1%) of PG enters the blood circulation through the capillary vessels of the gastric mucosa, and the entering amount is stable, so that the concentration of PG serum can reflect the secretion level of the gland of the gastric mucosa. Indirectly reflects the secretion function of different parts of the gastric mucosa. When pathological changes occur in the gastric mucosa, the PG content in the serum changes, which is called "serological biopsy" of the gastric mucosa.

The content of PGI in the blood of normal human is 60.6 +/-13.9 ng/ml; the content of PGII is 11.9 + -4.2 ng/ml, and the ratio of PGI/PG II is 5.52 + -1.86. Clinical studies at home and abroad indicate that PG II has a relatively large correlation with gastric fundus mucosa lesions, and the increase of PG II is related to atrophy of gastric fundus glandular tubes, intestinal metaplasia or pseudopyloric metaplasia and dysplasia. The PG II content determination is helpful for detecting duodenal ulcer, atrophic gastritis, gastric cancer and other digestive tract diseases, and meets the requirements of clinical detection and physical examination screening. In the screening of the stomach diseases of people, it is unrealistic that every person carries out gastroscopy, high risk people such as superficial gastritis, erosive gastritis, gastric ulcer, duodenal ulcer and gastric cancer can be screened out through non-invasive serum PG detection, and then the gastroscopy is a feasible scheme, the PGI/PGII ratio is one of the important indexes for screening the gastric cancer, and the PGII detection is used as a non-invasive method, so that the pain of patients can be reduced, and the method is simple, convenient and economical and has general investigation value.

Clinically, enzyme-linked immunosorbent assay (ELISA), chemiluminescence assay, flow fluorescence assay, time-resolved fluorescence immunoassay, light-activated chemiluminescence immunoassay, colloidal gold and the like are used for detecting horizontal PG II, and different methods have respective advantages and disadvantages, but specific monoclonal antibodies aiming at PG II are required.

At present, the monoclonal antibody for detecting PG II at home is basically purchased from foreign countries, and has defects in sensitivity and specificity.

In view of the above, the present invention is particularly proposed.

Disclosure of Invention

The invention relates to a novel separated binding protein containing a PG II antigen binding structural domain, which has obvious advantages in sensitivity and specificity compared with the existing PG II monoclonal antibody, and researches on the aspects of preparation, application and the like of the binding protein.

The antigen binding domain comprises at least one complementarity determining region selected from the group consisting of amino acid sequences set forth below, or a complementarity determining region having at least 80% sequence identity with the amino acid sequence set forth below and having K with PGII_D≤8.89×10^-8Affinity of mol/L;

CDR-VH1 is G-F-S-X1-T-X2-Y-G-X3-H, wherein,

x1 is L, I or V, X2 is T or S, X3 is I, V or L;

CDR-VH2 is I-W-R-X1-S-T-X2-Y-N-X3-A-F, wherein,

x1 is GG or N, X2 is E or D, X3 is A or P;

CDR-VH3 is V-K-X1-K-R-Y-X2-N-Y-D-A-M-X3-Y, wherein,

x1 is K or R, X2 is A or G, X3 is E or D;

the CDR-VL1 is T-A-S-S-S-X1-S-S-X2-Y-L-H, wherein,

x1 is I, V or L, X2 is S or T;

the complementarity determining region CDR-VL2 is S-T-X1-N-X2-A-S-X3-V-P, wherein,

x1 is S or T, X2 is I or L, X3 is G or A;

the complementarity determining region CDR-VL3 is H-X1-H-H-X2-S-P-X3-T, wherein,

x1 is N or Q, X2 is R or K, and X3 is I, V or L.

An important advantage is that the binding protein is highly active and has a high affinity for human PGII.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is an electrophoresis diagram of a monoclonal antibody of the recombinant antibody against human pepsinogen II of the present invention.

Detailed Description

The present invention may be understood more readily by reference to the following description of certain embodiments of the invention and the detailed description of the examples included therein.

Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such embodiments are necessarily varied. It is also to be understood that the terminology used in the description is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

Unless defined otherwise herein, scientific and technical terms used in connection with the present invention shall have the meanings that are commonly understood by one of ordinary skill in the art. The meaning and scope of a term should be clear, however, in the event of any potential ambiguity, the definition provided herein takes precedence over any dictionary or extrinsic definition. In this application, the use of "or" means "and/or" unless stated otherwise. Furthermore, the use of the term "including" and other forms is not limiting.

Generally, the nomenclature used, and the techniques thereof, in connection with the cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well known and commonly employed in the art. Unless otherwise indicated, the methods and techniques of the present invention are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. Enzymatic reactions and purification techniques are performed according to the manufacturer's instructions, as commonly practiced in the art, or as described herein. The nomenclature used in connection with the analytical chemistry, synthetic organic chemistry, and medical and pharmaceutical chemistry described herein, and the laboratory procedures and techniques thereof, are those well known and commonly employed in the art.

In order that the invention may be more readily understood, selected terms are defined below.

The term "amino acid" refers to naturally occurring or non-naturally occurring fusidic α -amino acids the term "amino acid" as used herein may include naturally occurring amino acids and non-naturally occurring amino acids including alanine (three letter code: A1a, one letter code: A), arginine (Arg, R), asparagine (Asn, N), aspartic acid (Asp, D), cysteine (Cys, c), glutamine (G1N, Q), glutamic acid (G1u, E), glycine (G1Y, G), histidine (His, H), isoleucine (I1E, I), leucine (Leu, L), lysine (Lys, K), methionine (Met, M), phenylalanine (Phe, F), proline (Pro, P), serine (Ser, S), threonine (Thr, T), tryptophan (Trp, W), tyrosine (Tyr, Y), and valine (Va1, V). non-naturally occurring amino acids include, but are not limited to α -amino acids, citrulline, homoserine (Tyr, histidine, etc.

The term "isolated binding protein" is a protein that, due to its derivative origin or source, does not bind to the naturally associated component with which it is associated in its native state; substantially free of other proteins from the same species; expressed by cells from different species; or do not occur in nature. Thus, a protein that is chemically synthesized or synthesized in a cellular system different from the cell from which it naturally originates will be "isolated" from the components with which it is naturally associated. Proteins can also be rendered substantially free of naturally associated components by isolation, using protein purification techniques well known in the art.

The term "isolated binding protein comprising an antigen binding domain" broadly refers to all proteins/protein fragments that comprise a CDR region. The term "antibody" includes polyclonal and monoclonal antibodies and antigenic compound-binding fragments of these antibodies, including Fab, F (ab') 2, Fd, Fv, scFv, diabodies and minimal recognition units of antibodies, as well as single chain derivatives of these antibodies and fragments. The type of antibody can be selected from IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD. Furthermore, the term "antibody" includes naturally occurring antibodies as well as non-naturally occurring antibodies, including, for example, chimeric (chimeric), bifunctional (bifunctional) and humanized (humanized) antibodies, as well as related synthetic isomeric forms (isoforms). The term "antibody" is used interchangeably with "immunoglobulin".

The "variable region" or "variable domain" of an antibody refers to the amino-terminal domain of the heavy or light chain of the antibody. The variable domain of the heavy chain may be referred to as "VH". The variable domain of the light chain may be referred to as "VL". These domains are usually the most variable parts of an antibody and contain an antigen binding site. The light or heavy chain variable region is made up of framework regions interrupted by three hypervariable regions, termed "complementarity determining regions" or "CDRs". The framework regions of the antibody, which constitute the combination of the essential light and heavy chains, serve to locate and align the CDRs, which are primarily responsible for binding to the antigen.

As used herein, the "framework" or "FR" regions mean the regions of the antibody variable domain excluding those defined as CDRs. Each antibody variable domain framework can be further subdivided into adjacent regions separated by CDRs (FR1, FR2, FR3 and FR 4).

Typically, the variable domains VL/VH of the heavy and light chains are obtained by linking the CDRs and FRs numbered as follows in a combinatorial arrangement: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR 4.

As used herein, the term "purified" or "isolated" in relation to a polypeptide or nucleic acid means that the polypeptide or nucleic acid is not in its native medium or native form. Thus, the term "isolated" includes a polypeptide or nucleic acid that is removed from its original environment, e.g., from its natural environment if it is naturally occurring. For example, an isolated polypeptide is generally free of at least some proteins or other cellular components that are normally bound to or normally mixed with it or in solution. Isolated polypeptides include the naturally-produced polypeptide contained in a cell lysate, the polypeptide in purified or partially purified form, recombinant polypeptides, the polypeptide expressed or secreted by a cell, and the polypeptide in a heterologous host cell or culture. In connection with a nucleic acid, the term isolated or purified indicates, for example, that the nucleic acid is not in its natural genomic context (e.g., in a vector, as an expression cassette, linked to a promoter, or artificially introduced into a heterologous host cell).

The invention provides an isolated binding protein comprising an antigen binding domain comprising at least one complementarity determining region selected from the group consisting of amino acid sequences set forth below, or an amino acid sequence having at least 80% sequence identity with a complementarity determining region of the amino acid sequence set forth below and having a K with PGII_D≤8.89×10^-8Affinity of mol/L;

CDR-VH1 is G-F-S-X1-T-X2-Y-G-X3-H, wherein,

x1 is L, I or V, X2 is T or S, X3 is I, V or L;

CDR-VH2 is I-W-R-X1-S-T-X2-Y-N-X3-A-F, wherein,

x1 is GG or N, X2 is E or D, X3 is A or P;

CDR-VH3 is V-K-X1-K-R-Y-X2-N-Y-D-A-M-X3-Y, wherein,

x1 is K or R, X2 is A or G, X3 is E or D;

the CDR-VL1 is T-A-S-S-S-X1-S-S-X2-Y-L-H, wherein,

x1 is I, V or L, X2 is S or T;

the complementarity determining region CDR-VL2 is S-T-X1-N-X2-A-S-X3-V-P, wherein,

x1 is S or T, X2 is I or L, X3 is G or A;

the complementarity determining region CDR-VL3 is H-X1-H-H-X2-S-P-X3-T, wherein,

x1 is N or Q, X2 is R or K, and X3 is I, V or L.

It is well known in the art that both the binding specificity and avidity of an antibody are determined primarily by the CDR sequences, and that variants with similar biological activity can be obtained by readily altering the amino acid sequence of the non-CDR regions according to well-established, well-known techniques of the art. Thus, the invention also includes "functional derivatives" of the binding proteins. "functional derivative" refers to a variant of an amino acid substitution, one functional derivative retaining detectable binding protein activity, preferably the activity of an antibody capable of binding PGII. "functional derivatives" may include "variants" and "fragments" which have the exact same CDR sequences as the binding proteins of the invention and therefore have similar biological activities.

In some embodiments, the antigen binding domain has at least 85%, or 90%, or 91%, or 92%, or 93%, or 94%, or 95%, or 96%, or 97%, or 98%, or 99% sequence identity to the complementarity determining region of the amino acid sequence having a KD of 8.89 x 10 to pepsinogen II^-8mol/L, KD value can also be selected from 8.56X 10^{- 8}mol/L、6.27×10^-8mol/L、2.34×10^-8mol/L、1.73×10^-9mol/L、2.63×10^-9mol/L、4.66×10^{- 9}mol/L、9.52×10^-9mol/L、7.26×10^-9mol/L、1.98×10^-10mol/L、2.75×10^-10mol/L、8.01×10^-10mol/L、9.50×10^-10mol/L, or 1.98X 10^-10mol/L≤KD≤8.89×10^-8mol/L, or 1.98X 10^-10mol/L≤KD≤9.52×10^-9mol/L。

Wherein the affinity is determined according to the method of the present specification.

In some embodiments of the present invention, the substrate is,

in the complementarity determining region CDR-VH1, X2 is S;

in the complementarity determining region CDR-VH2, X2 is D;

in the complementarity determining region CDR-VH3, X2 is G;

in the complementarity determining region CDR-VL1, X2 is S;

in the complementarity determining region CDR-VL2, X3 is G;

in the complementarity determining region CDR-VL3, X1 is Q.

In some embodiments, in the complementarity determining region CDR-VH1, X1 is L and X3 is I.

In some embodiments, in the complementarity determining region CDR-VH1, X1 is L and X3 is V.

In some embodiments, in the complementarity determining region CDR-VH1, X1 is L and X3 is L.

In some embodiments, in the complementarity determining region CDR-VH1, X1 is I and X3 is I.

In some embodiments, in the complementarity determining region CDR-VH1, X1 is I and X3 is V.

In some embodiments, in the complementarity determining region CDR-VH1, X1 is I and X3 is L.

In some embodiments, in the complementarity determining region CDR-VH1, X1 is V and X3 is I.

In some embodiments, in the complementarity determining region CDR-VH1, X1 is V and X3 is V.

In some embodiments, in the complementarity determining region CDR-VH1, X1 is V and X3 is L.

In some embodiments, in the complementarity determining region CDR-VH2, X1 is GG and X3 is a.

In some embodiments, in the complementarity determining region CDR-VH2, X1 is GG and X3 is P.

In some embodiments, in the complementarity determining region CDR-VH2, X1 is N and X3 is a.

In some embodiments, in the complementarity determining region CDR-VH2, X1 is N and X3 is P.

In some embodiments, in the complementarity determining region CDR-VH3, X1 is K and X3 is E.

In some embodiments, in the complementarity determining region CDR-VH3, X1 is K and X2 is D.

In some embodiments, in the complementarity determining region CDR-VH3, X1 is R and X3 is E.

In some embodiments, in the complementarity determining region CDR-VH3, X1 is R and X2 is D.

In some embodiments, in the complementarity determining region CDR-VL1, X1 is I.

In some embodiments, in the complementarity determining region CDR-VL1, X1 is V.

In some embodiments, in the complementarity determining region CDR-VL1, X1 is L.

In some embodiments, in the complementarity determining region CDR-VL2, X1 is S and X2 is L.

In some embodiments, in the complementarity determining region CDR-VL2, X1 is S and X2 is I.

In some embodiments, in the complementarity determining region CDR-VL2, X1 is T and X2 is L.

In some embodiments, in the complementarity determining region CDR-VL2, X1 is T and X2 is I.

In some embodiments, in the complementarity determining region CDR-VL3, X2 is R and X3 is I.

In some embodiments, in the complementarity determining region CDR-VL3, X2 is R and X3 is V.

In some embodiments, in the complementarity determining region CDR-VL3, X2 is R and X3 is L.

In some embodiments, in the complementarity determining region CDR-VL3, X2 is K and X3 is I.

In some embodiments, in the complementarity determining region CDR-VL3, X2 is K and X3 is V.

In some embodiments, in the complementarity determining region CDR-VL3, X2 is K and X3 is L.

In some embodiments, the mutation site of each complementarity determining region is selected from any one of the following combinations of mutations:

in some embodiments, the binding protein includes at least 3 CDRs therein; alternatively, the binding protein comprises at least 6 CDRs.

In some embodiments, the binding protein is a whole antibody comprising a variable region and a constant region.

In some embodiments, the binding protein is one of a nanobody, a F (ab ') 2, a Fab', a Fab, a Fv, a scFv, a diabody, and an antibody minimal recognition unit.

In some embodiments, the binding protein comprises light chain framework regions FR-L1, FR-L2, FR-L3 and FR-L4 in the sequence shown in SEQ ID NOS: 1-4, and/or heavy chain framework regions FR-H1, FR-H2, FR-H3 and FR-H4 in the sequence shown in SEQ ID NOS: 5-8.

In some embodiments, the binding protein further comprises an antibody constant region sequence.

In some embodiments, the constant region sequence is selected from the group consisting of sequences of any one of the constant regions of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD.

In some embodiments, the species of the constant region is derived from a cow, horse, dairy cow, pig, sheep, goat, rat, mouse, dog, cat, rabbit, camel, donkey, deer, mink, chicken, duck, goose, turkey, chicken fighting, or human.

In some embodiments, the constant region is derived from a mouse;

the light chain constant region sequence is shown as SEQ ID NO. 9;

the heavy chain constant region sequence is shown in SEQ ID NO 10.

The invention also provides an isolated nucleic acid encoding the binding protein described above.

Herein, a nucleic acid comprises conservatively substituted variants thereof (e.g., substitution of degenerate codons) and complementary sequences. The terms "nucleic acid" and "polynucleotide" are synonymous and encompass genes, cDNA molecules, mRNA molecules, and fragments thereof such as oligonucleotides.

The invention also provides a vector comprising the nucleic acid as described above.

Wherein the nucleic acid sequence is operably linked to at least one regulatory sequence. "operably linked" means that the coding sequence is linked to the regulatory sequences in a manner that allows for expression of the coding sequence. Regulatory sequences are selected to direct the expression of the protein of interest in a suitable host cell and include promoters, enhancers and other expression control elements.

Herein, a vector may refer to a molecule or agent comprising a nucleic acid of the invention or a fragment thereof, capable of carrying genetic information and capable of delivering the genetic information into a cell. Typical vectors include plasmids, viruses, bacteriophages, cosmids and minichromosomes. The vector may be a cloning vector (i.e., a vector for transferring genetic information into a cell, which may be propagated and in which the genetic information may be present or absent) or an expression vector (i.e., a vector which comprises the necessary genetic elements to permit expression of the genetic information of the vector in a cell). Thus, a cloning vector may contain a selectable marker, as well as an origin of replication compatible with the cell type specified by the cloning vector, while an expression vector contains the regulatory elements necessary to effect expression in a specified target cell.

The nucleic acid of the invention or fragments thereof may be inserted into a suitable vector to form a cloning or expression vector carrying the nucleic acid fragment of the invention. Such novel vectors are also part of the present invention. The vector may comprise a plasmid, phage, cosmid, minichromosome, or virus, as well as naked DNA that is transiently expressed only in a particular cell. The cloning and expression vectors of the invention are capable of autonomous replication and thus provide high copy numbers for high level expression or high level replication purposes for subsequent cloning. The expression vector may comprise a promoter for driving expression of the nucleic acid fragment of the invention, optionally a nucleic acid sequence encoding a signal peptide for secretion or integration of the peptide expression product into a membrane, a nucleic acid fragment of the invention, and optionally a nucleic acid sequence encoding a terminator. When the expression vector is manipulated in a production strain or cell line, the vector, when introduced into a host cell, may or may not be integrated into the genome of the host cell. Vectors typically carry a replication site, as well as a marker sequence capable of providing phenotypic selection in transformed cells.

The expression vectors of the invention are useful for transforming host cells. Such transformed cells are also part of the invention and may be cultured cells or cell lines for propagation of the nucleic acid fragments and vectors of the invention, or for recombinant production of the polypeptides of the invention. The transformed cells of the present invention include microorganisms such as bacteria (e.g., Escherichia coli, Bacillus spp., etc.). Host cells also include cells from multicellular organisms such as fungi, insect cells, plant cells or mammalian cells, preferably from mammals, e.g., CHO cells. The transformed cells are capable of replicating the nucleic acid fragments of the invention. When the peptide combination of the present invention is recombinantly produced, the expression product may be exported into the culture medium or carried on the surface of the transformed cell.

The invention also provides a method for producing the binding protein, which comprises the following steps:

the above-mentioned host cells are cultured in a medium, and the produced binding protein is recovered from the medium or from the cultured host cells.

The method can be, for example, transfecting a host cell with a nucleic acid vector encoding at least a portion of the binding protein, and culturing the host cell under suitable conditions such that the binding protein is expressed. The host cell may also be transfected with one or more expression vectors, which may comprise, alone or in combination, DNA encoding at least a portion of the binding protein. The bound protein may be isolated from the culture medium or cell lysate using conventional techniques for purifying proteins and peptides, including ammonium sulfate precipitation, chromatography (e.g., ion exchange, gel filtration, affinity chromatography, etc.), and/or electrophoresis.

Construction of suitable vectors containing the coding and regulatory sequences of interest can be carried out using standard ligation and restriction techniques well known in the art. The isolated plasmid, DNA sequence or synthetic oligonucleotide is cleaved, tailed and religated as desired. Any method may be used to introduce mutations into the coding sequence to produce variants of the invention, and these mutations may comprise deletions or insertions or substitutions or the like.

The invention also provides antibodies, reactive with epitopes of PGII, including monoclonal and polyclonal antibodies. The antibody may comprise the entire binding protein, or a fragment or derivative thereof. Preferred antibodies contain all or part of a binding protein.

The invention also provides the application of the binding protein in preparing a diagnostic agent or a kit for diagnosing superficial gastritis, erosive gastritis, atrophic gastritis, gastric ulcer, duodenal ulcer and gastric cancer.

The invention also provides a kit comprising one or more of the binding protein described above, the isolated nucleic acid described above, or the vector described above.

Preferably, the kit further comprises a label for labeling the binding protein.

According to one aspect of the invention, the invention also relates to a method for detecting the pepsinogen II antigen in a test sample, comprising:

a) contacting the pepsinogen ii antigen in the test sample with a binding protein as defined above under conditions sufficient for an antibody/antigen binding reaction to occur to form an immune complex; and

b) detecting the presence of said immune complex, the presence of said complex being indicative of the presence of said pepsinogen II antigen in said test sample;

in this embodiment, the binding protein may be labeled with an indicator that indicates the strength of the signal, so that the complex is readily detected.

In some embodiments, in step a), a second antibody is further included in the immune complex, the second antibody binding to the binding protein;

in this embodiment, the binding protein is in the form of a first antibody that forms a partner antibody with the second antibody for binding to a different epitope of PGII;

the second antibody may be labeled with an indicator showing the intensity of the signal so that the complex is easily detected.

In some embodiments, in step a), a second antibody is further included in the immune complex, the second antibody binding to the pepsinogen ii antigen;

in this embodiment, the binding protein serves as an antigen for the second antibody, which may be labeled with an indicator of signal intensity to allow the complex to be readily detected.

In some embodiments, the indicator that shows signal intensity comprises any one of a fluorescent substance, a quantum dot, a digoxigenin-labeled probe, biotin, a radioisotope, a radiocontrast agent, a paramagnetic ion fluorescent microsphere, an electron-dense substance, a chemiluminescent label, an ultrasound contrast agent, a photosensitizer, colloidal gold, or an enzyme.

In some embodiments, the fluorescent species include Alexa 350, Alexa 405, Alexa 430, Alexa488, Alexa 555, Alexa 647, AMCA, aminoacridine, BODIPY 630/650, BODIPY 650/665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, 5-carboxy-4 ', 5' -dichloro-2 ', 7' -dimethoxyfluorescein, 5-carboxy-2 ', 4', 5', 7' -tetrachlorofluorescein, 5-carboxyfluorescein, 5-carboxyrhodamine, 6-carboxytetramethylrhodamine, Cascade Blue, Cy2, Cy3, Cy5, Cy7, 6-FAM, dansyl chloride, fluorescein, HEX, 6-JOE, NBD (7-nitrobenz-2-oxa-1, 3-diazole), Any one of Oregon Green 488, Oregon Green 500, Oregon Green514, Pacific Blue, phthalic acid, terephthalic acid, isophthalic acid, cresol fast violet, cresol Blue violet, brilliant cresol Blue, p-aminobenzoic acid, erythrosine, phthalocyanine, azomethine, cyanine, xanthine, succinyl fluorescein, rare earth metal cryptate, europium tripyridyldiamine, europium cryptate or chelate, diamine, bispyanine, La Jolla Blue dye, allophycocyanin, allocyanonin B, phycocyanin C, phycocyanin R, thiamine, phycoerythrin R, REG, rhodamine Green, rhodamine isothiocyanate, rhodamine red, ROX, TAMRA, TET, TRIT (tetramethylrhodamine isothiol), tetramethylrhodamine, and Texas red.

In some embodiments, the radioisotope comprises¹¹⁰In、¹¹¹In、¹⁷⁷Lu、¹⁸F、⁵²Fe、⁶²Cu、⁶⁴Cu、⁶⁷Cu、⁶⁷Ga、⁶⁸Ga、⁸⁶Y、⁹⁰Y、⁸⁹Zr、⁹⁴mTc、⁹⁴Tc、⁹⁹mTc、¹²⁰I、¹²³I、¹²⁴I、¹²⁵I、¹³¹I、^154-158Gd、³²P、¹¹C、¹³N、¹⁵O、¹⁸⁶Re、¹⁸⁸Re、⁵¹Mn、⁵²mMn、⁵⁵Co、⁷²As、⁷⁵Br、⁷⁶Br、⁸²mRb and⁸³sr.

In some embodiments, the enzyme comprises any one of horseradish peroxidase, alkaline phosphatase, and glucose oxidase.

In some embodiments, the fluorescent microspheres are: the polystyrene fluorescent microsphere is internally wrapped with rare earth fluorescent ion europium.

As some embodiments, the present invention provides kits for determining the presence of pepsinogen ii in a subject, e.g., erosive gastritis, comprising at least one binding protein provided herein, associated buffers, reagents required for reacting a liquid sample with the binding protein, and reagents for determining the presence of a positive or negative binding reaction between pepsinogen ii and the binding protein. For determining the presence of pepsinogen II, the kit may, for example, utilize a binding protein as an antibody with a label, wherein the label may be any suitable label, such as a colloidal gold label.

The following examples are provided to illustrate the present invention, but not to limit the scope of the present invention.

Example 1

Restriction enzyme, Prime Star DNA polymerase, was purchased from Takara in this example. MagExtractor-RNA extraction kit was purchased from TOYOBO. BD SMART^TMThe RACE cDNAamplification Kit was purchased from Takara. pMD-18T vector was purchased from Takara. Plasmid extraction kits were purchased from Tiangen corporation. Primer synthesis and gene sequencing were performed by Invitrogen corporation. The hybridoma cell strain secreting Anti-HPGII-8F9 monoclonal antibody is the existing hybridoma cell strain of the applicant, and is recovered for later use.

1. Primer and method for producing the same

Amplification of Heavy Chain and Light Chain 5' RACE primers:

SMARTER II AOligonucleotide：

5’-AAGCAGTGGTATCAACGCAGAGTACXXXXX-3’；

5'-RACE CDS Primer(5'-CDS)：5'-(T)₂₅VN-3’(N＝A,C,G,orT；V＝A,G,orC)；

Universal Primer AMix(UPM)：5’-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT-3’；

Nested Universal Primer A(NUP)：5’-AAGCAGTGGTATCAACGCAGAGT-3’；

mIg-KR：5’-CTAACACTCATTCCTGTTGAAGCTCTTGACAAT-3’；

mIg-HR：5’-TCATTTACCAGGAGAGTGGGAGAGGC-3’。

2. antibody variable region gene cloning and sequencing

RNA is extracted from hybridoma cell strains secreting Anti-HPGII-8F9 monoclonal antibody, SMARTER II A Oligopuleotide and 5' -CDS primers in an SMARTERTMRACE cDNAAmplification Kit kit and the kit are used for first strand cDNA synthesis, the obtained first strand cDNA product is used as a PCR amplification template, Light Chain genes are amplified by Universal Primer A Mix (UPM), Nested Universal Primer A (NUP) and mIg-KR primers, the Heavy Chain gene is amplified by Universal Primer A Mix (UPM), Nested Universal Primer A (NUP) and mIg-HR primers, the target band of the Heavy Chain gene is amplified by the Light Chain Primer about 0.8KB, the target band of the Heavy Chain gene is amplified by the Heavy Chain Primer about 1.4KB, the target band is purified and recovered by agarose gel electrophoresis, the product is inserted into a cell strain of a Chart 18 KB DNA polymerase after the reaction of the Light Chain DNA polymerase, and clone cells are cloned into a vector of a HevIgDH 5 α, and the clone is detected after the Invitrogen DNA is amplified.

3. Sequence analysis of Anti-HPGII-8F9 antibody variable region Gene

Putting the gene sequence obtained by sequencing in an IMGT antibody database for analysis, and analyzing by using VNTI11.5 software to determine that the genes amplified by the heavy Chain primer pair and the Light Chain primer pair are correct, wherein in the gene fragment amplified by the Light Chain, the VL gene sequence is 342bp, belongs to VkII gene family, and a leader peptide sequence of 57bp is arranged in front of the VL gene sequence; in the gene fragment amplified by the HeavyChain primer pair, the VH gene sequence is 357bp, belongs to a VH1 gene family, and has a leader peptide sequence of 57bp in front.

4. Construction of recombinant antibody expression plasmid

pcDNA^TM3.4

vector is a constructed recombinant antibody eukaryotic expression vector, and multiple cloning enzyme cutting sites such as HindIII, BamHI, EcoRI and the like are introduced into the expression vector and named as a pcDNA 3.4A expression vector, and the expression vector is called as a 3.4A expression vector for short in the following; according to the sequencing result of the antibody variable region gene in the pMD-18T, VL and VH gene specific primers of the Anti-HPGII-8F9 antibody are designed, wherein two ends of the primers are respectively provided with HindIII and EcoRI enzyme cutting sites and protective bases, and the primers are as follows:

HPGII-8F9-HF：

5’>CCCAAGCTTATGGAATGCAGCTGTGTCATGCTCTTCTTC<3’；

HPGII-8F9-HR:

5’>CCCGAATTCTCATTTACCAGGAGAGTGGGAGAGGC<3’；

HPGII-8F9-LF:

5’>CCCAAGCTTATGAAGTTGCCTGTTAGGCTGTTGG<3’；

HPGII-8F9-LR:

5’>CCCGAATTCCTAACACTCATTCCTGTTGAAGCTCTTGACAA<3’。

a0.75 KB Light Chain gene fragment and a 1.42KB Heavy Chain gene fragment were amplified by PCR amplification. The gene fragments of the Heavy Chain and the Light Chain are subjected to double enzyme digestion by HindIII/EcoRI respectively, the 3.4A vector is subjected to double enzyme digestion by HindIII/EcoRI, the Heavy Chain gene and the Light Chain gene are respectively connected into the 3.4A expression vector after the fragments and the vector are purified and recovered, and recombinant expression plasmids of the Heavy Chain and the Light Chain are respectively obtained.

5. Screening for Stable cell lines

5.1 transient transfection of recombinant antibody expression plasmids into CHO cells, determination of expression plasmid Activity

Plasmid was diluted to 400ng/ml with ultrapure water and CHO cells were conditioned at 1.43X 10⁷cells/ml are put into a centrifuge tube, 100 mul of plasmid is mixed with 700 mul of cells, the mixture is transferred into an electric rotating cup and is electrically rotated, the sampling counting is carried out on 3 rd, 5 th and 7 th days, and the sampling detection is carried out on 7 th day.

The coating solution diluted PGII protein (fitzgerald,30R-AP039) to the indicated concentration, 100. mu.L per well, 4 ℃ overnight; the next day, washing with the washing solution for 2 times, and patting dry; adding blocking solution (20% BSA + 80% PBS), and drying at 37 deg.C for 1 hr in each well; adding diluted cell supernatant at 100 μ L/well, 37 deg.C for 30min (partial supernatant for 1 h); washing with washing solution for 5 times, and drying; adding goat anti-mouse IgG-HRP (goat anti-mouse IgG-HRP) with the concentration of 100 mu L per well at 37 ℃ for 30 min; washing with washing solution for 5 times, and drying; adding a developing solution A (50 muL/hole), adding a developing solution B (50 muL/hole), and keeping for 10 min; adding stop solution into the mixture, wherein the concentration of the stop solution is 50 mu L/hole; OD readings were taken at 450nm (reference 630nm) on the microplate reader. The results showed that the OD of the reaction after the cell supernatant was diluted 1000 times was still greater than 1.0, and the OD of the reaction without the cell supernatant was less than 0.1, indicating that the antibodies generated after the plasmid transient transformation were all active against PG II protein.

5.2 linearization of recombinant antibody expression plasmids

The following reagents were prepared: 50 mul Buffer, 100 mul DNA/tube, 10 mul Puv I enzyme, and sterile water to 500 mul, water bath enzyme digestion overnight at 37 ℃; sequentially extracting with equal volume of phenol/chloroform/isoamyl alcohol (lower layer) 25:24:1 and then chloroform (water phase); precipitating with 0.1 volume (water phase) of 3M sodium acetate and 2 volumes of ethanol on ice, rinsing with 70% ethanol, removing organic solvent, re-melting with appropriate amount of sterilized water after ethanol is completely volatilized, and finally measuring concentration.

5.3 recombinant antibody expression plasmid stable transfection, pressurized screening of stable cell lines:

plasmid was diluted to 400ng/ml with ultrapure water and CHO cells were conditioned at 1.43X 10⁷cells/ml are put into a centrifuge tube, 100 mul of plasmid is mixed with 700 mul of cells, and the mixture is transferred into an electric rotating cup and is electrically rotated, and the next day is counted; 25 u mol/L MSX 96 hole pressure culture about 25 days.

Observing the marked clone holes with cells under a microscope, and recording the confluence degree; taking culture supernatant, and sending the culture supernatant to a sample for detection; selecting cell strains with high antibody concentration and relative concentration, transferring the cell strains into 24 holes, and transferring the cell strains into 6 holes after 3 days; after 3 days, the seeds were kept and cultured in batches, and the cell density was adjusted to 0.5X 10⁶cells/ml, 2.2ml, cell density 0.3X 10⁶cell/ml, 2ml for seed preservation; and (4) 7 days, carrying out batch culture supernatant sample sending detection in 6 holes, and selecting cell strains with small antibody concentration and cell diameter to transfer TPP for seed preservation and passage.

6. Production of recombinant antibodies

6.1 cell expansion culture

After the cells are recovered, the cells are cultured in a shaking flask with the specification of 125ml, the inoculation volume is 30ml, the culture medium is 100% Dynamis culture medium, and the cells are placed in a shaking table with the rotation speed of 120r/min, the temperature of 37 ℃ and the carbon dioxide of 8%. Culturing for 72h, inoculating and expanding culture at an inoculation density of 50 ten thousand cells/ml, wherein the expanding culture volume is calculated according to production requirements, and the culture medium is 100% Dynamis culture medium. Then the culture is expanded every 72 h. When the cell amount meets the production requirement, the production is carried out by strictly controlling the inoculation density to be about 50 ten thousand cells/ml.

6.2 Shake flask production and purification

Shake flask parameters: the rotating speed is 120r/min, the temperature is 37 ℃, and the carbon dioxide is 8 percent. Feeding in a flowing mode: daily feeding was started when the culture was carried out for 72h in a shake flask, 3% of the initial culture volume was fed daily to HyCloneTM Cell BoostTM Feed 7a, and one thousandth of the initial culture volume was fed daily to Feed 7b, up to day 12 (day 12 feeding). Glucose was supplemented with 3g/L on the sixth day. Samples were collected on day 13. Affinity purification was performed using a proteinA affinity column. Mu.g of the purified antibody was subjected to reducing SDS-PAGE, and 4. mu.g of an external control antibody was used as a control, and the electrophoretogram was shown in FIG. 1. After reducing SDS-PAGE, two bands were shown, one of which was a light chain of about 25kD (SEQ ID NO: 11) and the other was a heavy chain of about 50kD (SEQ ID NO: 12).

Example 2

Although the antibody obtained in example 1 (having the light and heavy chains having the sequences shown in SEQ ID NOS: 11 and 12) has the ability to bind to PGII protein, neither affinity nor antibody activity is satisfactory, and therefore, the applicants have mutated the light and heavy chain CDRs of the antibody.

Upon analysis, the complementarity determining region (WT) of the heavy chain:

CDR-VH1 is G-F-S-I (X1) -T-T (X2) -Y-G-I (X3) -H;

CDR-VH2 is I-W-R-N (X1) -S-T-E (X2) -Y-N-P (X3) -A-F;

CDR-VH3 is V-K-R (X1) -K-R-Y-A (X2) -N-Y-D-A-M-E (X3) -Y;

complementarity determining regions of the light chain:

CDR-VL1 is T-A-S-S-S-I (X1) -S-S-T (X2) -Y-L-H;

CDR-VL2 is S-T-T (X1) -N-I (X2) -A-S-A (X3) -V-P;

CDR-VL3 is H-N (X1) -H-H-K (X2) -S-P-I (X3) -T;

wherein, X1, X2 and X3 are all mutation sites.

TABLE 1 mutant sites associated with antibody Activity

Detecting the activity of the antibody after mutation, diluting HPGII (fitzgerald,30R-AP039) to 3 mu g/ml by using a coating solution, coating the HPGII by using a microplate, wherein each well is 100 mu L, and the temperature is kept overnight at 4 ℃; the next day, washing with the washing solution for 2 times, and patting dry; adding blocking solution (20% BSA + 80% PBS), and drying at 37 deg.C for 1 hr in each well; adding diluted HPGII monoclonal antibody at 100. mu.L/well, 37 ℃ for 30min (partial supernatant for 1 h); washing with washing solution for 5 times, and drying; adding goat anti-mouse IgG-HRP (goat anti-mouse IgG-HRP) with the concentration of 100 mu L per well at 37 ℃ for 30 min; washing with washing solution for 5 times, and drying; adding a developing solution A (50 muL/hole), adding a developing solution B (50 muL/hole), and keeping for 10 min; adding stop solution into the mixture, wherein the concentration of the stop solution is 50 mu L/hole; OD readings were taken at 450nm (reference 630nm) on the microplate reader.

Some of the results are as follows:

TABLE 2 antibody Activity assay data

Concentration (μ g/ml)	WT	Mutation 1	Mutation 2	Mutation 3	Mutation 4	Mutation 5
							30	0.987	1.125	1.024	0.642	0.657	0.589
10	0.782	0.892	0.811	0.387	0.324	0.272
							3.333	0.459	0.536	0.513	0.207	0.187	0.042
1.111	0.270	0.390	0.310	0.035	0.037	-
							0.370	0.220	0.290	0.274	-	-	-
0	0.031	0.039	0.041	-	-	-

"-" indicates no activity.

Affinity assay

Using AMC sensors, purified antibodies were diluted to 10. mu.g/ml with PBST, and HPGII (fitzgerald,30R-AP039) was gradient diluted with PBST: 888.9nmol/ml, 444.4nmol/ml, 222.2nmol/ml, 111.1nmol/ml, 55.6nmol/ml, 27.8nmol/ml, 13.9nmol/ml, 0 nmol/ml.

The operation flow is as follows: equilibrating in buffer 1(PBST) for 60s, immobilizing antibody in antibody solution for 300s, incubating in buffer 2(PBST) for 180s, binding in antigen solution for 420s, dissociating in buffer 2 for 1200s, regenerating the sensor with 10mM GLY solution pH 1.69 and buffer 3, and outputting the data. KD represents the equilibrium solvophilic constant, i.e. affinity; kon denotes the binding rate; kdis denotes the off-rate.

Table 3 affinity assay data

Different mutations	KD(M)	Kon(1/Ms)	Kdis(1/S)
				WT	8.89E-08	1.55E+04	1.38E-03
Mutation 1	7.74E-09	3.12E+04	2.42E-04
				Mutation 2	4.71E-09	2.76E+04	1.30E-04
Mutation 3	5.03E-07	1.22E+04	6.14E-03
				Mutation 4	2.94E-07	3.04E+04	8.93E-03
Mutation 5	7.05E-07	1.93E+03	1.36E-03

As can be seen from tables 2 and 3, the activity effect and affinity of mutation 1 are the best, so that mutation sites with better potency are screened by using mutation 1 as a framework sequence (ensuring that the activity of the antibody obtained by screening is similar to that of mutation 1, and the antibody activity is +/-10%), and partial results are as follows.

TABLE 4 mutation sites related to antibody affinity

Affinity analysis, methods as above, results are shown in table 5.

Table 5 affinity assay data

As can be seen from table 5, the mutation sites listed in table 4 have little effect on the affinity of the antibody.

To verify the above results, the above experiment was repeated using WT as a backbone sequence, and affinity verification of the mutation site was performed, and some results are as follows.

TABLE 6 mutations with WT as backbone

Table 7 affinity assay data

From the analyses of tables 6 and 7, the affinity of the antibody was not greatly affected by the mutation sites listed in table 6.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.

SEQUENCE LISTING

<110> Dongguan City of Pengzhi Biotech Co., Ltd

<120> anti-PG II antibody and application thereof

<130>2010

<160>12

<170>PatentIn version 3.3

<210>1

<211>23

<212>PRT

<213>Mus musculus

<400>1

Gln Ile Val Leu Thr Gln Ser Pro Glu Ile Met Ser Ala Ser Leu Gly

1 5 10 15

Glu Arg Val Thr Met Thr Cys

20

<210>2

<211>15

<212>PRT

<213>Mus musculus

<400>2

Trp Tyr Gln Gln Lys Pro Gly Ser Ser Pro Lys Leu Trp Ile Tyr

1 5 1015

<210>3

<211>29

<212>PRT

<213>Mus musculus

<400>3

Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile

1 5 10 15

Ser Ser Met Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys

20 25

<210>4

<211>10

<212>PRT

<213>Mus musculus

<400>4

Phe Gly Ala Gly Thr Lys Leu Glu Val Lys

1 5 10

<210>5

<211>25

<212>PRT

<213>Mus musculus

<400>5

Gln Val Gln Leu Lys Gln Ser Gly Pro Ser Leu Val Gln Pro Ser Gln

1 5 10 15

Ser Leu Ser Ile Thr Cys Thr Val Ser

20 25

<210>6

<211>15

<212>PRT

<213>Mus musculus

<400>6

Trp Val Arg Gln Ser Pro Gly Lys Gly Leu Glu Trp Leu Gly Val

1 5 10 15

<210>7

<211>32

<212>PRT

<213>Mus musculus

<400>7

Met Ser Arg Leu Ser Ile Thr Lys Asp Asn Ser Lys Ser Gln Val Phe

1 5 10 15

Phe Lys Met Asn Ser Leu Gln Ala Asp Asp Thr Ala Ile Tyr Tyr Cys

20 25 30

<210>8

<211>11

<212>PRT

<213>Mus musculus

<400>8

Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser

1 5 10

<210>9

<211>107

<212>PRT

<213>Mus musculus

<400>9

Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu

1 5 10 15

Gln Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe

20 25 30

Tyr Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg

35 40 45

Gln Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser

50 55 60

Thr Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu

65 70 75 80

Arg His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser

85 90 95

Pro Ile Val Lys Ser Phe Asn Arg Asn Glu Cys

100 105

<210>10

<211>324

<212>PRT

<213>Mus musculus

<400>10

Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Ser Ala

1 5 10 15

Ala Gln Thr Asn Ser Met Val Thr Leu Gly Cys Leu Val Lys Gly Tyr

20 25 30

Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ser Leu Ser Ser

35 40 45

Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Asp LeuTyr Thr Leu

50 55 60

Ser Ser Ser Val Thr Val Pro Ser Ser Thr Trp Pro Ser Gln Thr Val

65 70 75 80

Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Lys

85 90 95

Ile Val Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro

100 105 110

Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu

115 120 125

Thr Ile Thr Leu Thr Pro Lys Val Thr Cys Val Val Val Asp Ile Ser

130 135 140

Lys Asp Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu

145 150 155 160

Val His Thr Ala Gln Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr

165 170 175

Phe Arg Ser Val Ser Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn

180 185 190

Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro

195 200 205

Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala Pro Gln

210 215 220

Val Tyr Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val

225 230 235 240

Ser Leu Thr Cys Met Ile Thr Asn Phe Phe Pro Glu Asp Ile Thr Val

245 250 255

Glu Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln

260 265 270

Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn

275 280 285

Val Gln Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val

290 295 300

Leu His Glu Gly Leu His Asn His His Thr Glu Lys Ser Leu Ser His

305 310 315 320

Ser Pro Gly Lys

<210>11

<211>215

<212>PRT

<213>Mus musculus

<400>11

Gln Ile Val Leu Thr Gln Ser Pro Glu Ile Met Ser Ala Ser Leu Gly

1 5 10 15

Glu Arg Val Thr Met Thr Cys Thr Ala Ser Ser Ser Ile Ser Ser Thr

2025 30

Tyr Leu His Trp Tyr Gln Gln Lys Pro Gly Ser Ser Pro Lys Leu Trp

35 40 45

Ile Tyr Ser Thr Thr Asn Ile Ala Ser Ala Val Pro Ala Arg Phe Ser

50 55 60

Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu

65 70 75 80

Ala Glu Asp Ala Ala Thr Tyr Tyr Cys His Asn His His Lys Ser Pro

85 90 95

Ile Thr Phe Gly Ala Gly Thr Lys Leu Glu Val Lys Arg Ala Asp Ala

100 105 110

Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln Leu Thr Ser

115 120 125

Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr Pro Lys Asp

130 135 140

Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln Asn Gly Val

145 150 155 160

Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr Tyr Ser Met

165 170 175

Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg His Asn Ser

180185 190

Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro Ile Val Lys

195 200 205

Ser Phe Asn Arg Asn Glu Cys

210 215

<210>12

<211>443

<212>PRT

<213>Mus musculus

<400>12

Gln Val Gln Leu Lys Gln Ser Gly Pro Ser Leu Val Gln Pro Ser Gln

1 5 10 15

Ser Leu Ser Ile Thr Cys Thr Val Ser Gly Phe Ser Ile Thr Thr Tyr

20 25 30

Gly Ile His Trp Val Arg Gln Ser Pro Gly Lys Gly Leu Glu Trp Leu

35 40 45

Gly Val Ile Trp Arg Asn Ser Thr Glu Tyr Asn Pro Ala Phe Met Ser

50 55 60

Arg Leu Ser Ile Thr Lys Asp Asn Ser Lys Ser Gln Val Phe Phe Lys

65 70 75 80

Met Asn Ser Leu Gln Ala Asp Asp Thr Ala Ile Tyr Tyr Cys Val Lys

85 90 95

Arg Lys Arg Tyr Ala Asn Tyr Asp Ala Met Glu Tyr Trp Gly Gln Gly

100 105 110

Thr Ser Val Thr Val Ser Ser Ala Lys Thr Thr Pro Pro Ser Val Tyr

115 120 125

Pro Leu Ala Pro Gly Ser Ala Ala Gln Thr Asn Ser Met Val Thr Leu

130 135 140

Gly Cys Leu Val Lys Gly Tyr Phe Pro Glu Pro Val Thr Val Thr Trp

145 150 155 160

Asn Ser Gly Ser Leu Ser Ser Gly Val His Thr Phe Pro Ala Val Leu

165 170 175

Gln Ser Asp Leu Tyr Thr Leu Ser Ser Ser Val Thr Val Pro Ser Ser

180 185 190

Thr Trp Pro Ser Gln Thr Val Thr Cys Asn Val Ala His Pro Ala Ser

195 200 205

Ser Thr Lys Val Asp Lys Lys Ile Val Pro Arg Asp Cys Gly Cys Lys

210 215 220

Pro Cys Ile Cys Thr Val Pro Glu Val Ser Ser Val Phe Ile Phe Pro

225 230 235 240

Pro Lys Pro Lys Asp Val Leu Thr Ile Thr Leu Thr Pro Lys Val Thr

245 250 255

Cys Val Val Val Asp Ile Ser Lys Asp Asp Pro Glu Val Gln Phe Ser

260265 270

Trp Phe Val Asp Asp Val Glu Val His Thr Ala Gln Thr Lys Pro Arg

275 280 285

Glu Glu Gln Phe Asn Ser Thr Phe Arg Ser Val Ser Glu Leu Pro Ile

290 295 300

Met His Gln Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys Arg Val Asn

305 310 315 320

Ser Ala Ala Phe Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Thr Lys

325 330 335

Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro Pro Lys Glu

340 345 350

Gln Met Ala Lys Asp Lys Val Ser Leu Thr Cys Met Ile Thr Asn Phe

355 360 365

Phe Pro Glu Asp Ile Thr Val Glu Trp Gln Trp Asn Gly Gln Pro Ala

370 375 380

Glu Asn Tyr Lys Asn Thr Gln Pro Ile Met Asp Thr Asp Gly Ser Tyr

385 390 395 400

Phe Val Tyr Ser Lys Leu Asn Val Gln Lys Ser Asn Trp Glu Ala Gly

405 410 415

Asn Thr Phe Thr Cys Ser Val Leu His Glu Gly Leu His Asn His His

420425 430

Thr Glu Lys Ser Leu Ser His Ser Pro Gly Lys

435 440

Claims (10)

1. An isolated binding protein comprising an antigen binding domain, wherein the antigen binding domain comprises at least one complementarity determining region selected from the group consisting of amino acid sequences having at least 80% sequence identity with the complementarity determining region of the amino acid sequences having a K with PGII_D≤8.89×10^-8mol/L ofAffinity;

CDR-VH1 is G-F-S-X1-T-X2-Y-G-X3-H, wherein,

x1 is L, I or V, X2 is T or S, X3 is I, V or L;

CDR-VH2 is I-W-R-X1-S-T-X2-Y-N-X3-A-F, wherein,

x1 is GG or N, X2 is E or D, X3 is A or P;

CDR-VH3 is V-K-X1-K-R-Y-X2-N-Y-D-A-M-X3-Y, wherein,

x1 is K or R, X2 is A or G, X3 is E or D;

the CDR-VL1 is T-A-S-S-S-X1-S-S-X2-Y-L-H, wherein,

x1 is I, V or L, X2 is S or T;

the complementarity determining region CDR-VL2 is S-T-X1-N-X2-A-S-X3-V-P, wherein,

x1 is S or T, X2 is I or L, X3 is G or A;

the complementarity determining region CDR-VL3 is H-X1-H-H-X2-S-P-X3-T, wherein,

x1 is N or Q, X2 is R or K, and X3 is I, V or L.

2. The binding protein of claim 1,

in the complementarity determining region CDR-VH1, X2 is S;

in the complementarity determining region CDR-VH2, X2 is D;

in the complementarity determining region CDR-VH3, X2 is G;

in the complementarity determining region CDR-VL1, X2 is S;

in the complementarity determining region CDR-VL2, X3 is G;

in the complementarity determining region CDR-VL3, X1 is Q;

further, in the complementarity determining region CDR-VH1, X1 is L, X3 is I;

further, in the complementarity determining region CDR-VH1, X1 is L, and X3 is V;

further, in the complementarity determining region CDR-VH1, X1 is L, and X3 is L;

further, in the complementarity determining region CDR-VH1, X1 is I, and X3 is I;

further, in the complementarity determining region CDR-VH1, X1 is I, X3 is V;

further, in the complementarity determining region CDR-VH1, X1 is I, X3 is L;

further, in the complementarity determining region CDR-VH1, X1 is V, X3 is I;

further, in the complementarity determining region CDR-VH1, X1 is V, and X3 is V;

further, in the complementarity determining region CDR-VH1, X1 is V, X3 is L;

further, in the complementarity determining region CDR-VH2, X1 is GG, and X3 is a;

further, in the complementarity determining region CDR-VH2, X1 is GG, and X3 is P;

further, in the complementarity determining region CDR-VH2, X1 is N, X3 is a;

further, in the complementarity determining region CDR-VH2, X1 is N, X3 is P;

further, in the complementarity determining region CDR-VH3, X1 is K, X3 is E;

further, in the complementarity determining region CDR-VH3, X1 is K, X2 is D;

further, in the complementarity determining region CDR-VH3, X1 is R, X3 is E;

further, in the complementarity determining region CDR-VH3, X1 is R, X2 is D;

further, in the complementarity determining region CDR-VL1, X1 is I;

further, in the complementarity determining region CDR-VL1, X1 is V;

further, in the complementarity determining region CDR-VL1, X1 is L;

further, in the complementarity determining region CDR-VL2, X1 is S, X2 is L;

further, in the complementarity determining region CDR-VL2, X1 is S, X2 is I;

further, in the complementarity determining region CDR-VL2, X1 is T, X2 is L;

further, in the complementarity determining region CDR-VL2, X1 is T, X2 is I;

further, in the complementarity determining region CDR-VL3, X2 is R, X3 is I;

further, in the complementarity determining region CDR-VL3, X2 is R, X3 is V;

further, in the complementarity determining region CDR-VL3, X2 is R, and X3 is L;

further, in the complementarity determining region CDR-VL3, X2 is K, X3 is I;

further, in the complementarity determining region CDR-VL3, X2 is K, X3 is V;

further, in the complementarity determining region CDR-VL3, X2 is K, X3 is L;

preferably, the mutation site of each complementarity determining region is selected from any one of the following combinations of mutations:

3. the binding protein according to any one of claims 1-2, wherein at least 3 CDRs are included in the binding protein; alternatively, the binding protein comprises at least 6 CDRs;

further, the binding protein is one of nanobody, F (ab ') 2, Fab', Fab, Fv, scFv, diabody, and antibody minimal recognition unit.

4. The binding protein according to any one of claims 1-2, wherein said binding protein comprises the light chain framework regions FR-L1, FR-L2, FR-L3 and FR-L4 in the sequence given in SEQ ID NOs 1-4, and/or the heavy chain framework regions FR-H1, FR-H2, FR-H3 and FR-H4 in the sequence given in SEQ ID NOs 5-8;

further, the binding protein further comprises an antibody constant region sequence;

further, the constant region sequence is selected from the sequences of any one of constant regions of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD;

further, the species source of the constant region is a cow, horse, cow, pig, sheep, goat, rat, mouse, dog, cat, rabbit, camel, donkey, deer, mink, chicken, duck, goose, turkey, chicken fighting or human;

further, the constant region is derived from a mouse;

the light chain constant region sequence is shown as SEQ ID NO. 9;

the heavy chain constant region sequence is shown in SEQ ID NO 10.

5. An isolated nucleic acid encoding the binding protein of any one of claims 1-4.

6. A vector comprising the nucleic acid of claim 5.

7. A host cell comprising the nucleic acid of claim 5 or the vector of claim 6.

8. A method of producing the binding protein of any one of claims 1 to 4, comprising the steps of:

culturing the host cell of claim 7 in a culture medium and recovering the produced binding protein from the culture medium or from the cultured host cell.

9. Use of a binding protein according to any one of claims 1 to 4 for the preparation of a diagnostic agent or kit for the diagnosis of superficial gastritis, erosive gastritis, atrophic gastritis, gastric ulcer, duodenal ulcer, gastric cancer.

10. A kit comprising one or more of the binding protein of any one of claims 1-4, the isolated nucleic acid of claim 5, or the vector of claim 6;

preferably, the kit further comprises a label for labeling the binding protein.

Images