CN112961872A - Probiotic chimeric sensor and construction method and application thereof - Google Patents
Probiotic chimeric sensor and construction method and application thereof Download PDFInfo
- Publication number
- CN112961872A CN112961872A CN202110211524.5A CN202110211524A CN112961872A CN 112961872 A CN112961872 A CN 112961872A CN 202110211524 A CN202110211524 A CN 202110211524A CN 112961872 A CN112961872 A CN 112961872A
- Authority
- CN
- China
- Prior art keywords
- thss
- phk
- tac
- chimeric
- probiotic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/025—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/13—Protein-histidine kinases (2.7.13)
- C12Y207/13003—Histidine kinase (2.7.13.3)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/22—Immunoglobulins specific features characterized by taxonomic origin from camelids, e.g. camel, llama or dromedary
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/569—Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
- G01N2333/24—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
- G01N2333/245—Escherichia (G)
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Plant Pathology (AREA)
- Toxicology (AREA)
- Analytical Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a probiotic chimeric sensor, a construction method thereof and application thereof in calprotectin detection. Firstly, a nano antibody capable of specifically binding target protein is designed aiming at specific biological macromolecules such as target protein to be detected. Then, the coding sequence of the nano antibody is used for exchange fusion with the binding domain of the two-component system histidine kinase receptor to construct a new chimeric histidine kinase receptor, and further the chimeric histidine kinase receptor and a response regulatory factor form a hybrid two-component system, so that the chimeric two-component system depending on the excitation of the appointed target protein is created. According to the method, intestinal probiotics are used as a carrier, a natural two-component system is modified, a probiotic macromolecular sensor which does not exist in the nature is created, the advantage of in-situ noninvasive detection of ulcerative colitis in the intestinal tract is achieved, and meanwhile outstanding sensitivity, stability and safety are achieved.
Description
Technical Field
The invention relates to the field of biotechnology application, in particular to a response sensing system artificially constructed based on chimeric recombinant transformation of two components of a two-component system (histidine kinase receptor, response regulatory factor).
Background
Two-component systems comprising two typical functional proteins, Histidine Kinases (HK) and Response Regulators (RR). Histidine kinases are composed mainly of a variable Ligand Binding Domain (LBD), a transmembrane domain (TM), and a relatively conserved dimerization/phosphotransferase domain (DHp), ATP binding/catalytic domain (CA), and other functional domains at the N-terminus. The response regulator includes two main functional domains, namely a signal receiving domain (REC) at the N-terminal and a DNA Binding Domain (DBD) at the C-terminal.
When an input signal is present, HK-LBD, usually located outside the membrane, rapidly switches from the silent conformation to the active conformation, and this conformational rearrangement will transmit information to the C-terminal signaling region within the membrane, catalyzed by the HK-CA domain to acquire the γ -phosphoryl group from ATP, which is then presented to the highly conserved histidine residue located in the HK-DHp region, completing phosphorylation activation of the kinase sensor. Subsequently, the activated histidine kinase is mediated by HK-DHp region, and combined with intracellular RR, transfers phosphoryl to RR-REC at N-terminal, so that the conserved aspartic acid residue is phosphorylated, and then RR-DBD at C terminal is reactivated, and the process of signal transfer activation from HK to RR is completed. And the RR in an activated state can realize the transcriptional control of one or more downstream export promoters.
Naturally occurring two-component systems, the response targets are primarily a series of small molecule species such as potassium ions, nitrogen ions, etc. (Riglar DT, Giessen TW, Baym M, et al. engineered bacteria can function in the mammalian gum locking-term as living diagnostics of inflammation. Nature Biotechnology 2017,35: 653-. At present, no two-component system sensing channel aiming at macromolecules such as protein exists, however, in a clinical disease model, the characteristic marker is usually macromolecules such as protein, and at the moment, if the detection of the characteristic marker is to be realized, a specific antibody aiming at the characteristic is usually obtained in advance and is further assembled into a classical enzyme-linked detection kit, so that the qualitative or quantitative detection of the marker molecules can be realized. The method uses ulcerative colitis as a disease model, aims at a Calprotectin (Calprotectin) inflammatory factor marker used in clinical examination of the ulcerative colitis, and constructs a whole-cell sensor by using probiotic strains as a carrier. A chimeric two-component sensing system carried by probiotics and aiming at a calprotectin macromolecular marker is obtained by actively replacing and fusing a ligand binding structural domain of a natural two-component system histidine kinase receptor with a coding sequence capable of expressing a specific nano antibody aiming at calprotectin, and is expected to realize detection response to the biological macromolecular marker in a non-invasive and non-invasive manner under the intestinal tract symbiotic colonization state.
Disclosure of Invention
In order to explore and create an intestinal tract probiotic sensor which does not exist in the nature and aims at biological macromolecules such as protein and the like, the invention mainly aims at providing a general functional domain fusion recombination technology, which adopts a specific nano antibody coding sequence aiming at target macromolecules to perform active fusion on an endogenous two-component system of intestinal tract probiotics so as to construct engineering probiotics capable of responding to calprotectin marker molecules of ulcerative colitis. Specifically, the invention comprises the following technical scheme:
according to a first aspect of the invention, a probiotic chimeric sensor construction method is provided, which comprises the following steps:
s1, probiotic carrier strain selection: selecting a suitable probiotic strain;
s2, preparing plasmid frameworks pRR-thsR and pHK-thsS for constructing a sensor;
s3, modifying a two-component system histidine kinase receptor according to the plasmid skeleton in the step S2: by using coulterNano antibody Nb for heterologously binding target proteinCP17The coding sequence is exchanged and fused with the histidine kinase receptor binding structural domain obtained by computer simulation analysis and the positions at two sides to construct a chimeric histidine kinase receptor library;
s4, constructing a probiotic strain of the histidine kinase chimeric receptor capable of detecting the calprotectin target molecule by using the histidine kinase chimeric receptor library obtained in the step S3: forming a hybrid two-component system with response modifiers, thereby creating a chimeric two-component system that relies on excitation by a given target protein, forming a probiotic chimeric sensor;
wherein the chimeric histidine kinase receptor is pHK-Ptac-thsS-NbCPThe response regulatory factor is pRR-PLtetO-1-thsR-sfGFP。
The pRR-thsR and pHK-thsS plasmid frameworks can be obtained by the indicated routes by the documents Landry BP, Palanki R, Dyulgyarov N, et al.
Further, the probiotic strain in step S1 is selected from escherichia coli Nissle1917 or lactobacillus or bifidobacterium.
Further, the nanobody Nb capable of specifically binding to the target protein in the step S3CP17The nano antibody aiming at calprotectin molecules and obtained for immune camel is obtained by the following steps:
1) mixing calprotectin as antigen with Freund's complete adjuvant (v/v ═ 1:1), emulsifying, and injecting subcutaneously to immunize bactrian camel; starting from the 2 nd immunization, mixing and emulsifying by using incomplete Freund adjuvant 1:1, and immunizing for 5 times at intervals;
2) collecting 50mL of camel neck venous blood 7 days after the 5 th immunization, separating lymphocytes, extracting total RNA, and performing reverse transcription to obtain cDNA;
3) using forward primer C-01: gtcctggctgctcttctacaagg (SEQ ID NO.1) and reverse primer C-02: ggtacgtgctgttgaactgttcc (SEQ ID NO.2), amplifying to obtain 650-750bp fragments, and using the fragments as templates of two rounds of amplification after purification; designing primers according to upstream and downstream conserved sequences of camel VHH fragments, fishing camel source VHHs coding sequences, carrying out enzyme digestion and connection with a phagemid vector Phen 2, electrically transforming escherichia coli TG1 competence, renaturation, coating a plate, carrying out inverted culture at 37 ℃, and washing thalli after thalli grow;
4) diluting calprotectin antigen with carbonate buffer solution, adding 96-hole enzyme linked plate, and incubating overnight at 4 ℃ to prepare antigen coated plate; infecting TG1 display library with helper phage M13K07, screening for 4 rounds to obtain sub-library with relatively highest affinity, coating double-antibody plate, selecting single clone, and culturing for 12-18 hr to express antibody; centrifuging to obtain supernatant, adding an antigen precast slab, performing indirect ELISA evaluation, selecting a monoclonal antibody with the highest titer, and sequencing to obtain a coding sequence of the nano antibody.
Further, the method for constructing the histidine kinase chimeric receptor library in the step S3 is as follows: analyzing and obtaining a coding sequence range corresponding to a ligand binding domain through three-dimensional structure simulation comparison, then constructing a histidine kinase chimeric receptor library in a seamless cloning mode, and respectively naming the library as pHK-Ptac-thsS-NbCP01、pHK-Ptac-thsS-NbCP02、pHK-Ptac-thsS-NbCP03、pHK-Ptac-thsS-NbCP04、pHK-Ptac-thsS-NbCP05、pHK-Ptac-thsS-NbCP06、pHK-Ptac-thsS-NbCP07、pHK-Ptac-thsS-NbCP08、pHK-Ptac-thsS-NbCP09、pHK-Ptac-thsS-Nb CP10、pHK-Ptac-thsS-Nb CP11、pHK-Ptac-thsS-Nb CP12、pHK-Ptac-thsS-Nb CP13、pHK-Ptac-thsS-Nb CP14、pHK-Ptac-thsS-NbCP15、pHK-Ptac-thsS-NbCP16、pHK-Ptac-thsS-NbCP17、pHK-Ptac-thsS-NbCP18、pHK-Ptac-thsS-NbCP19 and pHK-Ptac-thsS-Nb CP20。
Further, the step S4 includes:
1) mixing pRR-PLtetO-1Electrotransformation of-thsR-sfGFP into probiotic strainsCompetent cells are subjected to amplification screening by specific primers to obtain positive transformants;
2) preparing competent cells by using the positive transformant obtained in the step 1), and further introducing the chimeric kinase receptor library into the cells carrying pRR-PLtetO-1-a probiotic strain of the thsR-sfGFP plasmid;
3) adding IPTG, anhydrotetracycline and calprotectin solution to the engineered strain in the step 2) to obtain a strain with a fluorescence response signal, namely the probiotic strain capable of responding to the histidine kinase chimeric receptor of calprotectin.
In a second aspect, the invention provides a probiotic chimeric sensor, which is constructed by the method and is a probiotic strain comprising a histidine kinase chimeric receptor and a response regulatory factor two-component system.
The third aspect of the invention provides application of the probiotic chimeric sensor in preparing a detection reagent of a biological macromolecular marker.
Further, the biomacromolecule is calprotectin.
According to the invention, through a gene functional domain fusion means, based on a Nissle1917 probiotic carrier, fusion transformation is carried out on a histidine kinase receptor of a heterologous two-component system to obtain a chimeric kinase receptor with the capability of responding to calprotectin, and after the chimeric kinase receptor and a homologous response regulatory factor form a heterozygote two-component system, the Nissle1917 probiotic strain can have the capability of detecting ulcerative colitis calprotectin inflammatory factors, and has the potential of being better applied to clinical noninvasive detection after deep transformation.
Drawings
FIG. 1 shows the results of plasmid map representation and construction verification of pRR-PLtetO-1-thsR-sfGFP carrying response regulatory factor unit
FIG. 2 shows pHK-Ptac-thsS-Nb carrying chimeric kinase receptorsCPDemonstration of plasmid map and construction verification result
FIG. 3 shows the results of a sensitivity test of a probiotic calprotectin sensor carrying a chimeric kinase receptor and a signal reporter unit
Detailed Description
In order to make the technical means, the original characteristics, the achieved purposes and the effects of the invention easy to understand, the invention is further described with reference to the figures and the specific embodiments.
The test methods in the following examples, in which specific experimental conditions are not specified, are generally carried out according to conventional experimental conditions or according to the experimental conditions recommended by the manufacturer. The materials, reagents and the like used are, unless otherwise specified, reagents and materials obtained from commercial sources.
The preparation of each solution referred to herein is as follows:
phosphate buffer solution: potassium dihydrogen phosphate 0.24g/L, disodium hydrogen phosphate 1.42g/L, sodium chloride 8.0g/L, potassium chloride 0.2g/L, pH 7.4, and sterilizing at 121 deg.C for 15 min.
LB culture medium: 5g/L yeast extract, 10g/L tryptone and 10g/L sodium chloride (15 g/L agar powder is additionally added in LB solid culture medium).
M9 glycerol medium: 1 XM 9 salt, 0.4% v/v glycerol, 0.2% casamino acid, 2mM MgSO4，100uM CaCl2. The preparation method comprises the following steps: (1) 5 × concentration of M9 salt solution was prepared: 64.0g/L of sodium phosphate heptahydrate, 15.0g/L of monopotassium phosphate, 2.5g/L of sodium chloride and 5.0g/L of ammonium chloride. (2) Preparation of a 1M magnesium sulfate solution: 246.0g/L magnesium sulfate heptahydrate. (3) Preparing 1M calcium chloride solution: 219.1g/L of calcium chloride hexahydrate. (4) Preparing a 50% glycerol aqueous solution: 0.5L of glycerol was measured and double distilled water was added to 1.0L. The above four reagents were sterilized at 121 ℃ for 15 minutes for use. (5) Preparing a 20% casein amino acid solution: 2.0g of casamino acid is weighed, added with double distilled water to be dissolved to 10mL, and filtered and sterilized by a 0.22 micron filter. (6) 200mL of 5 XM 9 salt solution; 1M magnesium sulfate solution, 2 mL; 0.1mL of 1M calcium chloride solution; 12.5mL of a 50% glycerol aqueous solution; 20% casein amino acid solution, 10 mL.
The plasmid frameworks used in the method of the invention are pRR-thsR and pHK-thsS, which can be purchased from Beijing Zhongyuan Synergo Biotechnology Co., Ltd (the trade designations are #104336 and #90952), or constructed by the method described in example 2.
Example 1: selection of probiotic Carrier
Selection of probiotic carrier strains: intestinal probiotic bacteria Escherichia coli Nissel 1917(EcN) have the effects of modulating the release of cytokines such as TNF-alpha, IFN-gamma, etc., inhibiting the adhesion of pathogenic bacteria to intestinal epithelial cells, etc. (Alba RN, France Sca A., Jos Megm, Tersa V, et al. the administration of Escherichia coli Nissel 1917 amides depletion of DSS-induced pathology in microorganisms. frontiers in Pharmacology 2018,9: 468.). In the European evidence-based medical diagnosis and management consensus, it is even thought to have the potential to replace the first-line drug mesalazine (Harbord M, Ellialim R, Bettenworth D, et al. third European evidence-based consensus on the diagnosis and management of an undesirable nature part 2: current management. journal of Crohn & colors, 2017,11:769- & 784.). Therefore, we purchased EcN wild-type strain from Baiohobowei Biotechnology, Inc., Beijing, which was tested for good growth status and subsequently used as a carrier strain for constructing probiotic sensors.
Example 2: preparation of plasmid backbone of pRR-thsR, pHK-thsS
The following references can be made to the genetic manipulation of the EcN strain: ou B, Jiang B, Jin D, et al, engineered recombinant Escherichia coli biological strains integrated with F4and F18 fimbriae cluster genes in the chromosome and the ir assessment of immunogenic efficacy in vivo ACS Synthetic Biology 2020,9: 412-.
pRR-thsR, pHK-thsS plasmid backbone, reference Landry BP, Palanki R, Dyulgyarov N, et al.
Example 3: pHK-Ptac-thsS-NbcpConstruction of plasmid libraries
Codon-optimized ThsS gene sequences are as follows:
atgtcccgcctgctgctgtgtatctgtgttctgctgttctcttctgtggcgtggtctaaaccgcagcagttttatgtgggcgtactggctaactggggtcatcagcaagccgttgaacgttggaccccgatgatggagtatctgaacgaacatgtgccggacgcggaatttcacgtctacccgggcaacttcaaagcactgaacctggcaatggaactgggccagattcagttcattatcactaacccgggccaatatctgtacctgagcaatcagtacccgctgtcttggctggcgaccatgcgttctaagcgtcacgatggtaccacttctgcgatcggttccgccattattgtccgcgcggacagcgactaccgcaccctgtacgacctgaaaggtaaagtggtggctgcgtccgacccgcatgctctgggtggctaccaagcgaccgtcggtctgatgcattccctgggcatggatccggacaccttcttcggtgaaaccaagtttctgggctttccactggatccgctgctgtaccaagttcgtgatggcaacgttgacgcggccattaccccactgtgcactctggaggacatggttgcacgcggcgtactgaaatcttccgattttcgtgtgctgaaccctagccgcccggatggtgtagaatgccagtgctctaccaccctgtacccgaactggtctttcgctgcgactgagtctgtatccaccgaactgtctaaagaaatcacgcaggcactgctggaactgccatccgacagcccggcagctatcaaagcgcaactgaccggctggaccagcccgatctcccaactggcggtaatcaaactgttcaaagagctgcacgtaaaaaccccggactctagccgttgggaagccgttaagaagtggctggaagaaaaccgtcactggggtatcctgtctgttctggtgttcatcattgcaacgctgtatcacctgtggattgaataccgcttccaccaaaaaagctcttctctgatcgaatctgaacgtcagctgaaacagcaagctgttgccctggaacgtctgcaatctgctagcatcgttggtgaaattggtgcgggtctggcccacgagattaatcagccgatcgctgcaattacctcttattctgaaggtggcatcatgcgcctgcaaggtaaagaacaggcggatacggatagctgcatcgaactgctggaaaaaatccacaaacagagcactcgcgcaggcgaagtggtgcaccgcatccgtggtctgctgaaacgtcgtgaagcggtgatggtagatgttaacatcctgaccctggtggaagaatccatcagcctgctgcgtctggagctggcacgtcgcgaaatccagatcaacactcagatcaaaggtgaaccgttcttcattactgccgaccgcgttggcctgctgcaagttctgattaacctgatcaaaaactccctggacgcgatcgctgaatctgataatgcccgttctggtaaaatcaacatcgaactggactttaaagagtaccaggtaaacgtctccatcatcgataacggtccgggcctggcgatggattctgacactctgatggctacgttttacactaccaaaatggatggcctgggcctgggtctggcaatctgccgcgaagttatcagcaaccacgacggccacttcctgctgtccaaccgtgacgacggcgttctgggctgtgtggcaaccctgaatctgaaaaaacgcggttctgaagtgccgatcgaagtctaa(SEQ ID NO.3)
the original thsS gene sequence is present in pHK-thsS plasmid in the form of an expression cassette, on the basis of which pHK-P is constructedtac-thsS-NbcpA plasmid library comprising the steps of:
(1) and performing homologous modeling on the histidine kinase receptor ThsS to be subjected to fusion operation by using SWISS-MODEL and I-TASSER three-dimensional structure modeling software, combining the distribution characteristics of the identified kinase receptor functional structural domain, and estimating the double transmembrane structural domain and the corresponding coding region (43-111bp, 454-522bp) of the binding structural domain of the kinase receptor ThsS.
(2) By utilizing a seamless cloning method, a calprotectin specific nano antibody coding sequence optimized by codon preference is fused with and replaces a predicted histidine kinase ligand binding domain coding region, 15 nucleotides are set as step lengths from the 43bp, coding sequences at two sides of a predicted transmembrane domain and a binding domain are replaced, namely at the positions of 43bp, 58bp, 73bp, 88bp, 103bp, 118bp, 454bp, 469bp, 484bp, 499bp, 514bp and 529bp respectively, the nano antibody coding sequence is used for covering and replacing the corresponding kinase receptor binding domain, a library containing 12 chimeric kinase receptors is constructed and obtained, the first round of response performance evaluation is carried out, and the testing steps are described in example 4and example 5 in detail. Subsequently, the best responding chimeric kinase receptor was selected, and 3 nucleotides were set from the positions on both sides thereof as the step length to construct 8 chimeric kinase receptors. Further, the 20 chimeric kinase receptors were named pHK-Ptac-thsS-NbCP(01-20) that is pHK-Ptac-thsS-NbCP01、pHK-Ptac-thsS-NbCP02、pHK-Ptac-thsS-NbCP03、pHK-Ptac-thsS-NbCP04、pHK-Ptac-thsS-NbCP05、pHK-Ptac-thsS-NbCP06、pHK-Ptac-thsS-NbCP07、pHK-Ptac-thsS-NbCP08、pHK-Ptac-thsS-NbCP09、pHK-Ptac-thsS-Nb CP10、pHK-Ptac-thsS-Nb CP11、pHK-Ptac-thsS-Nb CP12、pHK-Ptac-thsS-Nb CP13、pHK-Ptac-thsS-Nb CP14、pHK-Ptac-thsS-NbCP15、pHK-Ptac-thsS-NbCP16、pHK-Ptac-thsS-NbCP17、pHK-Ptac-thsS-NbCP18、pHK-Ptac-thsS-NbCP19 and pHK-Ptac-thsS-Nb CP20。
The nano antibody Nb capable of specifically binding the target proteinCP17For immunizationThe nanometer antibody aiming at calprotectin molecules obtained from camels is prepared by the following steps:
1) mixing calprotectin as antigen with Freund's complete adjuvant (v/v ═ 1:1), emulsifying, and injecting subcutaneously to immunize bactrian camel; starting from the 2 nd immunization, mixing and emulsifying by using incomplete Freund adjuvant 1:1, and immunizing for 5 times at intervals;
2) collecting 50mL of camel neck venous blood 7 days after the 5 th immunization, separating lymphocytes, extracting total RNA, and performing reverse transcription to obtain cDNA;
3) using forward primer C-01: gtcctggctgctcttctacaagg (SEQ ID NO.1) and reverse primer C-02: ggtacgtgctgttgaactgttcc (SEQ ID NO.2), amplifying to obtain 650-750bp fragments, and using the fragments as templates of two rounds of amplification after purification; designing primers according to upstream and downstream conserved sequences of camel VHH fragments, fishing camel source VHHs coding sequences, carrying out enzyme digestion and connection with a phagemid vector Phen 2, electrically transforming escherichia coli TG1 competence, renaturation, coating a plate, carrying out inverted culture at 37 ℃, and washing thalli after thalli grow;
4) diluting calprotectin antigen with carbonate buffer solution, adding 96-hole enzyme linked plate, and incubating overnight at 4 ℃ to prepare antigen coated plate; infecting TG1 display library with helper phage M13K07, screening for 4 rounds to obtain sub-library with relatively highest affinity, coating double-antibody plate, selecting single clone, and culturing for 12-18 hr to express antibody; centrifuging to obtain supernatant, adding antigen precast slab, performing indirect ELISA evaluation, selecting monoclonal antibody with highest titer, and sequencing to obtain nanometer antibody NbCP17The coding sequence of (a).
Codon optimized nanobody NbCP17The coding sequence is as follows:
Caatctgttgttggcctggccgaagcgggtaacggtgcggttctggctatgggtagtctgcgtctgttgtgcgcagctccaggcagcaccaaaattaagtctcccatgatttgggagcgtgaagcaacaggctttgaagccgaattgctgcgaaccgcaggtcgaagcgggggcctgacccaatacttagacggtgttcaaggttacttccgtattgaacgtatcaaagcaaaaataaccgcatacaaccagcgcgacacgctgtcaccggatgatagcgcttttgcctatctttgtcaggcggtacgtggt(SEQ ID NO.4)。
example 4: carrying pRR-PLtetO-1EcN Strain construction of-thsR-sfGFP plasmid
Signal-carrying report unit pRR-PLtetO-1-method for constructing probiotics of-thsR-sfGFP (Escherichia coli Nissle1917) (the plasmid map is shown in figure 1), comprising the following steps:
(1) freezing and storing bacterial liquid of a recombinant plasmid pRR-thsR glycerol tube carrying a signal report unit, sucking 10 mu L of the frozen bacterial liquid, transferring the frozen bacterial liquid to 5mL of LB culture medium, adding chloramphenicol to the working concentration of 25 mu g/mL, carrying out shake culture at 37 ℃ and 220r/min for 12-18h, purifying to obtain a plasmid product, and renaming to be pRR-PLtetO-1-thsR-sfGFP。
(2) Sucking the plasmid product, adding Escherichia coli Nissle1917 competent bacteria solution, mixing, electrically transferring (2.5kV, 200 ohm, 25 muF, 0.2cm electric conversion cup, electric shock time: 4.5-5ms), adding 600 muL LB culture medium, transferring to 1.5mL centrifuge tube, 37 deg.C, 220r/min shaking culture for 45 min. 100 μ L of the culture broth was spread on LB solid agar plates (chloramphenicol-resistant) and cultured by inversion at 37 ℃ for 24-48 hours.
(3) And (3) transformant screening: when a single colony of about 1mm grows on the plate, uniformly mixing the single colonies by using 20 mu L of LB culture medium (chloramphenicol resistance), performing PCR amplification verification by using a specific target sequence, sending the single colonies with the verified correct strip size (about 800bp) (shown in figure 1) to Shanghai Huada Gene science and technology Limited for sequencing verification, and confirming that the constructed EpR03 strain is successfully obtained.
Example 5: carrying pHK-Ptac-thsS-NbcpEcN Strain construction of plasmids
Carry signal report unit and perception unit pHK-P simultaneouslytac-thsS-NbcpThe construction method of the engineering probiotic library (the plasmid map is shown in figure 2) comprises the following steps:
(1) the chimeric kinase receptor library plasmids obtained in example 3 were each shock-transformed (2.5kV, 200 ohm, 25. mu.F, 0.2cm electric transformation cup, shock time: 4.5-5ms) into competent cells of the EpR03 strain to be tested. Subsequently, 600. mu.L of LB non-resistant medium was added to the cuvette, mixed by pipetting, transferred to a 1.5mL centrifuge tube, and cultured at 37 ℃ for 45min with shaking at 220 r/min. 100 μ L of the culture solution was spread on LB solid agar plates (25 μ g/mL chloramphenicol and 50 μ g/mL spectinomycin), and inverted and cultured at 37 ℃ for 24-48 hours.
(2) After the plate grows to about 1mm behind the bacterium, carrying out amplification verification by using a fusion construction primer, amplifying a bacterium colony with a positive strip, and carrying out shake culture at 37 ℃ and 220r/min by using a culture solution with resistance to chloramphenicol and spectinomycin; meanwhile, 100 mu L of bacterial liquid is taken and sequenced to confirm the correctness of the constructed sequence, and the bacterial liquid is named as EpR03-pH-Nbcp(01-20), i.e. EpR03-pH-Nbcp01、EpR03-pH-Nbcp02、EpR03-pH-Nbcp03、EpR03-pH-Nbcp04、EpR03-pH-Nbcp05、EpR03-pH-Nbcp06、EpR03-pH-Nbcp07、EpR03-pH-Nbcp08、EpR03-pH-Nbcp09、EpR03-pH-Nb cp10、EpR03-pH-Nb cp11、EpR03-pH-Nb cp12、EpR03-pH-Nb cp13、EpR03-pH-Nb cp14、EpR03-pH-Nbcp15、EpR03-pH-Nbcp16、EpR03-pH-Nbcp17、EpR03-pH-Nbcp18、EpR03-pH-Nbcp19 and EpR03-pH-Nb cp20。
Example 6: test for engineered probiotic strains carrying chimeric kinase receptors and signaling reporter units
(1) Respectively taking EpR03-pH-Nbcp(01-20) 10uL of the strain was transferred to 5mLLB medium (25. mu.g/mL chloramphenicol and 50. mu.g/mL spectinomycin), and cultured at 37 ℃ and 220r/min with shaking for 12-16 h.
(2) Sucking 50uL of the above bacterial liquid, transferring to 3mL M9 glycerol medium (chloramphenicol 25. mu.g/mL and spectinomycin 50. mu.g/mL), culturing at 37 deg.C for 3 hr to OD600About 0.2.
(3) And (4) preparing a reaction system. The resulting suspension was diluted to OD with M9 glycerol medium (chloramphenicol 25. mu.g/mL and spectinomycin 50. mu.g/mL)600＝10-3. Sucking 1mL, adding IPTG (working concentration of 75uM), tetracycline (working concentration of 50ng/mL) and calprotectin standard solution (working concentration of 500mg/L), shaking and culturing at 37 deg.C and 220r/min for 6h to logarithmic phase (OD)600＝0.3)
(4) sfGFP fluorescence assay. The tube was removed and the reaction was stopped by ice-bath. mu.L of the bacterial solution was added to 200. mu.L of PBS precooled at 4 ℃ and measured by a fluorescence 3-type microplate reader from BioTek InstrumentsThe sfGFP fluorescence intensity was determined, the excitation wavelength was 488nm, and the emission wavelength was 530 nm. Meanwhile, the mCherry fluorescence intensity of constitutive expression, the excitation light wavelength is 552nm, and the emission light wavelength is 625nm, so that the mCherry fluorescence intensity is used for calibrating a fluorescence signal. Selection of EpR03-pH-Nbcp(01-20) the engineering probiotic strain with higher fluorescence intensity, and the corresponding chimeric kinase receptor can be used for constructing a calprotectin response type sensing system.
Example 7: probiotic sensor detection sensitivity test carrying positive chimeric kinase receptor and signal reporting unit
(1) 10uL of engineered probiotic strain glycerol pipecurose solution which is selected from the engineering probiotic strain and carries a chimeric kinase receptor with better response to calprotectin and a signal reporting unit in example 6 is transferred to 5mL of LB culture medium (25 mu g/mL of chloramphenicol and 50 mu g/mL of spectinomycin), and the culture is carried out for 12-16h at 37 ℃ and 220r/min by shaking.
(2) Sucking 50uL of the above bacterial liquid, transferring to 3mL M9 glycerol medium (chloramphenicol 25. mu.g/mL and spectinomycin 50. mu.g/mL), culturing at 37 deg.C for 3 hr to OD600About 0.2.
(3) And (4) preparing a reaction system. The resulting suspension was diluted to OD with M9 glycerol medium (chloramphenicol 25. mu.g/mL and spectinomycin 50. mu.g/mL)600＝10-3. Sucking 1mL, adding IPTG (working concentration of 75uM), tetracycline (working concentration of 50ng/mL) and calprotectin standard solution (working concentration of 0, 25, 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, 400, 500, 1000mg/L) diluted in gradient, culturing at 37 ℃ and 220r/min for 6h until logarithmic phase (OD)600≈0.3)
(4) sfGFP fluorescence assay. The tube was removed and the reaction was stopped by ice-bath. mu.L of the bacterial solution was added to 200. mu.L of PBS precooled at 4 ℃, the fluorescence intensity of sfGFP was measured by means of a staining 3-type fluorescence microplate reader from BioTek Instruments, the excitation wavelength was set at 488nm, and the emission wavelength was set at 530 nm. Meanwhile, the mCherry fluorescence intensity of constitutive expression, the excitation light wavelength is 552nm, and the emission light wavelength is 625nm, so that the mCherry fluorescence intensity is used for calibrating a fluorescence signal. The result is shown in figure 3, under the determination condition, the constructed calprotectin probiotic sensing system has the maximum response signal of about 50000(a.u.), and the signal intensity is higher, so that the calprotectin probiotic sensing system has the prospect of being applied to clinical auxiliary diagnosis.
The above embodiments should not be construed as limiting the scope of the invention. The key points of the invention are as follows: customizing a nano antibody aiming at a biological macromolecule, and performing replacement fusion by using a coding sequence of the nano antibody and a ligand binding domain of a dual-component system kinase receptor to obtain a fusion type kinase receptor capable of binding and responding to a target macromolecule; further, phosphorylation signals are transmitted by means of the intrinsic response regulator of the two-component system, and expression synthesis of a reporter gene downstream of the controlled homologous promoter is activated. The present invention should be construed as being in any way susceptible to variations without departing from the spirit thereof.
Sequence listing
<110> Shanghai health medical college
Huaweian evaluation medical research (Shanghai) Co., Ltd
<120> probiotic chimeric sensor and construction method and application thereof
<130> JSP12100763
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gtcctggctg ctcttctaca agg 23
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ggtacgtgct gttgaactgt tcc 23
<210> 3
<211> 1785
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
atgtcccgcc tgctgctgtg tatctgtgtt ctgctgttct cttctgtggc gtggtctaaa 60
ccgcagcagt tttatgtggg cgtactggct aactggggtc atcagcaagc cgttgaacgt 120
tggaccccga tgatggagta tctgaacgaa catgtgccgg acgcggaatt tcacgtctac 180
ccgggcaact tcaaagcact gaacctggca atggaactgg gccagattca gttcattatc 240
actaacccgg gccaatatct gtacctgagc aatcagtacc cgctgtcttg gctggcgacc 300
atgcgttcta agcgtcacga tggtaccact tctgcgatcg gttccgccat tattgtccgc 360
gcggacagcg actaccgcac cctgtacgac ctgaaaggta aagtggtggc tgcgtccgac 420
ccgcatgctc tgggtggcta ccaagcgacc gtcggtctga tgcattccct gggcatggat 480
ccggacacct tcttcggtga aaccaagttt ctgggctttc cactggatcc gctgctgtac 540
caagttcgtg atggcaacgt tgacgcggcc attaccccac tgtgcactct ggaggacatg 600
gttgcacgcg gcgtactgaa atcttccgat tttcgtgtgc tgaaccctag ccgcccggat 660
ggtgtagaat gccagtgctc taccaccctg tacccgaact ggtctttcgc tgcgactgag 720
tctgtatcca ccgaactgtc taaagaaatc acgcaggcac tgctggaact gccatccgac 780
agcccggcag ctatcaaagc gcaactgacc ggctggacca gcccgatctc ccaactggcg 840
gtaatcaaac tgttcaaaga gctgcacgta aaaaccccgg actctagccg ttgggaagcc 900
gttaagaagt ggctggaaga aaaccgtcac tggggtatcc tgtctgttct ggtgttcatc 960
attgcaacgc tgtatcacct gtggattgaa taccgcttcc accaaaaaag ctcttctctg 1020
atcgaatctg aacgtcagct gaaacagcaa gctgttgccc tggaacgtct gcaatctgct 1080
agcatcgttg gtgaaattgg tgcgggtctg gcccacgaga ttaatcagcc gatcgctgca 1140
attacctctt attctgaagg tggcatcatg cgcctgcaag gtaaagaaca ggcggatacg 1200
gatagctgca tcgaactgct ggaaaaaatc cacaaacaga gcactcgcgc aggcgaagtg 1260
gtgcaccgca tccgtggtct gctgaaacgt cgtgaagcgg tgatggtaga tgttaacatc 1320
ctgaccctgg tggaagaatc catcagcctg ctgcgtctgg agctggcacg tcgcgaaatc 1380
cagatcaaca ctcagatcaa aggtgaaccg ttcttcatta ctgccgaccg cgttggcctg 1440
ctgcaagttc tgattaacct gatcaaaaac tccctggacg cgatcgctga atctgataat 1500
gcccgttctg gtaaaatcaa catcgaactg gactttaaag agtaccaggt aaacgtctcc 1560
atcatcgata acggtccggg cctggcgatg gattctgaca ctctgatggc tacgttttac 1620
actaccaaaa tggatggcct gggcctgggt ctggcaatct gccgcgaagt tatcagcaac 1680
cacgacggcc acttcctgct gtccaaccgt gacgacggcg ttctgggctg tgtggcaacc 1740
ctgaatctga aaaaacgcgg ttctgaagtg ccgatcgaag tctaa 1785
<210> 4
<211> 312
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
caatctgttg ttggcctggc cgaagcgggt aacggtgcgg ttctggctat gggtagtctg 60
cgtctgttgt gcgcagctcc aggcagcacc aaaattaagt ctcccatgat ttgggagcgt 120
gaagcaacag gctttgaagc cgaattgctg cgaaccgcag gtcgaagcgg gggcctgacc 180
caatacttag acggtgttca aggttacttc cgtattgaac gtatcaaagc aaaaataacc 240
gcatacaacc agcgcgacac gctgtcaccg gatgatagcg cttttgccta tctttgtcag 300
gcggtacgtg gt 312
Claims (8)
1. A construction method of a probiotic chimeric sensor is characterized by comprising the following steps:
s1, probiotic carrier strain selection: selecting a suitable probiotic strain;
s2, preparing plasmid frameworks pRR-thsR and pHK-thsS for constructing a sensor;
s3, modifying a two-component system histidine kinase receptor by using the plasmid skeleton in the step S2: nano antibody Nb capable of specifically binding target proteinCP17The coding sequence is exchanged and fused with the histidine kinase receptor binding structural domain obtained by computer simulation analysis and the positions at two sides to construct a chimeric histidine kinase receptor library;
s4, constructing a probiotic strain of the histidine kinase chimeric receptor capable of detecting the calprotectin target molecule by using the chimeric histidine kinase receptor library obtained in the step S3: forming a hybrid two-component system with response modifiers, thereby creating a chimeric two-component system that relies on excitation by a given target protein, forming a probiotic chimeric sensor;
wherein the chimeric histidine kinase receptor is pHK-Ptac-thsS-NbCPThe response regulatory factor is pRR-PLtetO-1-thsR-sfGFP。
2. The method of claim 1, wherein: the probiotic strain in step S1 is selected from escherichia coli Nissle1917, lactobacillus or bifidobacterium.
3. The method of claim 1, wherein: the nanobody Nb capable of specifically binding to the target protein in the step S3CP17The preparation method of the nanometer antibody aiming at the calprotectin molecule obtained from the immune camel comprises the following steps:
1) mixing calprotectin as antigen with Freund's complete adjuvant (v/v ═ 1:1), emulsifying, and injecting subcutaneously to immunize bactrian camel; starting from the 2 nd immunization, mixing and emulsifying by using incomplete Freund adjuvant 1:1, and immunizing for 5 times at intervals;
2) collecting 50mL of camel neck venous blood 7 days after the 5 th immunization, separating lymphocytes, extracting total RNA, and performing reverse transcription to obtain cDNA;
3) using forward primer C-01: gtcctggctgctcttctacaagg (SEQ ID NO.1) and reverse primer C-02: ggtacgtgctgttgaactgttcc (SEQ ID NO.2), amplifying to obtain 650-750bp fragments, and using the fragments as templates of two rounds of amplification after purification; designing primers according to upstream and downstream conserved sequences of camel VHH fragments, fishing camel source VHHs coding sequences, carrying out enzyme digestion and connection with a phagemid vector Phen 2, electrically transforming escherichia coli TG1 competence, renaturation, coating a plate, carrying out inverted culture at 37 ℃, and washing thalli after thalli grow;
4) diluting calprotectin antigen with carbonate buffer solution, adding 96-hole enzyme linked plate, and incubating overnight at 4 ℃ to prepare antigen coated plate; infecting TG1 display library with helper phage M13K07, screening for 4 rounds to obtain sub-library with relatively highest affinity, coating double-antibody plate, selecting single clone, and culturing for 12-18 hr to express antibody; centrifuging to obtain supernatant, adding an antigen precast slab, performing indirect ELISA evaluation, selecting a monoclonal antibody with the highest titer, and sequencing to obtain a coding sequence of the nano antibody.
4. The method of claim 1, wherein: the construction method of the chimeric histidine kinase receptor library in step S3 is as follows: analyzing and obtaining the corresponding coding sequence range of the ligand binding domain through three-dimensional structure simulation comparison, then constructing a chimeric histidine kinase receptor library in a seamless cloning mode, and respectively naming the library as pHK-Ptac-thsS-NbCP01、pHK-Ptac-thsS-NbCP02、pHK-Ptac-thsS-NbCP03、pHK-Ptac-thsS-NbCP04、pHK-Ptac-thsS-NbCP05、pHK-Ptac-thsS-NbCP06、pHK-Ptac-thsS-NbCP07、pHK-Ptac-thsS-NbCP08、pHK-Ptac-thsS-NbCP09、pHK-Ptac-thsS-NbCP10、pHK-Ptac-thsS-NbCP11、pHK-Ptac-thsS-NbCP12、pHK-Ptac-thsS-NbCP13、pHK-Ptac-thsS-NbCP14、pHK-Ptac-thsS-NbCP15、pHK-Ptac-thsS-NbCP16、pHK-Ptac-thsS-NbCP17、pHK-Ptac-thsS-NbCP18、pHK-Ptac-thsS-NbCP19 and pHK-Ptac-thsS-NbCP20。
5. The method according to claim 1, wherein the step S4 includes:
1) mixing pRR-PLtetO-1Electro-transforming the-thsR-sfGFP into a probiotic strain competent cell, and obtaining a positive transformant through amplification and screening of a specific primer;
2) utilizing the positive transformant obtained in the step 1), preparing competent cells, and further respectively introducing the chimeric histidine kinase receptor libraries into the cells carrying pRR-PLtetO-1-a probiotic strain of the thsR-sfGFP plasmid;
3) adding IPTG, anhydrotetracycline and calprotectin to the engineered strain in the step 2) to obtain a strain with a fluorescence response signal, namely the probiotic strain capable of responding to a histidine kinase chimeric receptor of calprotectin.
6. A probiotic chimeric sensor, characterized by: the probiotic strain constructed by the method of any one of claims 1 to 5, comprising a chimeric histidine kinase receptor and a response regulator two-component system.
7. Use of the probiotic chimeric sensor of claim 6 in the preparation of a biomacromolecule marker detection reagent.
8. Use of a probiotic mosaic sensor according to claim 7, characterized in that: the biomacromolecule is calprotectin.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110211524.5A CN112961872B (en) | 2021-02-25 | 2021-02-25 | Probiotic chimeric sensor and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110211524.5A CN112961872B (en) | 2021-02-25 | 2021-02-25 | Probiotic chimeric sensor and construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112961872A true CN112961872A (en) | 2021-06-15 |
| CN112961872B CN112961872B (en) | 2022-09-30 |
Family
ID=76286110
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110211524.5A Active CN112961872B (en) | 2021-02-25 | 2021-02-25 | Probiotic chimeric sensor and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112961872B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20170360850A1 (en) * | 2014-12-22 | 2017-12-21 | Massachusetts Institute Of Technology | Probiotic organisms for diagnosis, monitoring, and treatment of inflammatory bowel disease |
| WO2018007726A1 (en) * | 2016-07-05 | 2018-01-11 | Gangwe Nana Ghislain Yannick | Kit for detecting a protein biomarker in a biological sample and amplifying the signal |
| CN111004324A (en) * | 2019-12-31 | 2020-04-14 | 苏州和锐生物科技有限公司 | Calprotectin monoclonal antibody and application thereof |
-
2021
- 2021-02-25 CN CN202110211524.5A patent/CN112961872B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20170360850A1 (en) * | 2014-12-22 | 2017-12-21 | Massachusetts Institute Of Technology | Probiotic organisms for diagnosis, monitoring, and treatment of inflammatory bowel disease |
| WO2018007726A1 (en) * | 2016-07-05 | 2018-01-11 | Gangwe Nana Ghislain Yannick | Kit for detecting a protein biomarker in a biological sample and amplifying the signal |
| CN111004324A (en) * | 2019-12-31 | 2020-04-14 | 苏州和锐生物科技有限公司 | Calprotectin monoclonal antibody and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| LANDRY, BP 等: ""Phosphatase activity tunes two-component system sensor detection threshold"", 《NAT COMMUN》 * |
| YOSHIDA, T 等: ""The design and development of Tar-EnvZ chimeric receptors"", 《 TWO-COMPONENT SIGNALING SYSTEMS, PT B》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112961872B (en) | 2022-09-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11198864B2 (en) | Protease-resistant systems for polypeptide display and methods of making and using thereof | |
| EP2670847B1 (en) | Methods and materials for enhancing functional protein expression in bacteria | |
| CN101426919B (en) | Method for cell surface displaying of target proteins using bacillus anthracis exosporium | |
| CN111499765A (en) | Coronavirus fusion protein and preparation method and application thereof | |
| CN111748571B (en) | Method for engineering bacillus subtilis into multifunctional stable platform for producing nano antibody | |
| CN107916276B (en) | A kind of novel T cell immunomodulator bioactivity detection method | |
| CA2312379A1 (en) | A bacterial multi-hybrid system and applications | |
| AU2002227112A1 (en) | Affinity maturation by competitive selection | |
| CN111269324B (en) | Fusion protein of Gauss luciferase and digoxin single-chain antibody and application thereof | |
| CN107973857B (en) | Recombinant fusion protein based on bacterial surface display system and application thereof | |
| CN112961872B (en) | Probiotic chimeric sensor and construction method and application thereof | |
| WO2016182819A2 (en) | Identifying ligands from bacterial sensors | |
| CN102653771B (en) | Expression vector of fused protein of glutamine transporter 1 as well as construction method and application thereof | |
| EP2358909B1 (en) | A system useful for reporting protein-protein interactions in the bacterial periplasm | |
| CN114057861B (en) | bio-PROTAC artificial protein targeting UBE2C | |
| US10802021B2 (en) | Synthetic hybrid receptor and genetic circuit in bacteria to detect enteric pathogenic microorganisms | |
| CN109852632A (en) | Purposes of the spoIIIJ albumen as anchorin in Bacillus surface display systems | |
| JP2019534689A (en) | Display of bispecific antibodies on phage surface | |
| Waraho et al. | Identifying and optimizing intracellular protein–protein interactions using bacterial genetic selection | |
| US20180258459A1 (en) | Nitrate biosensor | |
| Malik | Understanding the molecular basis for adhesion by Haemophilus Surface Fibril | |
| CN100485033C (en) | Exocytosis type expression system pES2c and preparation method | |
| Spahiu | Determinants of Staphylococcus aureus colonization and infection: Characterization of interaction between serine-aspartate containing protein D and human Siglec11 and Siglec16 | |
| RU2565545C1 (en) | RECOMBINANT PLASMID DNA pFLAG-sc14D5a-Rm7 ENSURING SYNTHESIS OF HYBRID PROTEIN sc14D5a-Rm7, BACTERIA STRAIN Escherichia coli - PRODUCER OF HYBRID PROTEIN sc14D5a-Rm7, AND HYBRID PROTEIN sc14D5a-Rm7, COMBINING PROTEIN E OF TICK-BORNE ENCEPHALITIS MICE AND HAVING BIO-LUMINESCENCE ACTIVITY | |
| CN112225815A (en) | Milk, wheat, peanut and soybean allergen fusion protein and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |