CN107916276B - A kind of novel T cell immunomodulator bioactivity detection method - Google Patents
A kind of novel T cell immunomodulator bioactivity detection method Download PDFInfo
- Publication number
- CN107916276B CN107916276B CN201711256804.8A CN201711256804A CN107916276B CN 107916276 B CN107916276 B CN 107916276B CN 201711256804 A CN201711256804 A CN 201711256804A CN 107916276 B CN107916276 B CN 107916276B
- Authority
- CN
- China
- Prior art keywords
- cell
- gene
- sequence
- reporter gene
- sleeping beauty
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/90—Vectors containing a transposable element
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Plant Pathology (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to biomedicine technical fields, specifically disclose a kind of novel T cell immunomodulator bioactivity detection method.The present invention will express the reporter gene of the eukaryon expression plasmid and coexpression resistant gene, different response element drivings of sleeping beauty's transposase, and in the eukaryon expression plasmid of reporter gene and coexpression resistant gene both ends insertion transposons inverted repeats, it is transferred to host's Jurkat T cell jointly, pressurized screening and the isolated stable monoclonal effector cell of monoclonal, target cell and T cell activation regulator is added, the bioactivity of T cell immunomodulator is measured by the activity of measurement report gene.Present invention could apply to the bioactivity reporter gene method detection architectures of the cell immunomodulators such as PD-1/PD-L1 monoclonal antibody, CTAL4-Fc fusion protein.The present invention does not need the cell component of anyone blood sources or other ingredients, test result are stablized, and easy to operate, the testing time is short, is particularly suitable for the later period to Control of drug quality and batch clearance detection, can be widely applied.
Description
Technical field
The present invention relates to biomedicine technical fields, concretely relate to a kind of using the foundation of sleeping beauty's Transposon System
The bioactivity detection method of T cell immunomodulator.
Background technique
The also known as removable gene of transposons, jumping gene are that one kind can be inserted into and cut off in genome and can change certainly
The DNA sequence dna of body position.Early in the 1950s, being found in corn by McClintock first, then again successively thin
It is found in bacterium, fungi and animals and plants, such as the Tn5 in bacterium, the Ty in yeast and the piggyBac from lepidopterous insects
Transposons etc..Sleeping beauty (Sleeping Beauty, SB) transposon system is a member in Tc1/mariner transposons superfamily,
It has inactivated more than 1,000 ten thousand years；1997, according to the system of accumulation data occurred for Ivics etc., utilized the side of bioinformatics
Method carries out molecule reconstruction to it, has waken up its transposition activity finally, restores skip capability, therefore named " sleeping beauty ".SB turns
Stand consists of two parts, transposase gene and the both ends inverted repeats (terminal that can be identified by transposase
Inverted repeat, ITR).The protein of 340 amino acid of open reading frame codes of transposase, it can be with both ends
Inverted repeats combine, promote the generation of swivel base.The inverted repeats at both ends is about 230bp, by the 32bp in outside
Inverted repeats, inside direct repeat (DR) similar with IR and between the two at a distance of 165bp-166bp segment 3
The composition such as a part.DR is the bond area of transposase, is the strict conservation area of transposons.
SB transposons carries out swivel base using the mechanism of action of classical " shearing-stickup " (Cut-and-Paste).Transposase
Specific recognition DR, with a kind of intracellular highly conserved albumen-High mobility group box-1 (high mobility group
Box-1 protein, HMGB1) combine form protrusion compound；At this point, the excision of swivel base enzymatic transposons, discharges transposons
Sequence, and be inserted on new integration site.Under normal circumstances, the TA being integrated into genome that SB transposons can be specific is bis-
Nucleotide site.
It is then to separate two functional components (transposase and ITR) of SB transposons, by the two in actual research
Ingredient is constructed with double-mass model system；The sequence of encoding transposase gene is separated from transposons, is built into one
A independent expression vector, and the original position of transposase gene then can be by other DNA sequence dnas (interest genes and Xiang Guanqi
Mover etc.) it replaces, it is built into another carrier；Using this double-mass model system, SB transposons can carry exogenous DNA array
It is integrated on chromosome, and is expressed in cell and internal stablize.It is apparent that sleeping beauty transposon stand will become natural and be easy to control
DNA sequence dna transfer vector, and become genetic engineering include widely used tool in field of gene.
Genes delivery system can be divided into integrated and circles system at present, wherein can be by foreign gene stable integration
Integration type system to eucaryon host chromosome includes retroviral vector, slow virus carrier and sleeping beauty, piggyBac
(PB) Transposon System.Relative to other common gene delivery vectors, sleeping beauty transposon stand has its unrivaled advantage:
1. foreign gene permanent integration can be inserted on host chromosome genome；2. industrialized production is simple, cheap；3. immunogene
Property it is low, in vivo it is highly-safe；4. having very big foreign gene capacity packing, or even the BACs of 100kb or more can be packed.
The inhibition of t lymphocyte (Thymus-dependent lymphocyte, abbreviation T cell) function or
Activation plays particularly important effect in tumour immunity, autoimmune disease and graft-rejection.The activation of T cell relies on
The accurate careful regulation of " dual signal " system.CD3/TCR (T cell of one activation signal in T cell
Receptor, T cell receptor) compound and the ajor histocompatibility on antigen presenting cell or other cell types it is compound
Body (major histocompatibility complex, MHC) and antigenic compound；Another comes from costimulatory molecules
The transmitting of the signal of (CD28, OX40,4-1BB) and Co inhibitor (CTLA4, PD-L1, PD-1).For example originating from T cell
The combination of costimulatory signal receptor CD28 and the CD80/86 on antigen presenting cell stimulate t cell activation.If logical to the signal
Road is adjusted, and such as passes through the combination of CTLA-4 Reverse transcriptase CD28 and CD80/86, can block second signal costimulatory signal
Access.Or for example anti-CTLA-4 antibody of antibody, PD-1 antibody, PD-L1 antibody by the way that coinhibitory signals molecule is added, then it can solve
Except the inhibition to t cell activation.Or anti-cd 3 antibodies competitive binding CD3/TCR compound is added, to block the first letter
Number access, it is final to realize the effect for T cell activity being adjusted (inhibit or activation).Based on this, emerges and largely listed
Or related molecular events and the drug that designs, hereafter referred to collectively as T cell activation tune during grinding for T cell activation
Save agent.T cell activation level is detected, is assessing its drug effect when developing such drug based on cellular level
The important indicator controlled with quality in production.
The measuring method of the bioactivity of T cell activation regulator general at present is to use mixed lymphocyte reaction (MLP),
Biological activity determination is usually carried out using human peripheral blood mononuclear cell (PBMC), however this method variability is big, it is at high cost,
Method durability and less reproducible.Its measuring method is to test T cell activation regulator in mixed lymphocyte reaction (MLP) to T
The influence that cell Proliferation and cell factor IFN-Y and IL-2 secretion generate.User's CD3+T cell enrichment column is purified from PBMC
Human T-cell, the tree of T cell and 104 allogenes that every part of culture purifies in the total volume of 200 μ l comprising 105
Prominent cell；The T cell activation regulator of various concentration is added into every part of culture, cell is cultivated 5 days in 37 DEG C；5 days
Afterwards, measurement of the 100 μ l culture mediums for cell factor is taken out from every part of culture.It is surveyed using cytokine test kit
Measure the level of the cell factors such as IFN-Y and IL-2.CCK8 reagent [2- (2- methoxyl group -4- nitrobenzophenone) -3- can be added simultaneously
(4- nitrobenzophenone) -5- (2,4- disulfonic acid benzene) -2H- tetrazolium monosodium salt] test T cell proliferation；This traditional bioactivity
Test method, which needs to acquire, separates enough Fresh human peripheral's blood monocytes (PBMC), is trained by prolonged (2-5 days)
The expression of cell factor in cell proliferative conditions and supernatant is measured after supporting.These traditional methods exist the time required to compared with
It is long, higher cost, and also method itself is easy to be influenced by PBMC activity difference between different human body, and larger wait of variability lacks
Point.
The prior art can't solve above-mentioned technical difficulty.
Summary of the invention
Exogenous gene high-efficient, as gene transfer vector, is integrated into T cell using sleeping beauty's Transposon System by the present invention,
Establish a kind of bioactivity detection method of novel T cell immunomodulator.Trans- turn of present invention T cell activation gene
The expression of controlling element driving reporter gene is recorded, and with sleeping beauty's Transposon System by its stable integration to Jurkat T cell
On, and the first signal and the second signal are added simultaneously, by the activity of test report gene, to detect T cell activation regulator
Bioactivity.The cell component of anyone blood sources is not needed using the reporter gene detection method that sleeping beauty transposon stand is established
Or other compositions, test result stablize, easy to operate, the required testing time is short, be particularly suitable for the later period to Control of drug quality with
And batch is let pass and is detected, and can be widely applied.
The present invention provides a kind of report bases that T cell activation regulator bioactivity is established with sleeping beauty's Transposon System
Because of detection method, which comprises
Step 1: the Reporter gene vector building of the trans- transcriptional regulatory element driving of T cell activation gene；The report
Gene is luciferase.
Step 2: sleeping beauty transposon stand inverted terminal repeat sequence is inserted at luciferase genes both ends；
Step 3: the expression vector of transposase is constructed；
Step 4: the double-mass model system electricity of sleeping beauty transposon stand is turned into Jurkat T cell, screening expression T cell activation base
The stable cell line of the reporter gene of the trans- transcriptional regulatory element driving of cause；
Step 5: detecting the bioactivity of T cell activation regulator, and detection method includes: in the first signal
Under the collective effect of second signal, stable cell line is activated in step 4, the trans- transcriptional control member of T cell activation gene
The reporter gene expression up-regulation or decline of part driving, it is synchronous that T cell activation regulator is added, pass through the expression of examining report gene
T cell activation regulator biological activity is quantitatively evaluated in amount.
Wherein, in the step 1, the T cell activation gene be selected from IL-2, NFAT, FoxP3, CD40, OX40,
Any one of CD137 or STAT3, preferably IL-2.
Wherein, in the step 1, the trans- transcriptional regulatory element is selected from IL-2 promoter, CD28response
Any one of element, NFAT response element or STAT3response element, preferably IL-2 starting
Son.
Wherein, left arm sequence (the SEQ ID in the step 2, in sleeping beauty transposon stand inverted terminal repeat sequence
No.1) are as follows: AAGTCGGAAGTTTACATACACTTAAGTTGGAGTCATTAAAACTCGTTTTTCAACTA CTCCACAAATT
TCTTGTTAACAAA CAATAGTTTTGGCAAGTCAGTTAGGACATCTACTTTGTGCATGACACAAGTCATTTTTCCAA
CAATTGTTTACAGACAGA TTATTTCACTTATAATTCACTGTATCACAATTCCAGTGGGTCAGAAGTTTACATACA
CTAA；Right arm sequence (SEQ ID No.2) are as follows: TGAGTGTATGTAAACTTCTGACCCACTGGGAATGTGATGAAAGAAAT
AAAAGCTGAAATGAATCATTCTCT CTACTATTATTCTGATATTTCACATTCTTAAAATAAAGTGGTGATCCTAAC
TGACCTAAGACAGGGAATTTTTACTAGGA TTAAATGTCAGGAATTGTGAAAAAGTGAGTTTAAATGTATTTGGCT
AAGGTGTATGTAAACTTCCGACTTCAACTG。
Wherein, in the step 3, the transposase is selected from SB10, SB11 or SB100X, preferably SB11.
Wherein, the gene order (SEQ ID No.3) of the SB11 transposase are as follows:
ATGGGAAAATCAAAAGAAATCAGCCAAGACC TCAGAAAAAAAATTGTAGACCTCCACAAGTCTGGTTCATCCTTG
GGAGCAATTTCCAAACGCCTGAAAGTACCACGTTCA TCTGTACAAACAATAGTACGCAAGTATAAACACCATGGG
ACCACGCAGCCGTCATACCGCTCAGGAAGGAGACGCGTTCT GTCTCCTAGAGATGAACGTACTTTGGTGCGAAAA
GTGCAAATCAATCCCAGAACAACAGCAAAGGACCTTGTGAAGATGC TGGAGGAAACAGGTACAAAAGTATCTATA
TCCACAGTAAAACGAGTCCTATATCGACATAACCTGAAAGGCCGCTCAGCA AGGAAGAAGCCACTGCTCCAAAAC
CGACATAAGAAAGCCAGACTACGGTTTGCAAGAGCACATGGGGACAAAGATCGTAC TTTTTGGAGAAATGTCCTC
TGGTCTGATGAAACAAAAATAGAACTGTTTGGCCATAATGACCATCGTTATGTTTGGAGGA AGAAGGGGGAGGCT
TGCAAGCCGAAGAACACCATCCCAACCGTGAAGCACGGGGGTGGCAGCATCATGTTGTGGGGGTGC TTTGCTGCA
GGAGGGACTGGTGCACTTCACAAAATAGATGGCATCATGAGGAAGGAAAATTATGTGGATATATTGAAGCA ACAT
CTCAAGACATCAGTCAGGAAGTTAAAGCTTGGTCGCAAATGGGTCTTCCAACAAGACAATGACCCCAAGCATACTT
CCAAACACGTGAGAAAATGGCTTAAGGACAACAAAGTCAAGGTATTGGAGTGGCCATCACAAAGCCCTGACCTCAA
TCCT ATAGAAAATTTGTGGGCAGAACTGAAAAAGCGTGTGCGAGCAAGGAGGCCTACAAACCTGACTCAGTTACA
CCAGCTCTG TCAGGAGGAATGGGCCAAAATTCACCCAACTTATTGTGGGAAGCTTGTGGAAGGCTACCCGAAACG
TTTGACCCAAGTTA AACAATTTAAAGGCAATGCTACCAAATACTAG。
Wherein, in the step 5, the first signal and the second signal be CD3 antibody and expression CD80/86 cell,
The cell of CD3 antibody and expression PD-1/PD-L1.
The present invention also provides the T for including CTLA4-Fc fusion protein, PD-1 monoclonal antibody and PD-L1 monoclonal antibody
The bioactivity detection method of cell activation regulator.
The present invention also provides in CTLA4-Fc fusion protein, PD-1 monoclonal antibody and PD-L1 monoclonal antibody Quality Control
In application.
The identical meanings that there are all scientific and technical terminologies used herein those of ordinary skill in the art to be understood.
Wherein, the Jurkat is people's Pancytopenia cell；
The IL-2 promoter sequence (SEQ ID No.4) is AAAATTTTCTGAGTTACTTTTGTATCCCCACCCCC
TTAAA GAAAGGAGGAAAAACTGTTTCATACAGAAGGCGTTAATTGCATGAATTAGAGCTATCACCTAAGTGTGGG
CTAATGTAAC AAAGAGGGATTTCACCTACATCCATTCAGTCAGTCTTTGGGGGTTTAAAGAATTCCAAAGAGTCA
TCAGAAGAGGAAAAA TGAAGGTAATGTTTTTTCAGACAGGTAAAGTCTTTGAAAATATGTGTAATATGTAAAACA
TTTTGACACCCCCATAATAT TTTTCCAGAATTAACAGTATAAATTGCATCTCTTGTTCAAGAGTTCCCTATCACT
CTCTTTAATCACTACTCACAGTAAC CTCAACTCCTGCCAC；
NFAT response element (the NFAT response element) sequence (SEQ ID No.5) is GGAGGAAAAA
CTGTTTCATACAGAAGGCGTGGAGGAAAAAC TGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAA
GGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTG GAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAA
CTGTTTCATACAGAAGGCGT。
To be any in ipilimumab, tremelimumab, PD-1 monoclonal antibody is the CTLA4 monoclonal antibody
It is any in nivolumab, pembrolizumab, PD-L1 monoclonal antibody be Atezolizumab, BMS936559,
It is any in Durvalumab, Avelumab.
Compared with the prior art, the present invention has the following advantages:
Currently, the country, which there is no, establishes reporter gene detection method using sleeping beauty transposon stand, T cell activation is adjusted to realize
The relevant report that agent bioactivity is quantitatively evaluated, the present invention have filled up this blank.The present invention uses sleeping beauty transposon stand
System-mediated obtains luciferase report gene stable cell line, transfects compared to common exogenous plasmid and obtains stable cell line
Positive rate is high, and efficiently, cell generation is more stable, is more suitable for for establishing test bioactivity, more stable reporter gene for integration
Detection method.In addition, compared with the experimental system for using primary T cells to be detected, detection method provided by the present invention is not necessarily to
Using human peripheral, solves experimental result one caused by current human peripheral source difficulty and the peripheral blood in different people source
This poor problem of cause property；And be not necessarily to while separating primary T cells, avoid cumbersome PBMC separation and T cell magnetic bead
The processes such as sorting shorten experiment flow, simplify laboratory operating procedures.The present invention establishes T cell activation using sleeping beauty transposon stand
The bioactivity reporter gene detection method of regulator, method is stablized, easy to operate, controls T cell activation regulator quality
It is of great significance with clinical application.
Detailed description of the invention
The pGL4.15-IL-2P Vector map of Fig. 1 insert end inverted repeats；
The pGL4.15-NFAT Vector map of Fig. 2 insert end inverted repeats；
The pcDNA3.1-SB11 Vector map of Fig. 3 insertion SB11 transposase sequence；
Fig. 4 screens the luciferase activity test of different IL2P-LUC positive colonies；
Fig. 5 screens the luciferase activity test of different NFAT-LUC positive colonies；
The foundation of the biological activity test method of Fig. 6 .CTLA4-Fc fusion protein；
The foundation of the biological activity test method of Fig. 7 .PD-1 monoclonal antibody；
The specificity of the biological activity test method of Fig. 8 .CTLA4-Fc fusion protein；
The stability of the biological activity test method of Fig. 9 .CTLA4-Fc fusion protein.
Specific embodiment
The detailed implementation method of the present invention is referring to embodiment, experimental method as described in the examples and reagent, if without special
Explanation is routine experiment method and reagent.Following embodiment is merely to illustrate and explain the present invention, rather than in any way
The limitation present invention.
A kind of reporter gene detection method for establishing T cell activation regulator bioactivity with sleeping beauty's Transposon System,
The described method includes:
Step 1: the Reporter gene vector building of the trans- transcriptional regulatory element driving of T cell activation gene；The report
Gene is luciferase.
Step 2: sleeping beauty transposon stand inverted terminal repeat sequence is inserted at luciferase genes both ends；
Step 3: the expression vector of transposase is constructed；
Step 4: the double-mass model system electricity of sleeping beauty transposon stand is turned into Jurkat T cell, screening expression T cell activation base
The stable cell line of the reporter gene of the trans- transcriptional regulatory element driving of cause；
Step 5: detecting the bioactivity of T cell activation regulator, and detection method includes: in the first signal
Under the collective effect of second signal, stable cell line is activated in step 4, the trans- transcriptional control member of T cell activation gene
The reporter gene expression up-regulation or decline of part driving, it is synchronous that T cell activation regulator is added, pass through the expression of examining report gene
T cell activation regulator biological activity is quantitatively evaluated in amount.
Preferably, in the step 1, the T cell activation gene be selected from IL-2, NFAT, FoxP3, CD40, OX40,
Any one of CD137 or STAT3, preferably IL-2.
It is further preferred that the trans- transcriptional regulatory element is selected from IL-2 promoter, CD28 in the step 1
Any one of response element, NFAT response element or STAT3response element, preferably
IL-2 promoter.
It is further preferred that the left arm sequence (SEQ in the step 2, in sleeping beauty transposon stand inverted terminal repeat sequence
ID No.1) are as follows: AAGTCGGAAGTTTACATACACTTAAGTTGGAGTCATTAAAACTCGTTTTTCAACTA CTCCACAA
ATTTCTTGTTAA CAAACAATAGTTTTGGCAAGTCAGTTAGGACATCTACTTTGTGCATGACACAAGTCATTTTTC
CAACAATTGTTTACAGA CAGATTATTTCACTTATAATTCACTGTATCACAATTCCAGTGGGTCAGAAGTTTACAT
ACACTAA；Right arm sequence (SEQ ID No.2) are as follows: TGAGTGTATGTAAACTTCTGACCCACTGGGAATGTGATGAAAGA
AATAAAAGCTGAAATGAATCATTCT CTCTACTATTATTCTGATATTTCACATTCTTAAAATAAAGTGGTGATCCT
AACTGACCTAAGACAGGGAATTTTTACTAG GATTAAATGTCAGGAATTGTGAAAAAGTGAGTTTAAATGTATTTG
GCTAAGGTGTATGTAAACTTCCGACTTCAACTG。
It is further preferred that the transposase is selected from SB10, SB11 or SB100X, preferably SB11 in the step 3.
It is further preferred that the gene order (SEQ ID No.3) of SB11 transposase are as follows:
ATGGGAAAATCAAAAGAAATCAGCCAAGAC CTCAGAAAAAAAATTGTAGACCTCCACAAGTCTGGTTCATCCTTG
GGAGCAATTTCCAAACGCCTGAAAGTACCACGTTC ATCTGTACAAACAATAGTACGCAAGTATAAACACCATGGG
ACCACGCAGCCGTCATACCGCTCAGGAAGGAGACGCGTTC TGTCTCCTAGAGATGAACGTACTTTGGTGCGAAAA
GTGCAAATCAATCCCAGAACAACAGCAAAGGACCTTGTGAAGATG CTGGAGGAAACAGGTACAAAAGTATCTATA
TCCACAGTAAAACGAGTCCTATATCGACATAACCTGAAAGGCCGCTCAGC AAGGAAGAAGCCACTGCTCCAAAAC
CGACATAAGAAAGCCAGACTACGGTTTGCAAGAGCACATGGGGACAAAGATCGTA CTTTTTGGAGAAATGTCCTC
TGGTCTGATGAAACAAAAATAGAACTGTTTGGCCATAATGACCATCGTTATGTTTGGAGG AAGAAGGGGGAGGCT
TGCAAGCCGAAGAACACCATCCCAACCGTGAAGCACGGGGGTGGCAGCATCATGTTGTGGGGGTG CTTTGCTGCA
GGAGGGACTGGTGCACTTCACAAAATAGATGGCATCATGAGGAAGGAAAATTATGTGGATATATTGAAGC AACAT
CTCAAGACATCAGTCAGGAAGTTAAAGCTTGGTCGCAAATGGGTCTTCCAACAAGACAATGACCCCAAGCATACT
TCCAAACACGTGAGAAAATGGCTTAAGGACAACAAAGTCAAGGTATTGGAGTGGCCATCACAAAGCCCTGACCTCA
ATCC TATAGAAAATTTGTGGGCAGAACTGAAAAAGCGTGTGCGAGCAAGGAGGCCTACAAACCTGACTCAGTTAC
ACCAGCTCT GTCAGGAGGAATGGGCCAAAATTCACCCAACTTATTGTGGGAAGCTTGTGGAAGGCTACCCGAAAC
GTTTGACCCAAGTT AAACAATTTAAAGGCAATGCTACCAAATACTAG。
It is further preferred that the first signal and the second signal are CD3 antibody and expression CD80/86 in the step 5
Cell, CD3 antibody and the cell for expressing PD-1/PD-L1.
A kind of T cell activation tune comprising CTLA4-Fc fusion protein, PD-1 monoclonal antibody and PD-L1 monoclonal antibody
Save the bioactivity detection method of agent.
A kind of application in CTLA4-Fc fusion protein, PD-1 monoclonal antibody and PD-L1 monoclonal antibody Quality Control.
Embodiment 1: the building of sleeping beauty transposon stand double-mass model system
1.pGL4.15-IL-2P the building of Reporter gene vector building and pGL4.15-NFAT Reporter gene vector
(1) full genome synthesis IL-2 promoter (- 329 to+48), wherein upstream has KpnI restriction enzyme site GGTACC,
Downstream belt HindIII restriction enzyme site AAGCTT, IL-2 promoter (- 329 to+48) complete sequence is as follows:
GGTACCGAAAATTTTCTGAGTTACTTTTGTATCCCCACCCCCTTAAAGAAAGGAGGAAAAACTGTTTC
ATACAGAA GGCGTTAATTGCATGAATTAGAGCTATCACCTAAGTGTGGGCTAATGTAACAAAGAGGGATTTCACC
TACATCCATTCAG TCAGTCTTTGGGGGTTTAAAGAATTCCAAAGAGTCATCAGAAGAGGAAAAATGAAGGTAATG
TTTTTTCAGACAGGTAAA GTCTTTGAAAATATGTGTAATATGTAAAACATTTTGACACCCCCATAATATTTTTCC
AGAATTAACAGTATAAATTGCAT CTCTTGTTCAAGAGTTCCCTATCACTCTCTTTAATCACTACTCACAGTAACC
TCAACTCCTGCCACAAAGCTT。
IL-2 promoter is inserted by full genome synthetic product and pGL4.15 plasmid after KpnI and HindIII digestion
On pGL4.15 carrier.PGL4.15-IL-2P plasmid is constructed, is sequenced, it is as a result completely correct.
(2) full genome synthesizes 6X NFAT response element, and wherein upstream has KpnI restriction enzyme site GGTACC, downstream belt
HindIII restriction enzyme site AAGCTT, 6X NFAT response element complete sequence is as follows:
GGTACCGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGG
AGGAAAAA CTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTC
ATACAGAAGGCGT GGAGGAAAAACTGTTTCATACAGAAGGCGTAGATCTAGACTCTAGAGGGTATATAATGGAAG
CTCGAATTCCAGCTTGGC ATTCCGGTACTGTTGGTAAAAAGCTT；
NFAT response element is inserted by full genome synthetic product and pGL4.15 plasmid after KpnI and HindIII digestion
On pGL4.15 carrier.PGL4.15-NFAT plasmid is constructed, is sequenced, it is as a result completely correct.
2. being inserted into sleeping beauty transposon stand inverted terminal repeat sequence (Inverted Terminal at reporter gene both ends
Rrepeat, ITR)
Full genome synthesizes ITR (L) and ITR (R) inverted terminal repeat sequence, and wherein ITR (L) sequence is through kpnI single endonuclease digestion,
ITR (R) is inserted on the correct pGL4.15-IL-2P and pGL4.15-NFAT carrier of sequencing respectively through SalI single endonuclease digestion.It closes
At sequence it is as follows:
ITR (L) sequence:
GGTACCCAGTTGAAGTCGGAAGTTTACATACACTTAAGTTGGAGTCATTAAAACTCGTTTTTCAACTA
CTCCACAA ATTTCTTGTTAACAAACAATAGTTTTGGCAAGTCAGTTAGGACATCTACTTTGTGCATGACACAAGT
CATTTTTCCAACA ATTGTTTACAGACAGATTATTTCACTTATAATTCACTGTATCACAATTCCAGTGGGTCAGAA
GTTTACATACACTAAGGT ACC；
ITR (R) sequence:
GTCGACTTGAGTGTATGTAAACTTCTGACCCACTGGGAATGTGATGAAAGAAATAAAAGCTGAAATGA
ATCATTCT CTCTACTATTATTCTGATATTTCACATTCTTAAAATAAAGTGGTGATCCTAACTGACCTAAGACAGG
GAATTTTTACTAG GATTAAATGTCAGGAATTGTGAAAAAGTGAGTTTAAATGTATTTGGCTAAGGTGTATGTAAA
CTTCCGACTTCAACTGGT CGAC；
It is correctly inserted into the pGL4.15-IL-2P Vector map and pGL4.15-NFAT Vector map of inverted terminal repeat sequence
See Fig. 1 and Fig. 2.
3. constructing the expression vector of transposase
Full genome synthesizes SB11 transposase gene, and upstream carries BamH I restriction enzyme site, and downstream carries Not I digestion position
Point, composition sequence are as follows；By sequence after BamH I and Not I double digestion, it is inserted on pcDNA3.1 carrier for expression of eukaryon, structure
The Vector map built is shown in Fig. 3.
SB11 transposase gene sequence:
GGATCCGCCACCATGGGAAAATCAAAAGAAATCAGCCAAGACCTCAGAAAAAAAATTGTAGACCTCCA
CAAGTCTG GTTCATCCTTGGGAGCAATTTCCAAACGCCTGAAAGTACCACGTTCATCTGTACAAACAATAGTACG
CAAGTATAAACAC CATGGGACCACGCAGCCGTCATACCGCTCAGGAAGGAGACGCGTTCTGTCTCCTAGAGATGA
ACGTACTTTGGTGCGAAA AGTGCAAATCAATCCCAGAACAACAGCAAAGGACCTTGTGAAGATGCTGGAGGAAAC
AGGTACAAAAGTATCTATATCCA CAGTAAAACGAGTCCTATATCGACATAACCTGAAAGGCCGCTCAGCAAGGAA
GAAGCCACTGCTCCAAAACCGACATAAG AAAGCCAGACTACGGTTTGCAAGAGCACATGGGGACAAAGATCGTAC
TTTTTGGAGAAATGTCCTCTGGTCTGATGAAAC AAAAATAGAACTGTTTGGCCATAATGACCATCGTTATGTTTG
GAGGAAGAAGGGGGAGGCTTGCAAGCCGAAGAACACCA TCCCAACCGTGAAGCACGGGGGTGGCAGCATCATGTT
GTGGGGGTGCTTTGCTGCAGGAGGGACTGGTGCACTTCACAAA ATAGATGGCATCATGAGGAAGGAAAATTATGT
GGATATATTGAAGCAACATCTCAAGACATCAGTCAGGAAGTTAAAGCT TGGTCGCAAATGGGTCTTCCAACAAGA
CAATGACCCCAAGCATACTTCCAAACACGTGAGAAAATGGCTTAAGGACAACA AAGTCAAGGTATTGGAGTGGCC
ATCACAAAGCCCTGACCTCAATCCTATAGAAAATTTGTGGGCAGAACTGAAAAAGCGT GTGCGAGCAAGGAGGCC
TACAAACCTGACTCAGTTACACCAGCTCTGTCAGGAGGAATGGGCCAAAATTCACCCAACTTA TTGTGGGAAGCT
TGTGGAAGGCTACCCGAAACGTTTGACCCAAGTTAAACAATTTAAAGGCAATGCTACCAAATACTAGG CGGCCGC。
Embodiment 2:IL-2 promoter drives luciferase stable cell line and NFAT RE driving luciferase to stablize cell
The acquisition of strain
1. sleeping beauty transposon stand system combination reporter gene is to Jurkat host cell
(1) sleeping beauty's double-mass model system transfections host cell
(1) shift to an earlier date 1 day passage Jurkat cell；
(2) it takes in dual anti-two holes that 6 orifice plates are added of+10% cow's serum of RPMI1640 growth medium+1%, the hole 2ml/, In
It is preheated in incubator；Separately 220 μ l Cell line Nucleofector Solution V is taken to preheat 10min in the incubator；
(3) take 5 μ g pGL4.15-IL-2P plasmids, 5 μ g pGL4.15-NFAT plasmids in two EP pipes respectively, then
0.5 μ g pcDNA3.1-SB11 plasmid mixing for standby use is respectively added again；
(4) Nucleofector electroporation is switched on, option program X-001；
(5) Jurkat cell counts, and divides and takes 1,000,000 cells in 1 centrifuge tube, and totally two, 90g is centrifuged 5min, abandons
Supernatant to the greatest extent；
(6) 100 μ l are taken to be added in cell precipitation the Cell line Nucleofector Solution V of preheating, after
Featheriness mixes, and cell suspension addition is placed in the EP pipe of plasmid, then featheriness is gone in electric revolving cup；
(7) electric revolving cup is put into electroporation, presses ' X ' key, after completing electricity turn, take 500 μ l pre- with the suction pipe that kit provides
The culture medium of heat is added after pressure-vaccum is omited in electric revolving cup bottom and cell is sucked out, and adds in the 6 orifice plates that 1ml preheating culture medium has been added, after
Continuous culture is for 24 hours.
(2) pressurization screening and stable monoclonal cell strain are separately cultured
(1) Hygromycin selection media after transfecting for 24 hours, is added, screens 3 weeks, the Selective agar medium of replacement in every 3-4 days；
(2) entirely dead to cellular control unit, screening is completed.It counts, Selective agar medium is diluted to 30 cell/15ml, 150 μ
The hole l/ is spread to U-96 orifice plate；
(3) with Selective agar medium culture 2 weeks, microscopically observation selects the cell hole of monoclonal growth, and is transferred to
24 orifice plates, 1 Zhou Houzai reach 6 orifice plates and expand culture.
(3) stablize the detection of monoclonal cell strain effector function
The effect detection of 1.IL-2P LUC positive colony cell
(1) Jurkat IL-2P Luc cell is counted, culture medium is diluted to 2,000,000 cell/ml；
(2) Raji cell is counted, culture medium is diluted to 2,000,000 cell/ml；
(3) the above two cell diluted is mixed in equal volume, is spread according to the density in 100 holes μ l/ to 96 orifice plate of the bottom V；
(3) CD3 antibody is diluted to final concentration of 0.4 μ g/ml with Selective agar medium, added according to the volume in 100 holes μ l/
To in above-mentioned 96 orifice plate of the bottom V, pressure-vaccum makes it mix it with cell；
(4) cell cultivates 6h in carbon dioxide incubator；
(5) 3000rpm is centrifuged 5min, sucks cell conditioned medium, and lysate Glo-lysis, lysis at room temperature is added in 50 holes μ l/
5min；
(6) 10 μ l cell lysates are drawn and are transferred to white 384 orifice plates, luciferase substrate Bright-Glo is added
5min is reacted in 10 hole μ l/ Luciferase Assay System, detects luciferase activity.
So that cell is activated after CD3 antibody and Raji costimulation cell and express IL-2, compared with non-stimulated control group,
IL-2 expression quantity obviously increases, and illustrates that CD3 antibody and Raji costimulation can activate the stable cell line that it is made to express IL-2,
Fig. 4 is shown in the expression of synchronous stimulation reporter gene luciferase.The single cell clone for choosing 10 hygromycin resistances (numbers respectively and is
1,2,3,4,5,6,7,8,9,10) CD3 antibody, is respectively added and after Raji cell co-stimulatory 6 hours, tests luciferase activity
Visible 10 selected relatively non-stimulated control groups of clone are obviously activated from Fig. 4 test result, wherein No. 6 clone fireflies
Light element enzymatic activity value highest shows that No. 6 clone's responses are most sensitive.No. 6 clones are chosen in subsequent experimental to be tested.
The effect detection of 2.NFAT LUC positive colony cell
(1) PDL1-CD3 overexpressing cell is counted, culture medium is diluted to 1,000,000 cell/ml, by 50 holes μ l/ access 96
Hole U bottom plate；
(2) sample dilutes: in 96 porocyte plates, PD-1 monoclonal antibody Nivolumab being carried out 4 times by 400 μ g/ml
Gradient dilution, totally 10 dilutions.3 multiple holes of each gradient after having diluted sample, are added to DC cell by 50 μ l/ pore volumes
In.
(3) Jurkat NFAT Luc drug resistance monoclonal cell is counted, culture medium is diluted to 1,000,000 cell/ml；
100 μ l of cell suspension is added in every hole, and 37 DEG C, 5%CO2 is cultivated 6 hours.
(4) 3000rpm is centrifuged 5min, sucks cell conditioned medium, and lysate Glo-lysis, lysis at room temperature is added in 50 holes μ l/
5min；
(5) 10 μ l cell lysates are drawn and are transferred to white 384 orifice plates, luciferase substrate Bright-Glo is added
5min is reacted in 10 hole μ l/ Luciferase Assay System, detects luciferase activity.
PD-L1 with CD3 antibody cell will be expressed together with the jurkat mixing with cells incubation for expressing PD-1, in analogue body
T cell-stimulating " dual signal " system relieves PD-1/PD-L1 coinhibitory signals to T after PD-1 monoclonal antibody is added
The luciferase activity of the inhibition of cell-stimulating, NFAT driving enhances (Fig. 5).Choose the single cell clone of 4 hygromycin resistances
(number is 1,2,3,4 respectively), tests response of 4 clones to the PD-1 monoclonal antibody of various concentration, and test result shows 4
Number clone is best to PD-1 monoclonal antibody response curve, and sensitivity and correlation are good compared with other 3 clones.In subsequent reality
No. 4 best clones of middle selection response are tested to be tested.
The test of embodiment 3:T cell activator bioactivity
The test of 1.CTLA4-Fc fusion protein bioactivity
The IL2 that screening is obtained and the positively related IL-2P Luc positive cell strain of luciferase activity, choose No. 6 clones
Carry out subsequent experimental.It is 100,000/hole according to cell density, CTLA4-Fc initial concentration is 67 μ g/ml, 10 times of multiple proportions series
13 gradients are diluted, totally 14 concentration points.CTLA4-Fc acts on 6 hours detection luciferase activities.
As shown in fig. 6, after the CTLA4-Fc fusion protein of gradient dilution is added, with the increase of CTLA4-Fc concentration, firefly
Luminous intensity is gradually reduced, i.e. IL-2 expression quantity gradually decreases, it is seen that with the increase of CTLA4-Fc concentration, inhibits T cell activation
Increased activity, show that the system can be used for the biological activity of quantitative detection T cell activation regulator such as CTLA4-Fc.
The test of 2.PD-1 monoclonal antibody or PD-L1 monoclonal antibody bioactivity
The NFAT-Luc positive cell strain that screening is obtained chooses No. 4 clones and carries out subsequent experimental.Adjust target cell density
For 100,000/ml, wherein every hole cell effect target ratio is 2:1, effector cell 100,000, target cell population is 50,000, then plus
Enter PD-1 monoclonal antibody or PD-L1 monoclonal antibody.PD-1 monoclonal antibody or PD-L1 monoclonal antibody initial concentration are
400 μ g/ml, 4 times of multiple proportions are serially diluted 9 gradients, totally 10 concentration points.PD-1 monoclonal antibody or PD-L1 monoclonal antibody
Act on 6 hours detection luciferase activities.
After the PD-1 monoclonal antibody of gradient dilution is added as shown in Figure 7, with the increase of antibody concentration, fluorescence intensity by
Cumulative strong, i.e. activation T cell ability enhancing after showing that PD-1 monoclonal antibody is added to the system, releases PD-1/PD-L1 to T
The inhibition of cell-stimulating, so that T cell is activated.Show that established test system can be applied to test PD-1 monoclonal simultaneously
The bioactivity of antibody.After the PD-L1 monoclonal antibody of gradient dilution is added, with the increase of antibody concentration, fluorescence intensity by
Cumulative strong, i.e. activation T cell ability enhancing after showing that PD-L1 monoclonal antibody is added to the system, releases PD-1/PD-L1
Inhibition to t cell activation, so that T cell is activated.Show that established test system can be applied to test PD-L1 simultaneously
The bioactivity of monoclonal antibody.
Embodiment 4: the verifying of methodology
Using the unrelated IgG of homotype as negative control, the specificity of this method is assessed.As shown in figure 8, it is unrelated that homotype is added
IgG does not observe the inhibition of T cell activation, and after CTLA4-Fc fusion protein is added, T cell activation is suppressed significantly, and shows this
Method system can special response test CTLA4-Fc fusion protein biological activity.And we are using different generations (difference
For 13 generations, 25 generations, 40 generations) sleeping beauty transposon stand System-mediated IL-2P-LUC stable cell line Jurkat, it is thin to evaluate this
Born of the same parents' strain generation is to the stability influence of active testing, as shown in figure 9, using the thin of the transposon-mediated different generations of sleeping beauty
Born of the same parents' strain test result is highly stable, can be used for subsequent pharmaceutical activity evaluation and batch quality is let pass.
For the ordinary skill in the art, specific embodiment is the exemplary description carried out to the present invention,
Obviously the present invention specific implementation is not subject to the restrictions described above, it is all use the inventive concept and technical scheme of the present invention into
The improvement of capable various unsubstantialities, or not improved the conception and technical scheme of the invention are directly applied to other occasions
, it is within the scope of the present invention.
Sequence table
<110>Beijing Dongfang Baitai Biotechnology Co., Ltd.
<120>a kind of novel T cell immunomodulator bioactivity detection method
<141> 2017-12-01
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 221
<212> DNA
<213>artificial sequence (Tanichthys albonubes)
<400> 1
aagtcggaag tttacataca cttaagttgg agtcattaaa actcgttttt caactactcc 60
acaaatttct tgttaacaaa caatagtttt ggcaagtcag ttaggacatc tactttgtgc 120
atgacacaag tcatttttcc aacaattgtt tacagacaga ttatttcact tataattcac 180
tgtatcacaa ttccagtggg tcagaagttt acatacacta a 221
<210> 2
<211> 227
<212> DNA
<213>artificial sequence (Tanichthys albonubes)
<400> 2
tgagtgtatg taaacttctg acccactggg aatgtgatga aagaaataaa agctgaaatg 60
aatcattctc tctactatta ttctgatatt tcacattctt aaaataaagt ggtgatccta 120
actgacctaa gacagggaat ttttactagg attaaatgtc aggaattgtg aaaaagtgag 180
tttaaatgta tttggctaag gtgtatgtaa acttccgact tcaactg 227
<210> 3
<211> 1029
<212> DNA
<213>artificial sequence (Homo sapiens)
<400> 3
gccaccatgg gaaaatcaaa agaaatcagc caagacctca gaaaaaaaat tgtagacctc 60
cacaagtctg gttcatcctt gggagcaatt tccaaacgcc tgaaagtacc acgttcatct 120
gtacaaacaa tagtacgcaa gtataaacac catgggacca cgcagccgtc ataccgctca 180
ggaaggagac gcgttctgtc tcctagagat gaacgtactt tggtgcgaaa agtgcaaatc 240
aatcccagaa caacagcaaa ggaccttgtg aagatgctgg aggaaacagg tacaaaagta 300
tctatatcca cagtaaaacg agtcctatat cgacataacc tgaaaggccg ctcagcaagg 360
aagaagccac tgctccaaaa ccgacataag aaagccagac tacggtttgc aagagcacat 420
ggggacaaag atcgtacttt ttggagaaat gtcctctggt ctgatgaaac aaaaatagaa 480
ctgtttggcc ataatgacca tcgttatgtt tggaggaaga agggggaggc ttgcaagccg 540
aagaacacca tcccaaccgt gaagcacggg ggtggcagca tcatgttgtg ggggtgcttt 600
gctgcaggag ggactggtgc acttcacaaa atagatggca tcatgaggaa ggaaaattat 660
gtggatatat tgaagcaaca tctcaagaca tcagtcagga agttaaagct tggtcgcaaa 720
tgggtcttcc aacaagacaa tgaccccaag catacttcca aacacgtgag aaaatggctt 780
aaggacaaca aagtcaaggt attggagtgg ccatcacaaa gccctgacct caatcctata 840
gaaaatttgt gggcagaact gaaaaagcgt gtgcgagcaa ggaggcctac aaacctgact 900
cagttacacc agctctgtca ggaggaatgg gccaaaattc acccaactta ttgtgggaag 960
cttgtggaag gctacccgaa acgtttgacc caagttaaac aatttaaagg caatgctacc 1020
aaatactag 1029
<210> 4
<211> 375
<212> DNA
<213>artificial sequence (Homo sapiens)
<400> 4
aaaattttct gagttacttt tgtatcccca cccccttaaa gaaaggagga aaaactgttt 60
catacagaag gcgttaattg catgaattag agctatcacc taagtgtggg ctaatgtaac 120
aaagagggat ttcacctaca tccattcagt cagtctttgg gggtttaaag aattccaaag 180
agtcatcaga agaggaaaaa tgaaggtaat gttttttcag acaggtaaag tctttgaaaa 240
tatgtgtaat atgtaaaaca ttttgacacc cccataatat ttttccagaa ttaacagtat 300
aaattgcatc tcttgttcaa gagttcccta tcactctctt taatcactac tcacagtaac 360
ctcaactcct gccac 375
<210> 5
<211> 180
<212> DNA
<213>artificial sequence (Homo sapiens)
<400> 5
ggaggaaaaa ctgtttcata cagaaggcgt ggaggaaaaa ctgtttcata cagaaggcgt 60
ggaggaaaaa ctgtttcata cagaaggcgt ggaggaaaaa ctgtttcata cagaaggcgt 120
ggaggaaaaa ctgtttcata cagaaggcgt ggaggaaaaa ctgtttcata cagaaggcgt 180
Claims (1)
1. a kind of novel T cell immunomodulator bioactivity detection method, which is characterized in that the described method includes:
Step 1: the Reporter gene vector building of the trans- transcriptional regulatory element driving of T cell activation gene；
Full genome synthesizes the trans- transcriptional regulatory element sequence, wherein the trans- transcriptional regulatory element Sequences upstream has
KpnI restriction enzyme site GGTACC, downstream belt HindIII restriction enzyme site AAGCTT；
Full genome synthetic product and pGL4.15 plasmid are inserted on pGL4.15 carrier after KpnI and HindIII digestion, are constructed
Reporter gene vector；
In the step 1, the reporter gene is luciferase；The T cell activation gene is IL-2 or NFAT；It is described anti-
Formula transcriptional regulatory element is IL-2 promoter sequence or NFAT response element, and the IL-2 promoter sequence is SEQ ID No.4
Shown, the sequence of the NFAT response element is as shown in SEQ ID No.5；
Step 2: sleeping beauty transposon stand inverted terminal repeat sequence is inserted at luciferase genes both ends；
The left arm and right arm of full genome synthesis sleeping beauty transposon stand inverted terminal repeat sequence, wherein the sleeping beauty transposon stand
The left arm of inverted terminal repeat sequence is passed through through kpnI single endonuclease digestion, the right arm of the sleeping beauty transposon stand inverted terminal repeat sequence
SalI single endonuclease digestion is inserted into respectively on the correct Reporter gene vector described in step 1 of sequencing；
In the step 2, the sequence of the left arm of the sleeping beauty transposon stand inverted terminal repeat sequence such as SEQ ID NO:1 institute
Show, the sequence of the right arm of the sleeping beauty transposon stand inverted terminal repeat sequence is as shown in SEQ ID NO:2；
Step 3: the expression vector of transposase is constructed；
Full genome synthesizes transposase gene, wherein the transposase gene upstream carries BamH I restriction enzyme site, and downstream carries
Not I restriction enzyme site；By composition sequence after BamH I and Not I double digestion, it is inserted on pcDNA3.1 carrier for expression of eukaryon,
Construct the expression vector of transposase；
In the step 3, the transposase is SB11；The gene order of the SB11 transposase is SEQ ID No.3；
Step 4: the double-mass model system electricity of sleeping beauty transposon stand is turned into Jurkat T cell, screening IL-2 promoter drives fluorescent
Plain enzyme stable cell line or NFAT RE drive luciferase stable cell line:
The double-mass model system electricity of sleeping beauty transposon stand turns Jurkat T cell, specifically comprises the following steps:
(1) shift to an earlier date 1 day passage Jurkat cell；
(2) it takes in dual anti-two holes that 6 orifice plates are added of+10% cow's serum of RPMI1640 growth medium+1%, the hole 2ml/ is being cultivated
It is preheated in case；Separately 220 μ l Cell line Nucleofector Solution V is taken to preheat 10min in the incubator；
(3) it takes Reporter gene vector described in 5 μ g to be placed in EP pipe, then adds the expression vector of transposase described in 0.5 μ g
Mixing for standby use；
(4) Nucleofector electroporation is switched on, option program X-001；
(5) Jurkat cell counts, and takes 1,000,000 cells in 1 centrifuge tube, and 90g is centrifuged 5min, abandons supernatant to the greatest extent；
(6) 100 μ l are taken to be added in cell precipitation the Cell line Nucleofector Solution V of preheating, rear featheriness
It mixes, cell suspension addition is placed in the EP pipe of the Reporter gene vector, then featheriness is gone in electric revolving cup；
(7) electric revolving cup is put into electroporation, presses ' X ' key, after completing electricity turn, take 500 μ l to preheat with the suction pipe that kit provides
Culture medium is added after pressure-vaccum is omited in electric revolving cup bottom and cell is sucked out, and adds in the 6 orifice plates that 1ml preheating culture medium has been added, continues to train
It supports for 24 hours；
Pressurization screening and stable monoclonal cell strain are separately cultured, and are specifically comprised the following steps:
(1) Hygromycin selection media after transfecting for 24 hours, is added, screens 3 weeks, the Selective agar medium of replacement in every 3-4 days；
(2) entirely dead to cellular control unit, screening is completed, and is counted, and Selective agar medium is diluted to 30 cell/15ml, 150 holes μ l/
It spreads to U-96 orifice plate；
(3) with Selective agar medium culture 2 weeks, microscopically observation selects the cell hole of monoclonal growth, and is transferred to 24 holes
Plate, 1 Zhou Houzai reach 6 orifice plates and expand culture to get stable cell line is arrived；
Step 5: detecting the bioactivity of T cell activation regulator, and detection method includes: in the first signal and
Under the dual signal system collective effect of binary signal, stable cell line is activated in step 4, the trans- transcription of T cell activation gene
The reporter gene expression up-regulation or decline of controlling element driving, it is synchronous that T cell activation regulator is added, pass through examining report gene
Expression quantity, be quantitatively evaluated T cell activation regulator biological activity；
In the step 5, the dual signal system of the first signal and the second signal is that CD3 antibody and expression CD80/86 are thin
Born of the same parents or CD3 antibody and expression PD-1/PD-L1 cell；
The T cell activation regulator is CTLA4-Fc fusion protein, PD-1 monoclonal antibody or PD-L1 monoclonal antibody.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711256804.8A CN107916276B (en) | 2017-12-04 | 2017-12-04 | A kind of novel T cell immunomodulator bioactivity detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711256804.8A CN107916276B (en) | 2017-12-04 | 2017-12-04 | A kind of novel T cell immunomodulator bioactivity detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107916276A CN107916276A (en) | 2018-04-17 |
| CN107916276B true CN107916276B (en) | 2019-11-08 |
Family
ID=61898240
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711256804.8A Active CN107916276B (en) | 2017-12-04 | 2017-12-04 | A kind of novel T cell immunomodulator bioactivity detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107916276B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108918892B (en) * | 2018-08-01 | 2021-04-27 | 百奥泰生物制药股份有限公司 | Method for determining anti-VEGF antibody activity and application thereof |
| CN109975537B (en) * | 2019-04-09 | 2022-05-24 | 上海药明生物技术有限公司 | Kit and method for detecting activity of TIM-3 antibody |
| CN112458149B (en) * | 2020-12-03 | 2021-10-08 | 北京东方百泰生物科技股份有限公司 | Method for detecting activation degree of antibody drug on T cells by taking CD3 as target |
| CN112921004B (en) * | 2021-02-05 | 2023-08-08 | 上海精翰生物科技有限公司 | Cell strain for detecting CD3 receptor agonist, construction method thereof and CD3 receptor agonist detection method |
| CN113009157B (en) * | 2021-03-23 | 2022-03-08 | 中国食品药品检定研究院 | RGA method for detecting biological activity of anti-CTLA-4 monoclonal antibody and application thereof |
| CN116364174B (en) * | 2023-05-29 | 2023-10-03 | 普瑞基准生物医药(苏州)有限公司 | Transcription factor activity calculation method, memory and electronic equipment |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104894273A (en) * | 2015-06-11 | 2015-09-09 | 北京东方百泰生物科技有限公司 | Reporter gene detection method for biological activity of T cell activation regulator |
| CN105154473A (en) * | 2015-09-30 | 2015-12-16 | 上海细胞治疗研究院 | Efficient and safe transposable element integration system and application thereof |
-
2017
- 2017-12-04 CN CN201711256804.8A patent/CN107916276B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104894273A (en) * | 2015-06-11 | 2015-09-09 | 北京东方百泰生物科技有限公司 | Reporter gene detection method for biological activity of T cell activation regulator |
| CN105154473A (en) * | 2015-09-30 | 2015-12-16 | 上海细胞治疗研究院 | Efficient and safe transposable element integration system and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| "睡美人"转座子及其在肿瘤研究中的应用;李永文 等;《中国肺癌杂志》;20081220;第11卷(第6期);第816-818页 * |
| GenBank: JQ692169.1 ，"Cloning vector pT2/Gene-Trap, complete sequence";Song,G.,et al.;《GenBank》;20120916;FEATURES和ORIGIN部分 * |
| Gene Transfer into Genomes of Human Cells by the Sleeping Beauty Transposon System;Aron M. Geurts,et al.;《MOLECULAR THERAPY》;20030731;第8卷(第1期);摘要，第2961页左栏第1段至第2971页左栏第1段，图1 * |
| Redirecting Specificity of T-Cell Populations For CD19 Using the Sleeping Beauty System;Harjeet Singh,et al.;《Cancer Res》;20080415;第68卷(第8期);第108-117页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107916276A (en) | 2018-04-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107916276B (en) | A kind of novel T cell immunomodulator bioactivity detection method | |
| CN110691844B (en) | Methods and kits for generating simulated innate immune cells from pluripotent stem cells | |
| Myers et al. | Expression of functional RANK on mature rat and human osteoclasts | |
| Weber et al. | Trpm4 differentially regulates Th1 and Th2 function by altering calcium signaling and NFAT localization | |
| ES2887593T3 (en) | Modular polypeptide libraries and methods for making and using them | |
| Yamamoto et al. | The human perforin gene is a direct target of STAT4 activated by IL-12 in NK cells | |
| JP2002536966A (en) | Characterization of the calcium channel family | |
| US10053683B2 (en) | Intercellular labeling of ligand-receptor interactions | |
| CN111269941B (en) | Activated CAR-T cell tracing and quantifying method based on two-color fluorescence system | |
| ES2894323T3 (en) | System and products for better quantification of ADCC activity | |
| CN114019156A (en) | Quality of immune synapses predicts potency of Chimeric Antigen Receptor (CAR) T cells | |
| CN108351344B (en) | Genome-scale T cell activity arrays and methods of use thereof | |
| JP2009500021A (en) | Polynucleotides and polypeptides of the IL-12 family of cytokines | |
| Paria et al. | Rapid identification and evaluation of neoantigen-reactive T-cell receptors from single cells | |
| CN110499295A (en) | A kind of CSF-1R reporter gene cell strain and its preparation method and application | |
| CN104894273A (en) | Reporter gene detection method for biological activity of T cell activation regulator | |
| Minami et al. | Signal transduction mediated by the reconstituted IL-2 receptor. Evidence for a cell type-specific function of IL-2 receptor beta-chain. | |
| ES2208145T1 (en) | SELECTION TESTS FOR AGONISTS OR ANTAGONISTS OF NF-KB RECEIVER ACTIVATOR. | |
| Cron et al. | Consistent transient transfection of DNA into non-transformed human and murine T-lymphocytes | |
| Estelles et al. | Exosome nanovesicles displaying G protein-coupled receptors for drug discovery | |
| US8771971B2 (en) | Methods and kits for measurement of lymphocyte function | |
| Ma et al. | Structural dynamics of the yeast Shwachman-Diamond syndrome protein (Sdo1) on the ribosome and its implication in the 60S subunit maturation | |
| CN108519484A (en) | The protein interaction in living cells is imaged and tracked using the bimolecular fluorescence complementary technology from connection label | |
| CN111826398A (en) | Engineering plasmid system for displaying and detecting interaction of membrane protein between living cells | |
| US20120252051A1 (en) | Tlr8 transgenic animals |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 406, room 1, building 2, 100176 Jingdong street, Beijing economic and Technological Development Zone, Beijing, Daxing District Patentee after: Beijing Dongfang Baitai Biotechnology Co., Ltd Address before: 406, room 1, building 2, 100176 Jingdong street, Beijing economic and Technological Development Zone, Beijing, Daxing District Patentee before: Beijing Dongfang Biotech Co.,Ltd. |
|
| CP01 | Change in the name or title of a patent holder |