CN112941002A

CN112941002A - Recombinant Escherichia coli strain for producing dopamine and construction method and application thereof

Info

Publication number: CN112941002A
Application number: CN202110180874.XA
Authority: CN
Inventors: 王钦宏; 宋富强; 陈五九; 吴凤礼; 张媛媛
Original assignee: Tianjin Institute of Industrial Biotechnology of CAS
Current assignee: Tianjin Institute of Industrial Biotechnology of CAS
Priority date: 2021-02-08
Filing date: 2021-02-08
Publication date: 2021-06-11
Anticipated expiration: 2041-02-08
Also published as: CN112941002B

Abstract

The invention discloses an escherichia coli recombinant strain for producing dopamine, and a construction method and application thereof. The invention provides a recombinant bacterium, which is obtained by introducing specific DNA molecules into escherichia coli; the specific DNA molecule has a coding gene of levodopa decarboxylase. The specific DNA molecule also has a regulatory element for promoting the expression of the coding gene of the levodopa decarboxylase. The recombinant strain can be Escherichia coli TD 03. The strain can utilize a glucose inorganic salt culture medium to produce dopamine by fermentation, and the cost of the culture medium is reduced, so that the production cost of the dopamine is reduced, and the strain has the advantages of short fermentation time and high yield. The invention provides a promising alternative scheme for the green sustainable production of dopamine. This will make the dopamine-synthesizing microbial system economically more attractive, while providing the possibility for the industrial production of downstream products of the dopamine pathway.

Description

Recombinant Escherichia coli strain for producing dopamine and construction method and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to an escherichia coli recombinant strain for producing dopamine, and a construction method and application thereof.

Background

Dopamine, a simple catecholamine, is a precursor to norepinephrine and epinephrine, and acts as a neurotransmitter to regulate a variety of physiological functions of the central nervous system. Disorders of dopamine system regulation may cause the development of symptoms such as parkinson's disease, schizophrenia, Tourette's syndrome, attention deficit hyperactivity disorder and pituitary tumors. In practical applications, dopamine is commonly used in the clinical treatment of many types of shock. Besides the application value of the dopamine, the dopamine can be used as a metabolic intermediate to synthesize high-value-added products such as hydroxytyrosol, salidroside and the like.

Currently, the preparation methods of dopamine mainly comprise chemical synthesis, plant extraction, biological enzyme catalysis and biological fermentation. Compared with a chemical synthesis method, the method for preparing dopamine by a biological synthesis method has the advantages of simple process, high product conversion efficiency, greenness and sustainability.

Disclosure of Invention

The invention aims to provide an escherichia coli recombinant strain for producing dopamine, and a construction method and application thereof.

The invention provides a recombinant bacterium, which is obtained by introducing specific DNA molecules into escherichia coli; the specific DNA molecule has levodopa decarboxylase gene.

The specific DNA molecule also has a regulatory element for promoting the expression of the levodopa decarboxylase gene.

In the specific DNA molecule, the regulatory element is positioned at the upstream of the levodopa decarboxylase gene.

The specific DNA molecule is composed of the following elements from upstream to downstream in sequence: a regulation and control element for promoting the expression of the levodopa decarboxylase gene and the levodopa decarboxylase gene.

The regulatory element promoting the expression of the levodopa decarboxylase gene can be specifically a regulatory element P1.

The regulatory element P1 can be specifically shown as SEQ ID NO. 2.

The specific DNA molecule is integrated into the genomic DNA of E.coli.

The specific DNA molecule is integrated into the FeaB gene coding frame of the genome DNA of the escherichia coli.

The specific DNA molecule is integrated into the genome DNA of the Escherichia coli through homologous recombination. The upstream homology arm of homologous recombination can be 30-50 (specifically 40) nucleotides upstream of the FeaB gene initiation codon in the genome DNA of the escherichia coli. The downstream homology arm of the homologous recombination can be 30-50 (specifically 40) nucleotides downstream of the stop codon of the FeaB gene in the genome DNA of the escherichia coli. The upstream homology arm of homologous recombination may specifically be: GTACACTGAAATCACACTGGGTAAATAATAAGGAAAAGTG are provided. The reverse complement sequence of the downstream homology arm of homologous recombination may specifically be: ACGGCACCAGGTGCCGTTTTTTACTTATGAGCGAACAAGA are provided.

The specific DNA molecule replaces the FeaB gene coding frame in the genome DNA of the escherichia coli.

The FeaB gene coding cassette in the genomic DNA of Escherichia coli is shown in positions 1447519 and 1449018 in NC-000913.3 (circular CON 11-OCT-2018).

Illustratively, the escherichia coli can be escherichia coli T004.

The preparation method of the recombinant bacterium specifically comprises the following steps: introducing specific DNA molecules with homologous arms into Escherichia coli FeaB1, and culturing (specifically at 30 deg.C) to obtain Escherichia coli FeaB 2; culturing (specifically culturing at 37 ℃) Escherichia coli FeaB2, and removing pKD46 plasmid to obtain the recombinant strain.

Specific DNA molecules having homology arms are obtained by adding upstream homology arms upstream of the specific DNA molecule and downstream homology arms downstream of the specific DNA molecule.

The upstream homology arm can be 30-50 (specifically 40) nucleotides upstream of the initiation codon of the FeaB gene in the genome DNA of the escherichia coli. The downstream homology arm can be 30-50 (specifically 40) nucleotides downstream of the stop codon of the FeaB gene in the genome DNA of the escherichia coli. The upstream homology arm may specifically be: GTACACTGAAATCACACTGGGTAAATAATAAGGAAAAGTG are provided. The reverse complement of the downstream homology arm may specifically be: ACGGCACCAGGTGCCGTTTTTTACTTATGAGCGAACAAGA are provided.

The escherichia coli FeaB1 can be specifically a recombinant bacterium obtained by transforming escherichia coli T004 into two types as follows: (1) introducing pKD46 plasmid; (2) the coding frame of the FeaB gene in the genome is replaced by a cat-sacB box. The cat-sacB box is specifically shown as SEQ ID NO. 5 and is a double-stranded DNA molecule.

The preparation method of the Escherichia coli FeaB1 comprises the following steps:

(1) introducing pKD46 plasmid into Escherichia coli T004 to obtain recombinant Escherichia coli with pKD46 plasmid;

(2) introducing the cat-sacB box with the homologous arm into the recombinant escherichia coli obtained in the step (1), and culturing (specifically, culturing at 30 ℃) to obtain escherichia coli FeaB 1.

The cat-sacB cassette with homology arms is obtained by adding an upstream homology arm upstream of the cat-sacB cassette and a downstream homology arm downstream of the cat-sacB cassette.

The levodopa decarboxylase gene is a gene encoding levodopa decarboxylase.

The levodopa decarboxylase is levodopa decarboxylase DddC derived from fruit fly (Drosophila melanogaster), or levodopa decarboxylase SddC derived from wild boar (Sus scrofa), or levodopa decarboxylase EcddC derived from wild horse (Equus caballus).

The levodopa decarboxylase (DmDDC) derived from drosophila can be specifically (a1) or (a2) or (a3) as follows:

(a1) 6, protein shown in SEQ ID NO;

(a2) protein which is derived from fruit fly and has more than 98 percent of identity with the protein shown in SEQ ID NO. 6 and has the same function;

(a3) the protein shown in SEQ ID NO. 6 is subjected to substitution and/or deletion and/or addition of one or more amino acid residues to obtain the protein with the same function.

The levodopa decarboxylase (SsDDC) derived from wild boars may specifically be (b1) or (b2) or (b3) as follows:

(b1) protein shown as SEQ ID NO. 7;

(b2) a protein which is derived from a wild boar, has more than 98 percent of identity with the protein shown in SEQ ID NO. 7 and has the same function;

(b3) the protein shown in SEQ ID NO. 7 is subjected to substitution and/or deletion and/or addition of one or more amino acid residues to obtain the protein with the same function.

The levodopa decarboxylase (EcDDC) derived from wild horse can be (c1) or (c2) or (c3) as follows:

(c1) the protein shown as SEQ ID NO. 8;

(c2) protein which is derived from wild horse, has more than 98 percent of identity with the protein shown in SEQ ID NO. 8 and has the same function;

(c3) the protein shown in SEQ ID NO. 8 is subjected to substitution and/or deletion and/or addition of one or more amino acid residues to obtain the protein with the same function.

The levodopa decarboxylase gene is a gene after codon optimization.

In particular, the codon is optimized to optimize the start codon of DmDDC to codon ATG.

The levodopa decarboxylase gene can be (d1) or (d2) or (d3) as follows:

(d1) DNA molecule shown as 89-1621 th nucleotide in SEQ ID NO. 1;

(d2) a DNA molecule derived from drosophila and having 98% or greater identity to (d1) and encoding said protein;

(d3) hybridizes under stringent conditions with (d1) and encodes the DNA molecule.

The levodopa decarboxylase gene can be (f1), (f2) or (f3) as follows:

(f1) a DNA molecule shown as 89-1549 nucleotides in SEQ ID NO. 3;

(f2) a DNA molecule derived from a wild boar and having 98% or more identity to (f1) and encoding the protein;

(f3) (ii) hybridizes under stringent conditions to (f1) and encodes said DNA molecule.

The encoding gene of the levodopa decarboxylase can be (g1) or (g2) or (g3) as follows:

(g1) a DNA molecule represented by nucleotides 89 to 1531 of SEQ ID NO. 4;

(g2) a DNA molecule derived from Eupatorium japonicum and having 98% or more identity to (g1) and encoding the protein;

(g3) hybridizes with (g1) under stringent conditions and encodes the DNA molecule.

The specific DNA molecule can be (h1) or (h2) or (h3) as follows:

(h1) 1, DNA molecule shown in SEQ ID NO;

(h2) a DNA molecule having 98% or more identity to (h1) and encoding the protein;

(h3) hybridizes with (h1) under stringent conditions and encodes the DNA molecule.

The specific DNA molecule can be (i1) or (i2) or (i3) as follows:

(i1) a DNA molecule shown as SEQ ID NO. 3;

(i2) (ii) a DNA molecule having 98% or more identity to (i1) and encoding said protein;

(i3) (ii) hybridizes under stringent conditions to (i1) and encodes the DNA molecule.

The specific DNA molecule can be (j1) or (j2) or (j3) as follows:

(j1) DNA molecule shown in SEQ ID NO. 4;

(j2) a DNA molecule having 98% or more identity to (j1) and encoding the protein;

(j3) (ii) hybridizes under stringent conditions to (j1) and encodes the DNA molecule.

Any of the above stringent conditions may be hybridization and washing of the membrane 2 times 5min at 68 ℃ in a solution of 2 XSSC, 0.1% SDS, or hybridization and washing of the membrane 2 times 15min at 68 ℃ in a solution of 0.5 XSSC, 0.1% SDS.

Specifically, the recombinant bacterium can be escherichia coli TD 03.

The invention also protects the application of any recombinant bacterium or the passage progeny thereof in producing dopamine.

The application comprises the following steps: and fermenting and culturing the recombinant bacteria (or subculture descendants thereof) to obtain the dopamine.

In the fermentation culture, a substrate for preparing dopamine is glucose.

In the application, the method for producing dopamine by using the recombinant bacterium comprises the following steps:

(1) seed culture: inoculating the recombinant bacteria into a seed culture medium, and culturing to obtain a seed culture solution;

(2) fermentation culture: inoculating the seed culture solution into a fermentation culture medium, and culturing (specifically, aerobic fermentation culture) to obtain a fermentation liquid.

The fermentation liquor contains dopamine.

Preferably, the initial glucose concentration is higher, about 20g/L-100g/L, after fermentation, when the glucose concentration in the fermentation solution is reduced to below 1g/L, the glucose solution with the concentration of 500g/L-600g/L is used for feeding, and the feeding speed is controlled to ensure that the glucose concentration in the fermentation tank is always less than 1 g/L.

The seed culture medium or the fermentation culture medium provided by the invention can be correspondingly adjusted according to the requirements on the components and the content of the components, the fermentation temperature, the pH value of the fermentation system, the fermentation time and the inoculation amount.

For example:

the initial glucose content is 20g/L-100g/L, specifically 20g/L, 30g/L, 40g/L, 50g/L, 60g/L, 70g/L, 80g/L, 90g/L, 100g/L, etc. (after the fermentation is started, when the glucose concentration in the fermentation tank is reduced to below 1g/L, the feeding is started by using a glucose solution with the concentration of 500g/L-600g/L, and the feeding speed is controlled so that the glucose concentration in the fermentation tank is less than 1 g/L);

the content of yeast extract is 0-5g/L, specifically 0g/L or 1g/L or 2g/L or 3g/L or 4g/L or 5 g/L;

the content of tryptone is 0-10g/L, specifically 0g/L, 1g/L, 2g/L, 3g/L, 4g/L, 5g/L, 6g/L, 7g/L, 8g/L, 9g/L, 10g/L, etc.;

the NaCl content is 0g/L-10g/L, specifically 0g/L, 1g/L, 2g/L, 3g/L, 4g/L, 5g/L, 6g/L, 7g/L, 8g/L, 9g/L, 10g/L, etc.;

the content of citric acid is 1g/L-5g/L, specifically 1g/L, 2g/L, 3g/L, 5g/L, etc.;

KH₂PO₄the content of (b) is 2.5g/L-10g/L, specifically 2.5g/L, 5g/L, 7.5g/L, 10g/L and the like;

K₂HPO₄·3H₂the content of O is 2.5g/L-10g/L, specifically 2.5g/L, 5g/L, 6.5g/L, 10g/L and the like;

(NH₄)₂HPO₄the content of (b) is 0.8g/L-4.4g/L, specifically 0.8g/L or 1.2g/L or 1.6g/L or 2.0g/L or 3.5g/L or 4.4g/L, etc.;

MgSO₄·7H₂the content of O is 1g/L-4g/L, and specifically can be 1g/L, 2g/L, 3g/L or 4 g/L;

FeCl₃·6H₂the content of O is 0.05mg/L-0.20mg/L, specifically 0.05mg/L, 0.10mg/L, 0.16mg/L, 0.20mg/L, etc.;

CaCl₂the content of (b) is 3mg/L-15mg/L, specifically 3mg/L, 7mg/L, 10mg/L, 11mg/L, 13mg/L, 15mg/L and the like;

the content of Thiamine HCl is 1mg/L-5mg/L, and specifically can be 1mg/L, 2mg/L, 3mg/L, 4mg/L or 5 mg/L;

ZnCl₂the content of (b) is 0.01mg/L-0.03mg/L, specifically 0.01mg/L or 0.02mg/L0.03mg/L and the like;

CoCl₂·6H₂the content of O is 1mg/L-6mg/L, specifically 1mg/L, 2mg/L, 4mg/L or 6 mg/L;

CuSO₄·5H₂the content of O is 0.2mg/L-1mg/L, specifically 0.2mg/L, 0.4mg/L, 0.6mg/L, 0.8mg/L, 1mg/L, etc.;

the fermentation temperature is 25-42 deg.C, specifically 25 deg.C, 30 deg.C, 37 deg.C, 40 deg.C, or 42 deg.C;

the pH value of the fermentation system is 6.0-8.0, specifically 6.0 or 7.0 or 8.0, etc.;

the fermentation time is 24 hours to 96 hours, specifically 24 hours or 36 hours or 48 hours or 60 hours or 72 hours or 84 hours or 96 hours and the like;

the volume percentage of the inoculation amount is 0.05-15%, and specifically can be either 0.05% or 2% or 5% or 10% or 15%.

As a specific implementation case, the method for producing dopamine by using the recombinant bacterium comprises the following steps:

(1) inoculating the single colony of the recombinant strain to 3mL of seed culture medium, and carrying out shaking culture at 30 ℃ and 250rpm for 16 hours to obtain a seed solution;

(2) mu.L of the seed solution obtained in step (1) was inoculated into 10mL of a fermentation medium and cultured at 37 ℃ under shaking at 250rpm for 48 hours.

Seed culture medium: contains glucose 4-6g/L, yeast extract 4-6g/L, tryptone 8-12g/L, NaCl8-12g/L, and water in balance. pH6.0-8.0.

Seed culture medium: contains 5g/L glucose, 5g/L yeast extract, 10g/L tryptone, 10g/L NaCl and the balance of water. pH 7.0.

Fermentation medium: contains glucose 15-25g/L, KH₂PO₄ 3-4g/L，K₂HPO₄·3H₂O 6-7g/L，(NH₄)₂HPO₄3-4g/L，MgSO₄ 0.1-0.2g/L，CaCl₂10-12mg/L, Thiamine HCl (Thiamine hydrochloride) 4-6mg/L, FeCl₃·6H₂O 0.14-0.18mg/L，CoCl₂·6H₂O 0.1-0.3mg/L，CuSO₄·5H₂O 0.01-0.02mg/L，Na₂MoO₄·2H₂O 0.01-0.02mg/L，ZnCl₂ 0.01-0.02mg/L，H₃BO₃0.004-0.006mg/L, and the balance of water. pH6.0-8.0.

Fermentation medium: contains glucose 20g/L, KH₂PO₄ 3.5g/L，K₂HPO₄·3H₂O 6.5g/L，(NH₄)₂HPO₄3.5g/L，MgSO₄ 0.120g/L，CaCl₂11mg/L Thiamine HCl (Thiamine hydrochloride) 5mg/L, FeCl₃·6H₂O 0.16mg/L，CoCl₂·6H₂O 0.2mg/L，CuSO₄·5H₂O 0.015mg/L，Na₂MoO₄·2H₂O 0.02mg/L，ZnCl₂0.02mg/L，H₃BO₃0.005mg/L and the balance of water. pH 6.8.

(1) inoculating the single colony of the recombinant strain into 3mL of a first-level seed culture medium, and carrying out shaking culture at 30 ℃ and 250rpm for 16 hours to obtain a first-level seed solution;

(2) inoculating 2mL of the first-stage seed solution into 200mL of a second-stage seed culture medium, and carrying out shaking culture at 37 ℃ and 250rpm for 24 hours to obtain a second-stage seed solution;

(3) inoculating 200mL of the secondary seed solution into 2L of a fermentation culture medium, and performing fermentation culture (specifically, culturing); in the fermentation process, the temperature is controlled to be 36-38 ℃, the pH is controlled to be 6.5-7.0, and the dissolved oxygen is controlled to be 18-22%; during the fermentation process, monitoring the glucose concentration in the system, and when the glucose concentration is less than 1g/L, beginning to supplement 400-600g/L glucose aqueous solution to control the glucose concentration of the system to be 0.1-1 g/L.

The fermentation culture time may be 32-40 hr.

The time for fermentation culture may be specifically 36 hours.

In the fermentation process, the temperature is controlled to be 37 ℃, the pH is controlled to be 6.8 (the pH is regulated by strong ammonia water), and the dissolved oxygen is controlled to be 20%; during the fermentation process, monitoring the glucose concentration in the system, and when the glucose concentration is less than 1g/L, beginning to supplement 500g/L glucose aqueous solution to control the glucose concentration of the system to be 0.1-1 g/L.

Primary seed culture medium: contains glucose 4-6g/L, yeast extract 4-6g/L, tryptone 8-12g/L, NaCl8-12g/L, and water in balance.

Primary seed medium (natural pH): contains 5g/L glucose, 5g/L yeast extract, 10g/L tryptone, 10g/L NaCl and the balance of water.

Secondary seed culture medium: contains 18-22g/L glucose, 4-6g/L yeast extract, 8-12g/L tryptone, 8-12g/L NaCl and the balance water.

Secondary seed medium (natural pH): contains 20g/L glucose, 5g/L yeast extract, 10g/L tryptone, 10g/L NaCl and the balance water.

Fermentation medium: contains 18-22g/L glucose and 1-3g/L, KH citric acid₂PO₄ 7-8g/L、(NH₄)₂SO₄ 1.4-1.8g/L、MgSO₄·7H₂O 1-3g/L、FeSO₄·7H₂O 70-80mg/L、MnSO₄·H₂O 4-5mg/L、Na₂SO₄ 18-22mg/L、ZnSO₄ 5-7mg/L、CoCl₂·6H₂O 3-5mg/L、CuSO₄·5H₂0.5-0.7mg/L of O and the balance of water. pH6.5-7.2.

Fermentation medium (ph 6.8): contains glucose 20g/L and citric acid 2g/L, KH₂PO₄ 7.5g/L、(NH₄)₂SO₄1.6g/L、MgSO₄·7H₂O 2g/L、FeSO₄·7H₂O 75mg/L、MnSO₄·H₂O 4.5mg/L、Na₂SO₄ 20mg/L、ZnSO₄ 6mg/L、CoCl₂·6H₂O 4mg/L、CuSO₄·5H₂O0.6 mg/L, and the balance of water.

The invention also protects the application of any recombinant bacterium (or the passage progeny thereof) in the production of downstream products of dopamine pathways.

The invention also protects the application of the levodopa decarboxylase or the coding gene thereof or the mutant protein derived from the levodopa decarboxylase or the coding gene thereof in producing dopamine.

The invention also protects the application of the levodopa decarboxylase or the coding gene thereof or the mutant protein derived from the levodopa decarboxylase or the coding gene thereof in the production of downstream products of a dopamine pathway.

The levodopa decarboxylase can be any one of the levodopa decarboxylases described above.

The coding gene of the levodopa decarboxylase can be any one of the levodopa decarboxylase genes.

Illustratively, in the examples of the present invention, the plasmid or the amplification product may be transformed or introduced into the bacterium by a currently conventional transformation method, such as an electrical transformation method, a chemical transformation method, or the like.

The invention also provides a culture of the recombinant bacteria (or subculture generations thereof) or a processed product thereof, such as fermentation broth, culture medium, freeze-dried powder, and fermentation broth, culture medium, freeze-dried powder and the like obtained by mixed culture of the recombinant bacteria and other strains.

The invention also protects Escherichia coli TD 03. Escherichia coli TD03, which is known as Escherichia coli TD03, has been deposited in China general microbiological culture Collection center (CGMCC, address: Beijing, Naja Kogyo No.1 Beijing, institute of microbiology, China academy of sciences, postal code 100101) at 19.11.2020 and 19.11.2020, and has been deposited with the deposit number of CGMCC No. 21210.

The invention also protects the application of the Escherichia coli TD03 in producing dopamine.

The invention also protects the application of the Escherichia coli TD03 in the downstream products of dopamine production.

The pathway of dopamine biosynthesis in E.coli is shown in FIG. 1. Glucose: glucose; E4P: erythrose-4-phosphate; PEP: phosphoenolpyruvic acid; PYR: pyruvic acid; DAHP: 3-deoxy-D-arabinoheptulose-7-phosphate; and (3) DHS: 3-dehydroshikimic acid; shikimate: (ii) shikimic acid; tyrosine: tyrosine; l-dopa: levodopa; PykAF pyruvate kinase; TktA is transketolase; GalP: a galactose MFS transporter; glk: glucokinase; PtsI: an enzyme I of phosphoenolpyruvate-glycophosphotransferase; pgi: glucose-6-phosphate isomerase; AroF 3-deoxy-D-arabinoheptulose 7-phosphate synthase; AroE 3-dehydroshikimate dehydrogenase; HpaBC: a tyrosine hydroxylase; DDC: dopa decarboxylase.

Escherichia coli T004 (Escherichia coli) T004 is totally known as Escherichia coli T004, and has been deposited in China general microbiological culture Collection center (CGMCC, China institute for microbiology, Japan) No.1 of Ministry of Collection of microorganisms and Japan, No. 3 of Beijing, Inward-Yang district, Beichen West Lu, Japan, Inc., 15 days 06, and the deposition number is CGMCC No. 14247.

Escherichia coli TD03, which is known as Escherichia coli TD03, has been deposited in China general microbiological culture Collection center (CGMCC, address: Beijing, Naja Kogyo No.1 Beijing, institute of microbiology, China academy of sciences, postal code 100101) at 19.11.2020 and 19.11.2020, and has been deposited with the deposit number of CGMCC No. 21210.

The invention provides an escherichia coli TD03 for producing dopamine, which increases the enzyme activity of levodopa decarboxylase by introducing and up-regulating the expression of the levodopa decarboxylase (DDC), and further can produce dopamine. The strain can utilize a glucose inorganic salt culture medium to produce dopamine by fermentation, and the cost of the culture medium is reduced, so that the production cost of the dopamine is reduced, and the strain has the advantages of short fermentation time and high yield. In addition, in the fermentation process, the content of glucose is only controlled to be below 1g/L, so that the production cost of dopamine is greatly reduced, and when the fermentation is finished, the glucose is completely converted, and the fermentation liquor basically has no accumulation of byproducts such as acetic acid and the like, so that the method has great development potential in large-scale industrial production. And the strain does not contain plasmids and is stable in heredity. The invention provides a promising alternative scheme for the green sustainable production of dopamine. This will make the dopamine-synthesizing microbial system economically more attractive, while providing the possibility for the industrial production of downstream products of the dopamine pathway.

Drawings

FIG. 1 shows the pathway of dopamine biosynthesis in E.coli.

FIG. 2 shows the L-dopa content and dopamine content in the fermentation system of example 3.

FIG. 3 is OD of fermentation system in example 4_600nmValue, dopamine content, and levodopa content.

FIG. 4 is the corresponding HPLC chromatogram taken from a 36h sample of the fermentation culture in example 4.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. Unless otherwise specified, all nucleic acid molecules in the examples are in the 5'→ 3' direction. The open reading frame of the FeaB gene of Escherichia coli is shown as 1447519-1449018 th position in NC-000913.3 (circular CON 11-OCT-2018). The pKD46 plasmid contains a temperature-sensitive origin of replication oriR101, which replicates normally when cultured at 30 ℃ and is automatically lost when cultured at 37 ℃.

Unless otherwise stated, the quantitative tests in the following examples were performed in triplicate, and the results were averaged.

Abbreviations for various enzymes in the present invention include, for example: FeaB can represent phenylacetaldehyde dehydrogenase genes and phenylacetaldehyde dehydrogenase, DDC can represent dopa decarboxylase genes and dopa decarboxylase, and the specific meanings are understood according to the context.

As a modification of the scheme of the invention, when constructing the recombinant strain, the recombinant strain is constructed by modifying the expression of 3-dehydrogenase shikimate dehydrogenase (aroE), tyrosine hydroxylase (hpaBC), Dopa Decarboxylase (DDC) and the like by gene recombination, inserting a regulatory element, changing the initiation codon of each enzyme and the like without taking Escherichia coli T004 as an original strain or taking other Escherichia coli capable of producing 3-dehydrogenase shikimate as an original strain.

For example, it can be constructed by modifying the expression of 3-dehydrogenaseshikimate dehydrogenase (aroE), 3-deoxy-D-arabinoheptulose 7-phosphate synthase (aroF), transketolase (tktA), galactose MFS transporter (galP), glucose kinase (glk), phosphoenolpyruvate-saccharophosphotransferase (PTS system), pyruvate kinase, phosphoglucose isomerase (pgi), hydroxytyrosinase (hpaBC), dopa (DDC), etc., using E.coli DSM1576 as a starting strain, and by inserting regulatory elements, changing the start codon of each enzyme, etc.

For example, Escherichia coli DSM1576 can be used as a starting strain, the expression or non-expression of 3-dehydrogenase shikimate dehydrogenase (aroE) is firstly down-regulated by gene recombination, the base C at position 443 in 3-deoxy-D-arabinoheptulose 7-phosphate synthase gene aroF is mutated to T, the expression of transketolase (tktA) is up-regulated, the expression of galactose MFS transporter (galP) is up-regulated, the expression of glucokinase (glk) is up-regulated, the expression or non-expression of phosphoenolpyruvate-glycophosphotransferase enzyme I (pts I) is down-regulated, the expression or non-expression of pyruvate kinase (pykA and/or pykF) is down-regulated, the expression or non-expression of phosphoglucose isomerase (pgi) is down-regulated, the expression of 3-dehydrogenase shikimate dehydrogenase (aroE) is up-regulated, the expression of tyrosine hydroxylase (hpaBC) is up-regulated, introducing and up-regulating Dopa Decarboxylase (DDC) expression, synthesizing corresponding regulatory elements according to the expression requirement (up-regulation/down-regulation) of each enzyme, and inserting the regulatory elements into the initiation codon of the corresponding enzyme; and, alternatively, the start codon sequence of the corresponding enzyme, etc. are changed.

For example, it is possible to start from E.coli DSM1576 by gene recombination to directly up-regulate the expression of 3-dehydrogenase shikimate dehydrogenase (aroE), to mutate the base C at position 443 in the 3-deoxy-D-arabinoheptulose 7-phosphate synthase gene aroF to T, to up-regulate the expression of transketolase (tktA), to up-regulate the expression of galactose MFS transporter (galP), to up-regulate the expression of glucokinase (glk), to down-regulate the expression or non-expression of phosphoenolpyruvate-glycophosphotransferase enzyme I (pts I), to down-regulate the expression or non-expression of pyruvate kinase (pykA and/or pykF), to down-regulate the expression or non-expression of phosphoglucose isomerase (pgi), to up-regulate the expression of tyrosine hydroxylase (hpaBC), to introduce and up-regulate the expression of Dopa Decarboxylase (DDC), to synthesize the corresponding regulatory elements according to the expression requirements (up/down regulation) of the respective enzymes, and inserting it into the initiation codon of the corresponding enzyme; and, alternatively, the start codon sequence of the corresponding enzyme, etc. are changed.

Example 1 preparation of E.coli FeaB1

1. Taking a double-stranded DNA molecule shown in SEQ ID NO. 5 as a template, adopting a primer pair consisting of feaB-up-F and feaB-down-R to carry out PCR amplification, recovering a PCR amplification product, and naming the PCR amplification product as a feaB1 fragment. The double-stranded DNA molecule shown in SEQ ID NO:5 is a cat-sacB cassette which has a chloramphenicol resistance gene (cat gene) (shown as position 196-855 in SEQ ID NO: 5) and a fructan sucrose transferase gene (sacB gene) (shown as position 1197-2618 in SEQ ID NO: 5).

feaB-up-F (forward primer):

GTACACTGAAATCACACTGGGTAAATAATAAGGAAAAGTGGTGACGGAAGATCACTTC；

feaB-down-R (reverse primer):

ACGGCACCAGGTGCCGTTTTTTACTTATGAGCGAACAAGAATCAAAGGGAAAACTGTC。

reaction system for PCR amplification (50 μ L): 5 × TransStart^TMFastpfu Buffer 10. mu. L, dNTPs (2.5mmol/L each) 4. mu. L, DNA template 1. mu.L (20-50ng), forward primer (10. mu. mol/L) 2. mu.L, reverse primer (10. mu. mol/L) 2. mu. L, DMSO 1. mu. L, TransStart^TMFastPfu DNA Polymerase (2.5U/. mu.L) 1. mu.L, deionized water 29. mu.L.

Reaction conditions for PCR amplification: pre-denaturation at 94 ℃ for 5 min; denaturation at 95 ℃ for 20 seconds, annealing at 55 ℃ for 30 seconds, extension at 72 ℃ for 3 minutes, and 30 cycles; extension at 72 ℃ for 5 minutes.

In the FeaB1 fragment, 40 nucleotides at the 5 'end are 40 nucleotides upstream of the initiation codon of the FeaB gene (as upstream homology arms), and 40 nucleotides at the 3' end are 40 nucleotides downstream of the termination codon of the FeaB gene (as downstream homology arms).

2. Taking Escherichia coli T004, and introducing pKD46 plasmid by adopting a calcium chloride conversion method to obtain the recombinant Escherichia coli with pKD46 plasmid.

3. Preparing competent cells from the recombinant escherichia coli obtained in the step 2; then 50. mu.L of competent cells were placed on ice, 50-100ng of FeaB1 fragment was added, and the mixture was placed on ice for 2 minutes and then transferred to a 0.2-em Bio-Rad electric rotor for electric shock (using a Micropulser electroporator from Bio-Rad, Inc., with a shock parameter of 2.5 kv); then, 1mL of LB liquid medium was quickly transferred to an electroporation cuvette, mixed 5 times with a pipette, and then the liquid phase in the electroporation cuvette was transferred to a 15mL test tube and incubated for 2 hours in a shaker at 30 ℃ and 100 rpm.

4. And (3) after the step 3 is completed, coating 200 mu L of bacterial liquid on an LB solid culture medium containing chloramphenicol and ampicillin, culturing at 30 ℃ until a single colony which is visible to naked eyes grows out, selecting the single colony, and performing colony PCR amplification and sequencing verification to obtain a recombinant bacterium named as escherichia coli FeaB 1. Coli FeaB1 contains pKD46 plasmid. In E.coli FeaB1, the open reading frame of the FeaB gene in the E.coli T004 genome was replaced with a cat-sacB cassette.

The primers used for colony PCR amplification were as follows:

FeaB-500-up-F (forward primer): GACGCTCATCCTGCTCCATT, respectively;

FeaB-500-down-R (reverse primer): TCCGGGCACGATTCGTCTGTTGAG are provided.

Example 2 preparation of E.coli TD01 and E.coli TD02 and E.coli TD03

Liquid screening culture medium: basically, the difference is only 10% of sucrose and no sodium chloride from LB liquid medium.

Solid screening culture medium: basically, the difference is that 10% of sucrose is contained and sodium chloride is not contained in the LB solid culture medium.

Firstly, preparing escherichia coli TD01

1. Taking a double-stranded DNA molecule shown in SEQ ID NO. 3 as a template, carrying out PCR amplification by adopting a primer pair consisting of SsDDC-P1-up and SsDDC-P1-down, recovering a PCR amplification product, and naming the product as a FeaB2 fragment. The double-stranded DNA molecule shown in SEQ ID NO. 3 has regulatory elements P1 (shown as positions 1-88 in SEQ ID NO. 3) and an SsDDC gene (shown as positions 89-1549 in SEQ ID NO. 3).

SsDDC-P1-up (forward primer):

GTACACTGAAATCACACTGGGTAAATAATAAGGAAAAGTGTTATCTCTGGCGGTGTTG；

SsDDC-P1-down (reverse primer):

ACGGCACCAGGTGCCGTTTTTTACTTATGAGCGAACAAGATTAACTCTTAATTTCTGCTTTGCCTTCTTCCGC。

Reaction conditions for PCR amplification: pre-denaturation at 94 ℃ for 5 min; denaturation at 95 ℃ for 20 seconds, annealing at 55 ℃ for 30 seconds, extension at 72 ℃ for 30 seconds, and 30 cycles; extension at 72 ℃ for 5 minutes.

In the FeaB2 fragment, 40 nucleotides at the 5 'end are 40 nucleotides upstream of the initiation codon of the FeaB gene (as upstream homology arms), and 40 nucleotides at the 3' end are 40 nucleotides downstream of the termination codon of the FeaB gene (as downstream homology arms).

2. Preparing competent cells from escherichia coli FeaB 1; then 50. mu.L of competent cells were placed on ice, 50-100ng of FeaB2 fragment was added, and the mixture was placed on ice for 2 minutes and then transferred to a 0.2-em Bio-Rad electric rotor for electric shock (using a Micropulser electroporator from Bio-Rad, Inc., with a shock parameter of 2.5 kv); then 1mL of LB liquid medium was quickly transferred to an electroporation cuvette, mixed 5 times with a pipette, and then the liquid phase in the electroporation cuvette was transferred to a 15mL test tube, and incubated in a shaker at 30 ℃ and 200rpm for 2 hours to obtain Escherichia coli FeaB 2. Coli FeaB2 contains pKD46 plasmid.

3. And (3) after the step 2 is completed, transferring 300 mu L of bacterial liquid into 30mL of liquid screening culture medium, carrying out shaking culture at 37 ℃ and 250rpm overnight, then carrying out streak inoculation on a solid screening culture medium plate, carrying out culture at 37 ℃ until a single colony which is obvious to naked eyes grows out, picking the single colony, carrying out colony PCR amplification and sequencing verification, and obtaining a recombinant bacterium which is named as escherichia coli TD 01. Coli TD01 does not contain pKD46 plasmid. In Escherichia coli TD01, the open reading frame of the FeaB gene in the genome of Escherichia coli T004 was replaced with a double-stranded DNA molecule represented by SEQ ID NO. 3.

The primers used for colony PCR amplification were as follows:

w-promoter-s (forward primer): TTATCTCTGGCGGTGTTG, respectively;

FeaB-1-down (reverse primer): TTACTGTTCCTGTTCCATTTCATCTG are provided.

Secondly, preparing escherichia coli TD02

1. Taking a double-stranded DNA molecule shown in SEQ ID NO. 4 as a template, carrying out PCR amplification by adopting a primer pair consisting of EcDDC-P1-up and EcDDC-P1-down, recovering a PCR amplification product, and naming the product as a FeaB3 fragment. The double-stranded DNA molecule shown in SEQ ID NO. 4 has regulatory element P1 (shown as positions 1-88 in SEQ ID NO. 4) and Ecddc gene (shown as positions 89-1531 in SEQ ID NO. 4).

EcDDC-P1-up (forward primer):

GTACACTGAAATCACACTGGGTAAATAATAAGGAAAAGTGTTATCTCTGGCGGTGTTG；

EcDDC-P1-down (reverse primer):

ACGGCACCAGGTGCCGTTTTTTACTTATGAGCGAACAAGATTATTCTTTTTCTGCTTTCAGCAGTTCGGT。

In the FeaB3 fragment, 40 nucleotides at the 5 'end are 40 nucleotides upstream of the initiation codon of the FeaB gene (as upstream homology arms), and 40 nucleotides at the 3' end are 40 nucleotides downstream of the termination codon of the FeaB gene (as downstream homology arms).

2. Preparing competent cells from escherichia coli FeaB 1; then 50. mu.L of competent cells were placed on ice, 50-100ng of FeaB3 fragment was added, and the mixture was placed on ice for 2 minutes and then transferred to a 0.2-em Bio-Rad electric rotor for electric shock (using a Micropulser electroporator from Bio-Rad, Inc., with a shock parameter of 2.5 kv); then 1mL of LB liquid medium was quickly transferred to an electroporation cuvette, mixed 5 times with a pipette, and then the liquid phase in the electroporation cuvette was transferred to a 15mL test tube, and incubated in a shaker at 30 ℃ and 200rpm for 2 hours to obtain Escherichia coli FeaB 3. Coli FeaB3 contains pKD46 plasmid.

3. And (3) after the step 2 is completed, transferring 300 mu L of bacterial liquid into 30mL of liquid screening culture medium, carrying out shaking culture at 37 ℃ and 250rpm overnight, then carrying out streak inoculation on a solid screening culture medium plate, carrying out culture at 37 ℃ until a single colony which is obvious to naked eyes grows out, picking the single colony, carrying out colony PCR amplification and sequencing verification, and obtaining a recombinant bacterium which is named as escherichia coli TD 02. Coli TD02 does not contain pKD46 plasmid. In Escherichia coli TD02, the open reading frame of the FeaB gene in the genome of Escherichia coli T004 was replaced with a double-stranded DNA molecule represented by SEQ ID NO. 4.

The primers used for colony PCR amplification were as follows:

w-promoter-s (forward primer): TTATCTCTGGCGGTGTTG, respectively;

FeaB-1-down (reverse primer): TTACTGTTCCTGTTCCATTTCATCTG are provided.

Thirdly, preparing escherichia coli TD03

1. Taking a double-stranded DNA molecule shown in SEQ ID NO.1 as a template, adopting a primer pair consisting of DmDDC-P1-up and DmDDC-P1-down to carry out PCR amplification, recovering a PCR amplification product, and naming the PCR amplification product as a FeaB4 fragment. The double-stranded DNA molecule shown in SEQ ID NO.1 has regulatory element P1 (shown as positions 1-88 in SEQ ID NO. 1) and Dmdc gene (shown as positions 89-1621 in SEQ ID NO. 1).

DmDDC-P1-up (forward primer):

GTACACTGAAATCACACTGGGTAAATAATAAGGAAAAGTGTTATCTCTGGCGGTGTTG；

DmDDC-P1-down (reverse primer):

ACGGCACCAGGTGCCGTTTTTTACTTATGAGCGAACAAGATTACTGTTCCTGTTCCATTTCATCTG。

In the FeaB4 fragment, 40 nucleotides at the 5 'end are 40 nucleotides upstream of the initiation codon of the FeaB gene (as upstream homology arms), and 40 nucleotides at the 3' end are 40 nucleotides downstream of the termination codon of the FeaB gene (as downstream homology arms).

2. Preparing competent cells from escherichia coli FeaB 1; then 50. mu.L of competent cells were placed on ice, 50-100ng of FeaB4 fragment was added, and the mixture was placed on ice for 2 minutes and then transferred to a 0.2-em Bio-Rad electric rotor for electric shock (using a Micropulser electroporator from Bio-Rad, Inc., with a shock parameter of 2.5 kv); then 1mL of LB liquid medium was quickly transferred to an electroporation cuvette, mixed 5 times with a pipette, and then the liquid phase in the electroporation cuvette was transferred to a 15mL test tube, and incubated in a shaker at 30 ℃ and 200rpm for 2 hours to obtain Escherichia coli FeaB 4. Coli FeaB4 contains pKD46 plasmid.

3. And (3) after the step 2 is completed, transferring 300 mu L of bacterial liquid into 30mL of liquid screening culture medium, carrying out shaking culture at 37 ℃ and 250rpm overnight, then carrying out streak inoculation on a solid screening culture medium plate, carrying out culture at 37 ℃ until a single colony which is obvious to naked eyes grows out, picking the single colony, carrying out colony PCR amplification and sequencing verification, and obtaining a recombinant bacterium which is named as escherichia coli TD 03. Coli TD03 does not contain pKD46 plasmid. In Escherichia coli TD03, the open reading frame of the FeaB gene in the genome of Escherichia coli T004 was replaced with a double-stranded DNA molecule represented by SEQ ID NO: 1.

The primers used for colony PCR amplification were as follows:

w-promoter-s (forward primer): TTATCTCTGGCGGTGTTG, respectively;

FeaB-1-down (reverse primer): TTACTGTTCCTGTTCCATTTCATCTG are provided.

Example 3, E.coli T004, TD01, TD02, and TD03 for fermentation production of dopamine

Seed medium (ph 7.0): contains 5g/L glucose, 5g/L yeast extract, 10g/L tryptone, 10g/L NaCl and the balance of water.

Fermentation medium (NBS medium) (ph 6.8): contains glucose 20g/L, KH₂PO₄ 3.5g/L，K₂HPO₄·3H₂O 6.5g/L，(NH₄)₂HPO₄ 3.5g/L，MgSO₄ 0.120g/L，CaCl₂11mg/L Thiamine HCl (Thiamine hydrochloride) 5mg/L, FeCl₃·6H₂O 0.16mg/L，CoCl₂6H₂O 0.2mg/L，CuSO₄·5H₂O 0.015mg/L，Na₂MoO₄·2H₂O 0.02mg/L，ZnCl₂ 0.02mg/L，H₃BO₃0.005mg/L and the balance of water.

The test bacteria are respectively as follows: escherichia coli T004, Escherichia coli TD01, Escherichia coli TD02 or Escherichia coli TD 03.

1. Seed culture

The single colony of the test bacterium was inoculated into a 15mL test tube containing 3mL of a seed medium, and subjected to shaking culture at 30 ℃ and 250rpm for 16 hours to obtain a seed solution.

2. Fermentation culture

And (3) inoculating 200 mu L of the seed liquid obtained in the step (1) into a 100mL conical flask containing 10mL of fermentation medium, and performing shaking culture at 37 ℃ and 250rpm for 48 hours to obtain a fermentation system (the fermentation system comprises fermentation supernatant and thalli).

3. And (3) centrifuging the fermentation system obtained in the step (2) at 25 ℃ and 14000rpm for 10min, collecting supernatant (which can be diluted properly with water according to the actual detection range), filtering with a 0.22 mu M filter membrane, collecting filtrate, and carrying out HPLC detection.

The detection method comprises the following steps: high performance liquid chromatography.

The instrument comprises the following steps: agilent (Agilent-1200) high performance liquid chromatograph.

A chromatographic column: innoval C18 column (4.6X 250mm, 5 μm) from Agela Technologies.

Column temperature: at 30 ℃.

Mobile phase: 2 parts by volume of methanol and 8 parts by volume of a 0.1% (by volume) aqueous phosphoric acid solution were mixed well.

Flow rate of mobile phase: 0.8 mL/min.

Detection wavelength: 280 nm.

The levodopa standard is purchased from Sigma-Aldrich company, and has a product catalog number PHR1271-500 MG; the retention time of the standard levodopa for HPCL peak-out value is 3.6min according to the parameters. A calibration curve was prepared with levodopa concentration and peak area as variables.

The dopamine standard is purchased from West corporation, and the catalog number of the product is D-99771; the retention time of the dopamine standard corresponding to the peak value of HPCL peak is 3.3min according to the parameters. A standard curve was prepared with dopamine concentration and peak area as variables.

And (4) comparing the peak area of the corresponding peak position of the sample with a standard curve, and calculating to obtain the levodopa content and the dopamine content in the fermentation system.

The results are shown in FIG. 2. The dopamine yield in the fermentation system of Escherichia coli TD03 is 2.4 g/L.

Example 4 production of dopamine by E.coli TD03 extensive fermentation

Fermentation medium (ph 6.8): contains glucose 20g/L and citric acid 2g/L, KH₂PO₄ 7.5g/L、(NH₄)₂SO₄1.6g/L、MgSO₄·7H₂O 2g/L、FeSO₄·7H₂O 75mg/L、MnSO₄·H₂O 4.5mg/L、Na₂SO₄ 20mg/L、ZnSO₄ 6mg/L、CoCl₂·6H₂O4mg/L、CuSO₄·5H₂O0.6 mg/L, and the balance of water.

1. First order seed culture

Escherichia coli TD03 single colony was inoculated into a 15mL test tube containing 3mL of primary seed medium, and subjected to shaking culture at 30 ℃ and 250rpm for 16 hours to obtain a primary seed solution.

2. Second stage seed culture

Inoculating 2mL of the primary seed solution into a 1L shake flask containing 200mL of the secondary seed culture medium, and performing shake culture at 37 ℃ and 250rpm for 24 hours to obtain a secondary seed solution.

3. Fermentation culture

200mL of the secondary seed solution was inoculated into a 5L Biotech-5BG fermentor (Shanghai Baoxing BioEquipment engineering Co., Ltd.) containing 2L of a fermentation medium, and fermentation was carried out for 40 hours to obtain a fermentation system. During the fermentation process, the temperature is controlled at 37 ℃, the pH is controlled at 6.8 (the pH is controlled by strong ammonia water), and the dissolved oxygen is controlled at 20%. During the fermentation process, monitoring the glucose concentration in the system, and when the glucose concentration is less than 1g/L, beginning to supplement 500g/L glucose aqueous solution to control the glucose concentration of the system to be 0.1-1 g/L.

4. Sampling at intervals in the fermentation process, and detecting the OD of the system_600nmAnd detecting the dopamine content and the levodopa content in the system.

The detection method of dopamine content and levodopa content is the same as step 3 of example 3.

OD of fermentation System_600nmValues, dopamine content and levodopa content are shown in figure 3.

After fermentation culture for 36h, the content of the dopamine accumulated in the fermentation liquor reaches the highest concentration (29.2 g/L), and the molar conversion rate of the sugar and the acid is 15%.

The corresponding HPLC chromatogram for a 36h sample from the fermentation culture is shown in FIG. 4. It can be seen that a single dopamine peak is shown, the accumulation of other fermentation byproducts such as acetic acid is basically avoided, and the glucose is completely converted.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> recombinant strain of Escherichia coli for producing dopamine, construction method and application thereof

<130> GNCYX210739

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1621

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ttatctctgg cggtgttgac aagagataac aacgttgata taattgagcc cgtattgtta 60

gcatgtacgt ttaaaccagg aaacagctat gagccatatt ccgattagta ataccattcc 120

gaccaaacag accgatggca atggcaaagc caatattagc ccggataaac tggatccgaa 180

agtgagtatt gatatggaag ccccggaatt caaagatttt gccaaaacca tggtggattt 240

tattgcagaa tatctggaaa atatccgtga acgtcgcgtg ctgccggaag tgaaaccggg 300

ttatctgaaa ccgctgattc cggatgcagc cccggaaaaa ccggaaaaat ggcaggatgt 360

gatgcaggat attgaacgtg ttattatgcc gggtgtgacc cattggcata gcccgaaatt 420

tcatgcctat tttccgaccg ccaatagtta tccggccatt gtggccgata tgctgagtgg 480

tgcaattgca tgtattggtt ttacctggat tgccagcccg gcctgtaccg aactggaagt 540

ggttatgatg gattggctgg gcaaaatgct ggaactgccg gcagaatttc tggcctgcag 600

cggtggcaaa ggtggtggcg tgattcaggg caccgcaagc gaaagcaccc tggtggcact 660

gctgggtgca aaagcaaaaa agctgaaaga agtgaaagaa ctgcatccgg aatgggatga 720

acataccatt ctgggtaaac tggttggtta ttgcagcgat caggcacata gtagcgttga 780

acgcgccggt ctgctgggtg gtgttaaact gcgtagcgtg cagagcgaaa atcatcgtat 840

gcgcggtgca gcactggaaa aagcaattga acaggatgtt gcagaaggcc tgattccgtt 900

ttatgcagtt gttaccctgg gcaccaccaa tagctgtgcc tttgattatc tggatgaatg 960

tggtccggtg ggtaataagc ataatctgtg gattcatgtg gatgccgcct atgcaggcag 1020

cgcattcatt tgtccggaat atcgtcatct gatgaaaggc attgaaagcg ccgatagttt 1080

taattttaac ccgcataaat ggatgctggt gaattttgat tgcagcgcca tgtggctgaa 1140

agatccgagt tgggttgtta atgcattcaa tgtggatccg ctgtatctga aacatgatat 1200

gcagggcagt gccccggatt atcgtcattg gcagattccg ctgggccgtc gttttcgcgc 1260

actgaaactg tggtttgtgc tgcgtctgta tggcgtggaa aatctgcagg cacatattcg 1320

ccgtcattgc aattttgcaa aacagtttgg cgatctgtgt gtggcagata gtcgttttga 1380

actggccgca gaaattaata tgggtctggt gtgttttcgt ctgaaaggta gcaatgaacg 1440

caatgaagca ctgctgaaac gcattaatgg tcgcggccat attcatctgg tgccggccaa 1500

aattaaggat gtgtattttc tgcgtatggc catttgcagt cgctttaccc agagtgaaga 1560

tatggaatat agctggaaag aagttagtgc agccgcagat gaaatggaac aggaacagta 1620

a 1621

<210> 2

<211> 88

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ttatctctgg cggtgttgac aagagataac aacgttgata taattgagcc cgtattgtta 60

gcatgtacgt ttaaaccagg aaacagct 88

<210> 3

<211> 1549

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ttatctctgg cggtgttgac aagagataac aacgttgata taattgagcc cgtattgtta 60

gcatgtacgt ttaaaccagg aaacagctat gaacgccagt gattttcgtc gtcgcggtaa 120

agaaatggtt gattatatgg ccgattatct ggaaggcatt gaaggtcgtc aggtgtatcc 180

ggatgttcag ccgggctatc tgcgtccgct gattccggca accgcaccgc aggaaccgga 240

tacctttgaa gatattctgc aggatgtgga aaaaattatt atgccgggtg ttacccattg 300

gcatagcccg tatttctttg catattttcc gaccgcaagt agctatccgg caatgctggc 360

agatatgctg tgtggtgcca ttggttgcat tggttttagc tgggccgcca gtccggcctg 420

caccgaactg gaaaccgtta tgatggattg gctgggcaaa atgctgcagc tgccggaagc 480

atttctggcc ggcgaagccg gcgaaggcgg cggtgtgatt cagggtagtg caagtgaagc 540

caccctggtt gcactgctgg ccgcccgtac caaagttacc cgccgcctgc aggcagcaag 600

tccgggtctg acccagggtg cagtgctgga aaaactggtt gcatacgcta gcgatcaggc 660

ccatagcagt gtggaacgtg caggcctgat tggcggcgtg aaactgaaag ccattccgag 720

cgatggcaaa tttgccatgc gtgcaagcgc cctgcaggaa gccctggaac gtgataaagc 780

agccggtctg attccgtttt tcgtggttgc caccctgggt acaaccagtt gttgcagttt 840

tgataatctg ctggaagttg gcccgatttg tcatgaagaa gatatttggc tgcatgtgga 900

tgccgcatac gctggcagcg cctttatttg tccggaattt cgtcatctgc tgaatggtgt 960

ggaatttgcc gatagcttta attttaatcc gcataaatgg ctgctggtga attttgattg 1020

tagcgcaatg tgggtgaaac gccgtaccga tctgaccggt gcattcaaac tggaccctgt 1080

ttatctgaaa catagtcatc agggcagcgg cctgattacc gattatcgcc attggcagct 1140

gccgctgggt cgtcgctttc gcagcctgaa aatgtggttt gtgtttcgta tgtatggcgt 1200

gaaaggtctg caggcctata ttcgcaaaca tgttcagctg agtcatgaat ttgaagcatt 1260

tgttctgcag gaccctcgtt ttgaagtgtg tgccgaagtt accctgggtc tggtgtgttt 1320

tcgcctgaaa ggtagcgatg gcctgaatga agccctgctg gaacgtatta atagcgcccg 1380

taaaattcat ctggtgccgt gtcgcctgcg cggccagttt gttctgcgtt ttgcaatttg 1440

cagccgcaaa gttgaaagcg gccatgttcg tctggcctgg gaacatattc gtggtctggc 1500

cgcagaactg ctggccgcgg aagaaggcaa agcagaaatt aagagttaa 1549

<210> 4

<211> 1531

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ttatctctgg cggtgttgac aagagataac aacgttgata taattgagcc cgtattgtta 60

gcatgtacgt ttaaaccagg aaacagctat ggatgccagt gaatttcgtc gtcgtggtaa 120

agaaatggtg gattatgtgg cagattatat ggaaggcatt gaaggccgcc aggtgtatcc 180

ggatgtggaa ccgggttatc tgcgtccgct gattccgacc accgccccgc aggaaccgga 240

tacctttgaa gatattatta atgatgtgga gaagatcatc atgccgggtg ttacccattg 300

gcatagcccg tatttctttg catattttcc gaccgccagt agttatccga gcatgctggc 360

agatatgctg tgcggtgcaa ttggctgtat tggttttagt tgggcagcca gcccggcatg 420

caccgaactg gaaaccgtga tgatggattg gctgggtaaa atgctgcagc tgccggaagc 480

atttctggca ggtaatgcag gcgaaggtgg tggcgtgatt cagggtagtg caagcgaagc 540

caccctggtt gccctgctgg ccgcacgtac caaagtgacc cgccgtctgc aggccgccag 600

ccctggttta acccaggccg caattatgga aaaactggtg gcatatagta gtgatcaggc 660

ccatagtagc gtggaacgcg ccggtctgat tggcggtgtg aaactgaaag caattccgag 720

tgatggtaaa tttgcaatgc gtgcaagcgc actgcaggaa gccctggaac gcgataaagc 780

cgcaggcctg attccgtttt tcgttgttgc aaccctgggc accaccagtt gctgtagctt 840

tgataatctg ctggaagttg gcccgatttg tattaaggaa gatgtgtggc tgcatattga 900

tgcagcctat gccggcagtg cctttatttg tccggaattt cgtccgctgc tgaatggtgt 960

tgaatttgcc gatagtttta attttaaccc gcataaatgg ctgctggtga attttgattg 1020

cagtgcaatg tgggtgaaaa aacgtaccga tctgaccggc gcattcaaac tggatccggt 1080

gtatctgaaa catagtcatc aggatagtgg tctgattacc gattatcgtc attggcagct 1140

gccgctgggt cgccgttttc gtagcctgaa aatgtggttt gtgtttcgta tgtatggtat 1200

taagggtctg caggcatata ttcgtaaaca tgttcagctg agccatgaat ttgaaagcct 1260

ggtgcagcag gatccgcgtt ttgaaatttg tgccgaagtt accctgggtc tggtgtgttt 1320

tcgtctgaaa ggcagcaata agctgaccaa agccctgctg gaacgcatta ataatgcaaa 1380

aaagattcac ctggtgccgt gccatctgcg tgataaattt gtgctgcgtt ttgcaatttg 1440

cagccgcacc gtggaaagcg cccatgttca gttagcatgg gaacatattc gcggtctggc 1500

caccgaactg ctgaaagcag aaaaagaata a 1531

<210> 5

<211> 2932

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gtgacggaag atcacttcgc agaataaata aatcctggtg tccctgttga taccgggaag 60

ccctgggcca acttttggcg aaaatgagac gttgatcggc acgtaagagg ttccaacttt 120

caccataatg aaataagatc actaccgggc gtattttttg agttatcgag attttcagga 180

gctaaggaag ctaaaatgga gaaaaaaatc actggatata ccaccgttga tatatcccaa 240

tggcatcgta aagaacattt tgaggcattt cagtcagttg ctcaatgtac ctataaccag 300

accgttcagc tggatattac ggccttttta aagaccgtaa agaaaaataa gcacaagttt 360

tatccggcct ttattcacat tcttgcccgc ctgatgaatg ctcatccgga attccgtatg 420

gcaatgaaag acggtgagct ggtgatatgg gatagtgttc acccttgtta caccgttttc 480

catgagcaaa ctgaaacgtt ttcatcgctc tggagtgaat accacgacga tttccggcag 540

tttctacaca tatattcgca agatgtggcg tgttacggtg aaaacctggc ctatttccct 600

aaagggttta ttgagaatat gtttttcgtc tcagccaatc cctgggtgag tttcaccagt 660

tttgatttaa acgtggccaa tatggacaac ttcttcgccc ccgttttcac catgggcaaa 720

tattatacgc aaggcgacaa ggtgctgatg ccgctggcga ttcaggttca tcatgccgtt 780

tgtgatggct tccatgtcgg cagaatgctt aatgaattac aacagtactg cgatgagtgg 840

cagggcgggg cgtaattttt ttaaggcagt tattggtgcc cttaaacgcc tggtgctacg 900

cctgaataag tgataataag cggatgaatg gcagaaattc gaaagcaaat tcgacccggt 960

cgtcggttca gggcagggtc gttaaatagc cgctagatct aagtaaatcg cgcgggtttg 1020

ttactgataa agcaggcaag acctaaaatg tgtaaagggc aaagtgtata ctttggcgtc 1080

accccttaca tattttaggt ctttttttat tgtgcgtaac taacttgcca tcttcaaaca 1140

ggagggctgg aagaagcaga ccgctaacac agtacataaa aaaggagaca tgaacgatga 1200

acatcaaaaa gtttgcaaaa caagcaacag tattaacctt tactaccgca ctgctggcag 1260

gaggcgcaac tcaagcgttt gcgaaagaaa cgaaccaaaa gccatataag gaaacatacg 1320

gcatttccca tattacacgc catgatatgc tgcaaatccc tgaacagcaa aaaaatgaaa 1380

aatatcaagt tcctgaattc gattcgtcca caattaaaaa tatctcttct gcaaaaggcc 1440

tggacgtttg ggacagctgg ccattacaaa acgctgacgg cactgtcgca aactatcacg 1500

gctaccacat cgtctttgca ttagccggag atcctaaaaa tgcggatgac acatcgattt 1560

acatgttcta tcaaaaagtc ggcgaaactt ctattgacag ctggaaaaac gctggccgcg 1620

tctttaaaga cagcgacaaa ttcgatgcaa atgattctat cctaaaagac caaacacaag 1680

aatggtcagg ttcagccaca tttacatctg acggaaaaat ccgtttattc tacactgatt 1740

tctccggtaa acattacggc aaacaaacac tgacaactgc acaagttaac gtatcagcat 1800

cagacagctc tttgaacatc aacggtgtag aggattataa atcaatcttt gacggtgacg 1860

gaaaaacgta tcaaaatgta cagcagttca tcgatgaagg caactacagc tcaggcgaca 1920

accatacgct gagagatcct cactacgtag aagataaagg ccacaaatac ttagtatttg 1980

aagcaaacac tggaactgaa gatggctacc aaggcgaaga atctttattt aacaaagcat 2040

actatggcaa aagcacatca ttcttccgtc aagaaagtca aaaacttctg caaagcgata 2100

aaaaacgcac ggctgagtta gcaaacggcg ctctcggtat gattgagcta aacgatgatt 2160

acacactgaa aaaagtgatg aaaccgctga ttgcatctaa cacagtaaca gatgaaattg 2220

aacgcgcgaa cgtctttaaa atgaacggca aatggtacct gttcactgac tcccgcggat 2280

caaaaatgac gattgacggc attacgtcta acgatattta catgcttggt tatgtttcta 2340

attctttaac tggcccatac aagccgctga acaaaactgg ccttgtgtta aaaatggatc 2400

ttgatcctaa cgatgtaacc tttacttact cacacttcgc tgtacctcaa gcgaaaggaa 2460

acaatgtcgt gattacaagc tatatgacaa acagaggatt ctacgcagac aaacaatcaa 2520

cgtttgcgcc aagcttcctg ctgaacatca aaggcaagaa aacatctgtt gtcaaagaca 2580

gcatccttga acaaggacaa ttaacagtta acaaataaaa acgcaaaaga aaatgccgat 2640

attgactacc ggaagcagtg tgaccgtgtg cttctcaaat gcctgattca ggctgtctat 2700

gtgtgactgt tgagctgtaa caagttgtct caggtgttca atttcatgtt ctagttgctt 2760

tgttttactg gtttcacctg ttctattagg tgttacatgc tgttcatctg ttacattgtc 2820

gatctgttca tggtgaacag ctttaaatgc accaaaaact cgtaaaagct ctgatgtatc 2880

tatctttttt acaccgtttt catctgtgca tatggacagt tttccctttg at 2932

<210> 6

<211> 510

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Met Ser His Ile Pro Ile Ser Asn Thr Ile Pro Thr Lys Gln Thr Asp

1 5 10 15

Gly Asn Gly Lys Ala Asn Ile Ser Pro Asp Lys Leu Asp Pro Lys Val

20 25 30

Ser Ile Asp Met Glu Ala Pro Glu Phe Lys Asp Phe Ala Lys Thr Met

35 40 45

Val Asp Phe Ile Ala Glu Tyr Leu Glu Asn Ile Arg Glu Arg Arg Val

50 55 60

Leu Pro Glu Val Lys Pro Gly Tyr Leu Lys Pro Leu Ile Pro Asp Ala

65 70 75 80

Ala Pro Glu Lys Pro Glu Lys Trp Gln Asp Val Met Gln Asp Ile Glu

85 90 95

Arg Val Ile Met Pro Gly Val Thr His Trp His Ser Pro Lys Phe His

100 105 110

Ala Tyr Phe Pro Thr Ala Asn Ser Tyr Pro Ala Ile Val Ala Asp Met

115 120 125

Leu Ser Gly Ala Ile Ala Cys Ile Gly Phe Thr Trp Ile Ala Ser Pro

130 135 140

Ala Cys Thr Glu Leu Glu Val Val Met Met Asp Trp Leu Gly Lys Met

145 150 155 160

Leu Glu Leu Pro Ala Glu Phe Leu Ala Cys Ser Gly Gly Lys Gly Gly

165 170 175

Gly Val Ile Gln Gly Thr Ala Ser Glu Ser Thr Leu Val Ala Leu Leu

180 185 190

Gly Ala Lys Ala Lys Lys Leu Lys Glu Val Lys Glu Leu His Pro Glu

195 200 205

Trp Asp Glu His Thr Ile Leu Gly Lys Leu Val Gly Tyr Cys Ser Asp

210 215 220

Gln Ala His Ser Ser Val Glu Arg Ala Gly Leu Leu Gly Gly Val Lys

225 230 235 240

Leu Arg Ser Val Gln Ser Glu Asn His Arg Met Arg Gly Ala Ala Leu

245 250 255

Glu Lys Ala Ile Glu Gln Asp Val Ala Glu Gly Leu Ile Pro Phe Tyr

260 265 270

Ala Val Val Thr Leu Gly Thr Thr Asn Ser Cys Ala Phe Asp Tyr Leu

275 280 285

Asp Glu Cys Gly Pro Val Gly Asn Lys His Asn Leu Trp Ile His Val

290 295 300

Asp Ala Ala Tyr Ala Gly Ser Ala Phe Ile Cys Pro Glu Tyr Arg His

305 310 315 320

Leu Met Lys Gly Ile Glu Ser Ala Asp Ser Phe Asn Phe Asn Pro His

325 330 335

Lys Trp Met Leu Val Asn Phe Asp Cys Ser Ala Met Trp Leu Lys Asp

340 345 350

Pro Ser Trp Val Val Asn Ala Phe Asn Val Asp Pro Leu Tyr Leu Lys

355 360 365

His Asp Met Gln Gly Ser Ala Pro Asp Tyr Arg His Trp Gln Ile Pro

370 375 380

Leu Gly Arg Arg Phe Arg Ala Leu Lys Leu Trp Phe Val Leu Arg Leu

385 390 395 400

Tyr Gly Val Glu Asn Leu Gln Ala His Ile Arg Arg His Cys Asn Phe

405 410 415

Ala Lys Gln Phe Gly Asp Leu Cys Val Ala Asp Ser Arg Phe Glu Leu

420 425 430

Ala Ala Glu Ile Asn Met Gly Leu Val Cys Phe Arg Leu Lys Gly Ser

435 440 445

Asn Glu Arg Asn Glu Ala Leu Leu Lys Arg Ile Asn Gly Arg Gly His

450 455 460

Ile His Leu Val Pro Ala Lys Ile Lys Asp Val Tyr Phe Leu Arg Met

465 470 475 480

Ala Ile Cys Ser Arg Phe Thr Gln Ser Glu Asp Met Glu Tyr Ser Trp

485 490 495

Lys Glu Val Ser Ala Ala Ala Asp Glu Met Glu Gln Glu Gln

500 505 510

<210> 7

<211> 486

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Met Asn Ala Ser Asp Phe Arg Arg Arg Gly Lys Glu Met Val Asp Tyr

1 5 10 15

Met Ala Asp Tyr Leu Glu Gly Ile Glu Gly Arg Gln Val Tyr Pro Asp

20 25 30

Val Gln Pro Gly Tyr Leu Arg Pro Leu Ile Pro Ala Thr Ala Pro Gln

35 40 45

Glu Pro Asp Thr Phe Glu Asp Ile Leu Gln Asp Val Glu Lys Ile Ile

50 55 60

Met Pro Gly Val Thr His Trp His Ser Pro Tyr Phe Phe Ala Tyr Phe

65 70 75 80

Pro Thr Ala Ser Ser Tyr Pro Ala Met Leu Ala Asp Met Leu Cys Gly

85 90 95

Ala Ile Gly Cys Ile Gly Phe Ser Trp Ala Ala Ser Pro Ala Cys Thr

100 105 110

Glu Leu Glu Thr Val Met Met Asp Trp Leu Gly Lys Met Leu Gln Leu

115 120 125

Pro Glu Ala Phe Leu Ala Gly Glu Ala Gly Glu Gly Gly Gly Val Ile

130 135 140

Gln Gly Ser Ala Ser Glu Ala Thr Leu Val Ala Leu Leu Ala Ala Arg

145 150 155 160

Thr Lys Val Thr Arg Arg Leu Gln Ala Ala Ser Pro Gly Leu Thr Gln

165 170 175

Gly Ala Val Leu Glu Lys Leu Val Ala Tyr Ala Ser Asp Gln Ala His

180 185 190

Ser Ser Val Glu Arg Ala Gly Leu Ile Gly Gly Val Lys Leu Lys Ala

195 200 205

Ile Pro Ser Asp Gly Lys Phe Ala Met Arg Ala Ser Ala Leu Gln Glu

210 215 220

Ala Leu Glu Arg Asp Lys Ala Ala Gly Leu Ile Pro Phe Phe Val Val

225 230 235 240

Ala Thr Leu Gly Thr Thr Ser Cys Cys Ser Phe Asp Asn Leu Leu Glu

245 250 255

Val Gly Pro Ile Cys His Glu Glu Asp Ile Trp Leu His Val Asp Ala

260 265 270

Ala Tyr Ala Gly Ser Ala Phe Ile Cys Pro Glu Phe Arg His Leu Leu

275 280 285

Asn Gly Val Glu Phe Ala Asp Ser Phe Asn Phe Asn Pro His Lys Trp

290 295 300

Leu Leu Val Asn Phe Asp Cys Ser Ala Met Trp Val Lys Arg Arg Thr

305 310 315 320

Asp Leu Thr Gly Ala Phe Lys Leu Asp Pro Val Tyr Leu Lys His Ser

325 330 335

His Gln Gly Ser Gly Leu Ile Thr Asp Tyr Arg His Trp Gln Leu Pro

340 345 350

Leu Gly Arg Arg Phe Arg Ser Leu Lys Met Trp Phe Val Phe Arg Met

355 360 365

Tyr Gly Val Lys Gly Leu Gln Ala Tyr Ile Arg Lys His Val Gln Leu

370 375 380

Ser His Glu Phe Glu Ala Phe Val Leu Gln Asp Pro Arg Phe Glu Val

385 390 395 400

Cys Ala Glu Val Thr Leu Gly Leu Val Cys Phe Arg Leu Lys Gly Ser

405 410 415

Asp Gly Leu Asn Glu Ala Leu Leu Glu Arg Ile Asn Ser Ala Arg Lys

420 425 430

Ile His Leu Val Pro Cys Arg Leu Arg Gly Gln Phe Val Leu Arg Phe

435 440 445

Ala Ile Cys Ser Arg Lys Val Glu Ser Gly His Val Arg Leu Ala Trp

450 455 460

Glu His Ile Arg Gly Leu Ala Ala Glu Leu Leu Ala Ala Glu Glu Gly

465 470 475 480

Lys Ala Glu Ile Lys Ser

485

<210> 8

<211> 480

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 8

Met Asp Ala Ser Glu Phe Arg Arg Arg Gly Lys Glu Met Val Asp Tyr

1 5 10 15

Val Ala Asp Tyr Met Glu Gly Ile Glu Gly Arg Gln Val Tyr Pro Asp

20 25 30

Val Glu Pro Gly Tyr Leu Arg Pro Leu Ile Pro Thr Thr Ala Pro Gln

35 40 45

Glu Pro Asp Thr Phe Glu Asp Ile Ile Asn Asp Val Glu Lys Ile Ile

50 55 60

Met Pro Gly Val Thr His Trp His Ser Pro Tyr Phe Phe Ala Tyr Phe

65 70 75 80

Pro Thr Ala Ser Ser Tyr Pro Ser Met Leu Ala Asp Met Leu Cys Gly

85 90 95

Ala Ile Gly Cys Ile Gly Phe Ser Trp Ala Ala Ser Pro Ala Cys Thr

100 105 110

Glu Leu Glu Thr Val Met Met Asp Trp Leu Gly Lys Met Leu Gln Leu

115 120 125

Pro Glu Ala Phe Leu Ala Gly Asn Ala Gly Glu Gly Gly Gly Val Ile

130 135 140

Gln Gly Ser Ala Ser Glu Ala Thr Leu Val Ala Leu Leu Ala Ala Arg

145 150 155 160

Thr Lys Val Thr Arg Arg Leu Gln Ala Ala Ser Pro Gly Leu Thr Gln

165 170 175

Ala Ala Ile Met Glu Lys Leu Val Ala Tyr Ser Ser Asp Gln Ala His

180 185 190

Ser Ser Val Glu Arg Ala Gly Leu Ile Gly Gly Val Lys Leu Lys Ala

195 200 205

Ile Pro Ser Asp Gly Lys Phe Ala Met Arg Ala Ser Ala Leu Gln Glu

210 215 220

Ala Leu Glu Arg Asp Lys Ala Ala Gly Leu Ile Pro Phe Phe Val Val

225 230 235 240

Ala Thr Leu Gly Thr Thr Ser Cys Cys Ser Phe Asp Asn Leu Leu Glu

245 250 255

Val Gly Pro Ile Cys Ile Lys Glu Asp Val Trp Leu His Ile Asp Ala

260 265 270

Ala Tyr Ala Gly Ser Ala Phe Ile Cys Pro Glu Phe Arg Pro Leu Leu

275 280 285

Asn Gly Val Glu Phe Ala Asp Ser Phe Asn Phe Asn Pro His Lys Trp

290 295 300

Leu Leu Val Asn Phe Asp Cys Ser Ala Met Trp Val Lys Lys Arg Thr

305 310 315 320

Asp Leu Thr Gly Ala Phe Lys Leu Asp Pro Val Tyr Leu Lys His Ser

325 330 335

His Gln Asp Ser Gly Leu Ile Thr Asp Tyr Arg His Trp Gln Leu Pro

340 345 350

Leu Gly Arg Arg Phe Arg Ser Leu Lys Met Trp Phe Val Phe Arg Met

355 360 365

Tyr Gly Ile Lys Gly Leu Gln Ala Tyr Ile Arg Lys His Val Gln Leu

370 375 380

Ser His Glu Phe Glu Ser Leu Val Gln Gln Asp Pro Arg Phe Glu Ile

385 390 395 400

Cys Ala Glu Val Thr Leu Gly Leu Val Cys Phe Arg Leu Lys Gly Ser

405 410 415

Asn Lys Leu Thr Lys Ala Leu Leu Glu Arg Ile Asn Asn Ala Lys Lys

420 425 430

Ile His Leu Val Pro Cys His Leu Arg Asp Lys Phe Val Leu Arg Phe

435 440 445

Ala Ile Cys Ser Arg Thr Val Glu Ser Ala His Val Gln Leu Ala Trp

450 455 460

Glu His Ile Arg Gly Leu Ala Thr Glu Leu Leu Lys Ala Glu Lys Glu

465 470 475 480

Claims

1. A recombinant bacterium is obtained by introducing specific DNA molecules into Escherichia coli; the specific DNA molecule has levodopa decarboxylase gene.

2. The recombinant bacterium according to claim 1, wherein: the specific DNA molecule also has a regulatory element for promoting the expression of the levodopa decarboxylase gene.

3. The recombinant bacterium according to claim 2, wherein: in the specific DNA molecule, the regulatory element is positioned at the upstream of the levodopa decarboxylase gene and is a regulatory element P1.

4. The recombinant bacterium according to any one of claims 1 to 3, wherein: the specific DNA molecule is integrated into the genomic DNA of E.coli.

5. The recombinant bacterium according to any one of claims 1 to 3, wherein: the specific DNA molecule replaces the FeaB gene coding frame in the genome DNA of the escherichia coli.

6. The recombinant bacterium according to any one of claims 1 to 5, wherein: the levodopa decarboxylase is levodopa decarboxylase derived from drosophila, levodopa decarboxylase derived from wild pigs or levodopa decarboxylase derived from wild horses.

7. Use of the recombinant bacterium of any one of claims 1 to 6 for producing dopamine or a downstream product of the dopamine pathway.

8. Application of levodopa decarboxylase or a coding gene thereof or a mutant protein derived from the levodopa decarboxylase or the coding gene thereof in producing dopamine or downstream products of a dopamine pathway.

9. Escherichia coli (Escherichia coli) TD03, with a preservation number of CGMCC No. 21210.

10. Use of an escherichia coli bacterium according to claim 9 for the production of dopamine or a downstream product of the dopamine pathway.