CN111926002B

CN111926002B - TrpE mutant and application thereof in gene engineering bacteria for producing L-tryptophan

Info

Publication number: CN111926002B
Application number: CN202010972530.8A
Authority: CN
Inventors: 张大伟; 丁冬芹; 柏丹阳; 朱亚如
Original assignee: Tianjin Institute of Industrial Biotechnology of CAS
Current assignee: Tianjin Institute of Industrial Biotechnology of CAS
Priority date: 2020-09-16
Filing date: 2020-09-16
Publication date: 2021-01-05
Anticipated expiration: 2040-09-16
Also published as: CN111926002A

Abstract

The invention discloses a mutant of TrpE protein and application thereof in genetic engineering bacteria for producing L-tryptophan. Specifically, feedback inhibition of a key gene TrpE in an L-tryptophan metabolic branching pathway is relieved by means of genetic engineering, and the genetic engineering bacteria with high L-tryptophan yield are obtained. Furthermore, the supply of precursors is improved, negative regulatory factors in the pathway are removed, and the metabolic flow of the L-tryptophan synthetic pathway is enlarged by over-expressing key genes of the L-tryptophan metabolic pathway, so that the yield of the L-tryptophan is improved.

Description

TrpE mutant and application thereof in gene engineering bacteria for producing L-tryptophan

Technical Field

The invention belongs to the field of genetic engineering and microorganisms, and particularly relates to a TrpE mutant, a genetic engineering bacterium for producing L-tryptophan, a construction method thereof and application thereof in producing L-tryptophan.

Background

L-tryptophan is the second most important essential amino acid of eight essential amino acids of human and animals, participates in the synthesis and metabolic network regulation of human proteins, is widely present in the natural world, and is also one of the important members of aromatic amino acids. L-tryptophan is a precursor of various important bioactive substances, such as pigments, 5-hydroxytryptamine, indole, alkaloids, melatonin and the like, and is widely applied to the industries of medicines, foods, feeds and the like. With the increasing demand of L-tryptophan at home and abroad, the L-tryptophan becomes an important research hotspot. The production method of L-tryptophan includes chemical synthesis, conversion and microbial fermentation. Among them, the microbial fermentation method has been widely used in the production of L-tryptophan due to its advantages of easily available raw materials, low cost, high purity of final product, easy extraction, environmental protection, etc. Escherichia coli is used as a model strain with wide application, and has been widely applied to metabolic engineering modification of industrial commodities due to the advantages of clear genetic background, simple genetic modification, faster propagation, easy culture and the like.

With the development of gene recombination technology, the synthesis path of L-tryptophan is gradually developed by utilizing the genetic engineering means to modify. In the case of no chemical mutagenesis, Zhao Shi Jun et al apply the research strategy of metabolic engineering to produce L-tryptophanE. coliOn the basis of W3110, the yield of L-tryptophan is improved to 17.7g/L through a series of gene operations (construction of Zhao Shi Jun. L-tryptophan production strain and metabolic regulation research [ D)]Wuxi, Jiangnan university, 2011.). In 2017, Chen et al obtained L-tryptophan engineering strain S028 through a genetic engineering pure transformation method, and after fermentation for 61h, the L-tryptophan yield reached 40.3g/L (Chen L et al, Applied microbiology and biotechnology, 2017, 101(2): 559-568). In 1993, Syoji Azuma et al added pluronic L-61 to the fermentation culture to crystallize L-tryptophan and reached a L-tryptophan yield of 54.5g/L (Azuma S et al, Applied Microbiology and Biotechnology, 1993, 39(4-5): 471-) 476).

Disclosure of Invention

The invention aims to modify genes of L-tryptophan related metabolic pathways in bacteria, particularly escherichia coli, by a genetic engineering method so as to obtain an L-tryptophan production strain.

The invention firstly provides a mutant of anthranilate synthase TrpE, so that a catalytic pocket of TrpE protein is always in a closed state, and the TrpE protein can always perform a normal catalytic function to generate anthranilic acid no matter whether L-tryptophan exists or not. Preferably, the polypeptide amino acid sequence has only the following mutations relative to the wild-type sequence: substitution of amino acid A at position 63 with V. Preferably, the amino acid sequence is as set forth in SEQ ID NO: 1. further provides a coding gene for coding the mutant and a recombinant host cell containing the coding gene for the mutant.

The invention further provides a genetically engineered bacterium for producing L-tryptophan, wherein a TrpE protein gene is introduced and mutated into a starting bacterium to relieve the inhibition effect of TrpE by L-tryptophan, or the TrpE protein gene in the starting bacterium is mutated by a gene site-directed mutagenesis method to relieve the inhibition effect of TrpE by L-tryptophan. Preferably, the mutation is to replace the amino acid residue at position A63 in the TrpE protein by V, and further, the starting bacterium is E.coli, more preferably, the starting bacterium is E.coli strain KW (Chen, Y et al. Journal of Industrial Microbiol & Biotechnology, 2018, 45(5): 357-367.).

Preferably, AroG and/or TrpE and/or PpSA are overexpressed in the genetically engineered bacteria, and/or TrpR is knocked out. The overexpression can be realized by conventional transformation of the gene, and the knockout of TrpR can be realized by methods such as homologous recombination and gene editing. More preferably, AroG, TrpE and PpSA are overexpressed in the genetically engineered bacteria, and TrpR is knocked out. Wherein, the over-expression of AroG and TrpE is realized by introducing the plasmid carrying the expression frame into the genetic engineering bacteria; overexpression is carried out by introducing tac promoter into genome of genetically engineered bacteriappsAThe gene(s) is (are),

the present invention also provides a method for constructing an L-tryptophan-producing genetically engineered bacterium, which comprises introducing into a starting bacterium a TrpE protein gene having a mutation capable of releasing the inhibitory effect of L-tryptophan on TrpE, preferably, replacing the amino acid residue at position A63 in the TrpE protein with V.

Furthermore, AroG, and/or TrpE, and/or PpSA, and/or TrpR are subjected to knockout through genetic engineering technology in genetically engineered bacteria. Preferably, AroG, TrpE and PpSA are simultaneously overexpressed in the genetically engineered bacteria through a genetic engineering technology, and TrpR is knocked out.

In one embodiment, the method for constructing the L-tryptophan genetic engineering bacteria comprises the following steps:

1) the Escherichia coli strain KW is introduced with genearoGAndtrpEDCBAconstructing a strain KBD 1;

2) over-expression on the genomeppsAGene construction of strain KBD 2;

3) knock-outtrpRA gene; constructing a strain KBD 3;

4) in the strain KBD3, the strain,the final product tryptophan inhibition resistant mutant TrpE is obtained by replacing the 63 th amino acid residue A63 of anthranilic acid (ANTA) synthase TrpE with V^fbrAnd constructing a strain KBD4, wherein the amino acid sequence of the mutated TrpE (A63V) is shown in SEQ ID NO: 1;

the invention further provides application of the genetic engineering bacteria in producing L-tryptophan. Specifically, the method comprises the steps of fermenting the genetically engineered bacteria and then collecting L-tryptophan, and specifically collecting L-tryptophan from fermentation supernatant. Wherein the genetic engineering bacteria are subjected to fermentation culture for 38-42h, and L-tryptophan is collected from the supernatant of the fermentation liquid. More preferably, the method further comprises a step of purifying the L-tryptophan.

According to the invention, through the constructed genetic engineering bacteria, shake flask fermentation verification shows that the feedback inhibition of the final product tryptophan on TrpE is relieved by introducing TrpE (A63V) mutation, the yield of L-tryptophan is obviously improved, and compared with a control strain KW, the yield is improved by 1.68 times. Therefore, the gene engineering bacteria obtained by the invention can be used for fermentation to obtain the effective accumulation of the product L-tryptophan, lays a foundation for the industrial production of the L-tryptophan and has strong practical and application values.

Drawings

FIG. 1: plasmid map of PH5 a-aroG-trpeDCBA.

FIG. 2: TrpE protein kinetics mimic diagram.

FIG. 3: and (3) performing shake flask fermentation on the L-tryptophan producing strain.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention.

The experimental procedures in the following examples are conventional unless otherwise specified.

The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.

The quantitative tests in the following examples, all set up three replicates and the results averaged.

The amino acid sequence of the mutant TrpE (A63V) is shown in SEQ ID NO: 1 is shown.

KW strains are described in the following documents: chen, Y.et al, radial design and analysis of an Escherichia coli strain for high-efficiency trpophan production. Journal of Industrial Microbiol & Biotechnology, 45(5), 357 and 367 (2018).

Example 1 construction of L-Tryptophan-producing Strain KBD1

The L-tryptophan metabolic pathway is characterized in that glucose enters into cells, two important precursors of L-tryptophan, namely phosphoenolpyruvate (PEP) and erythrose 4-phosphate (E4P), are synthesized through a glycolysis pathway and a pentose phosphate pathway respectively, and then enter a shikimic acid pathway through DAHP synthase AroG condensation to finally generate chorismate. Then, the chorismic acid enters an L-tryptophan branched synthesis way under the catalysis of anthranilate synthase TrpE, so that the target product L-tryptophan is finally generated. Therefore, in order to construct an L-tryptophan-producing strain, the two enzymes AroG and TrpE occupying key nodes in the L-tryptophan synthesis pathway were first overexpressed.

Construction of the PH5 a-aroG-trpECBA plasmid: the aroG fragment with the adaptor was amplified using the wild type E.coli MG1655 as a template and the primer aroG-F, aroG-R. A adaptor-ligated pH5a-M fragment was amplified at pH5a-M-F, PH5a-M-R using the pH5a plasmid as a template. The aroG-M-Gibson fragment for Gibson assembly was obtained by amplifying the aroG-F, PH5a-M-R primer using the aroG fragment and the PH5a-M fragment as templates. A ligated trpeDCBA-Gibson fragment was amplified using the primer trpeDCBA-F, trpEDCBA-R, using MG1655 as a template. The plasmid backbone with the linker was amplified at pH5a-ver-F, PH5a-ver-R, and Gibson analysis was performed with the above aroG-M-Gibson fragment and trpeDCBA-Gibson fragment to obtain the plasmid pH5a-aroG-trpeDCBA, the plasmid map is shown in FIG. 1.

TABLE 1 primers used for construction of L-tryptophan-producing strain KBD1

Primer name	Nucleotide sequence (5 '-3')
		Primer aroG-F (SEQ ID NO: 3)	CGCATCCGACAATTAAACCTTACCCGCGACGCGCTTTTA
Primer aroG-R (SEQ ID NO: 4)	TGGCAACACTGGAACAGACATGAATTATCAGAACGACGA
		Primer PH5a-M-F (SEQ ID NO: 5)	CGTCGTTCTGATAATTCATGTCTGTTCCAGTGTTGCCAT
Primer PH5a-M-R (SEQ ID NO: 6)	AGCGGCGACGCGCAGTTAATCCCACAGCCGCCAGTTCCG
		Primer trpeDCBA-F (SEQ ID NO: 7)	GGAACTGGCGGCTGTGGGATTAACTGCGCGTCGCCGCTT
Primer trpeDCBA-R (SEQ ID NO: 8)	ACAAAATTAGAGAATAACAATGCAAACACAAAAACCGAC
		Primer PH5a-ver-F (SEQ ID NO: 9)	TCGGTTTTTGTGTTTGCATTGTTATTCTCTAATTTTGTT
Primer PH5a-ver-R (SEQ ID NO: 10)	AAAAGCGCGTCGCGGGTAAGGTTTAATTGTCGGATGCGC

Plasmid pH5 a-aroG-trpECBA was transformed into strain KW to construct tryptophan producer strain KBD 1. The strains and plasmids used in this section were as follows:

TABLE 2 construction of L-Tryptophan-producing Strain KBD1 strains and plasmids

Strains or plasmids	Correlation property
		Strain MG1655	F^- λ^- ilvG- rfb-50 rph-1
Strain KW	Escherichia coli W3110-derived strain, L-tryptophan-producing strain
		Strain KBD1	KW derivative strain, overexpression in KW strainaroGAndtrpEDCBA
plasmid pH5a	PH5a ori；Tet^R(ii) a Tac promoter
		Plasmid PH5a-aroG-trpeDCBA	PH5 a-derived plasmid, overexpressionaroG，trpEDCBA

Example 2 construction of L-Tryptophan-producing Strain KBD2

PEP is an important precursor for L-tryptophan synthesis, and Ppps A is a PEP synthase which catalyzes the production of PEP from pyruvate, so Ppps is overexpressed to increase the supply of PEP.

construction of cas9-ppsA plasmid: the ligated ppsA-UP fragment was amplified with the primer ppsA-UP-F, ppsA-UP-R and the ligated ppsA-Down fragment was amplified with the primer ppsA-Down-F, ppsA-Down-R using the wild type E.coli MG1655 as a template. The ppsA-UP fragment and the ppsA-Down fragment were assembled into the ppsA-UD fragment. The cas9 plasmid was used as a template, and the plasmid backbone ppsA-ver1 fragment was amplified with the primer ppsA-N20-F, ppsA-ver-R, and the plasmid backbone tnaA-ver2 fragment was amplified with the primer ppsA-ver-F, ppsA-N20-R. Plasmid frameworks ppsA-ver1, ppsA-ver2 and the above fragment ppsA-UD were ligated together by Gibson assembly (Gibson assembly method: Gibson et al, which achieved intermolecular ligation of multiple DNA fragments in 1 reaction) to obtain cas9-ppsA plasmid.

TABLE 3 primers used for the construction of L-tryptophan-producing strain KBD2

Overexpression on the genome of the strain KBD1 by introduction of tac promoterppsAGene, a tryptophan-producing strain KBD2 was constructed. The strains and plasmids used in this section were as follows:

TABLE 4 construction of L-Tryptophan-producing Strain KBD2 strains and plasmids

Strains or plasmids	Correlation property
		Strain MG1655	F^- λ^- ilvG- rfb-50 rph-1
Strain KBD1	KW derivative strain, overexpression in KW strainaroGAndtrpEDCBA
		strain KBD2	KBD 1-derived strain, over-expressed in KBD1 strainppsA
Plasmid CRISPR/Cas9	pSC101 ori；AMP^R(ii) a araBAD promoter
		Plasmid cas9-ppsA	cas 9-derived plasmid for replacementppsAThe gene promoter is tac promoter

Example 3 construction of L-Tryptophan-producing Strain KBD3

TrpR regulatory factors are involved in tryptophan biosynthesis, transport and regulation. TrpR is a tryptophan transcription repressor that negatively regulates the expression of the trp regulator in response to intracellular tryptophan levels. TrpR inhibits gene transcription by interfering with RNA polymerase interaction with the promoter. When the intracellular tryptophan concentration reaches a certain amount, TrpR is triggered to inhibit the transcription of multiple genes. Therefore, TrpR was knocked out in order to release the inhibitory effect of tryptophan.

construction of cas9-trpR plasmid: the wild type Escherichia coli MG1655 is used as a template, a ligated trpR-UP fragment is amplified with a primer trpR-UP-F, trpR-UP-R, and a ligated trpR-Down fragment is amplified with a primer trpR-Down-F, trpR-Down-R. the trpR-UP fragment and the trpR-Down fragment are assembled into a trpR-UD fragment. Using cas9 plasmid as template, using primers trpR-N20-F, trpR-ver-R to amplify plasmid skeleton trpR-ver1 fragment, and using primers trpR-ver-F, trpR-N20-R to amplify plasmid skeleton trpR-ver2 fragment. The plasmid frameworks trpR-ver1 and trpR-ver2 and the above fragment trpR-UD were ligated with each other by Gibson assembly (Gibson assembly method, which is achieved by intermolecular ligation of multiple DNA fragments in 1 reaction according to Gibson et al) to obtain cas9-trpR plasmid.

The primers used in this section were as follows:

TABLE 5 primers used for construction of L-tryptophan-producing strain KBD3

Primer name	Nucleotide sequence (5 '-3')
		Primer trpR-up-F (SEQ ID NO: 19)	AATCCATGGGCCTGTAGCAGCTTATAACGCCGGA
Primer trpR-up-R (SEQ ID NO: 20)	ATCAGGCCTACAAAAAATATGTCGCCATTGTTAGC
		Primer trpR-down-F (SEQ ID NO: 21)	CAATGGCGACATATTTTTTGTAGGCCTGATAAGAC
Primer trpR-down-R (SEQ ID NO: 22)	CCAAGCTTCCATTCATGGTCCCGTGATGTCGCGT
		Primer trpR-ver-F (SEQ ID NO: 23)	ACATCACGGGACCATGAATGGAAGCTTGGATTCTC
Primer trpR-ver-R (SEQ ID NO: 24)	GCGTTATAAGCTGCTACAGGCCCATGGATTCTTC
		Primer trpR-N20-F (SEQ ID NO: 25)	GCCAGATGAGCGCGAAGCGTGTTTTAGAGCTAGAAATAGC
Primer trpR-N20-R (SEQ ID NO: 26)	ACGCTTCGCGCTCATCTGGCGCTAAGATCTGACTCCATAA

Knock-out of regulatory factors in strain KBD2trpRThereafter, a tryptophan-producing strain KBD3 was constructed. The strains and plasmids used in this section were as follows:

TABLE 6 construction of L-Tryptophan-producing Strain KBD3 strains and plasmids

Strains or plasmids	Correlation property
		Strain MG1655	F^- λ^- ilvG- rfb-50 rph-1
Strain KBD2	KBD 1-derived strain, over-expressed in KBD1 strainppsA
		Strain KBD3	KBD 2-derived strain, knock-out in KBD2 straintryR
Plasmid CRISPR/Cas9	pSC101 ori；AMP^R(ii) a araBAD promoter
		Plasmid cas9-trpR	cas 9-derived plasmid for gene knock-outtrpR

Example 4 construction of L-Tryptophan-producing Strain KBD4

ANTA synthase TrpE catalyzes the production of anthranilic acid from chorismate and glutamine derived from the shikimate pathway, which is the first reaction of the tryptophan-terminal branch pathway. However, TrpE is inhibited by the end product tryptophan, i.e., after a certain amount of tryptophan is produced, it inhibits the activity of TrpE enzyme, thus hindering the production of more tryptophan, which results in a large degree of failure to increase tryptophan production.

In order to investigate the inhibition mechanism of TrpE protein by L-tryptophan, the TrpE protein was subjected to kinetic simulation in the absence and presence of L-tryptophan, respectively. As a result, as shown in FIG. 2, in the absence of L-tryptophan, the catalytic pocket of the TrpE protein was in a normal state, i.e., a closed state (gray). When L-tryptophan is present, it can bind to the TrpE protein, causing a structural change in the TrpE protein and causing it to catalyze the transition of the pocket from a closed to an open state (grayish white). In the open state, the TrpE protein cannot bind to the substrate chorismate, thus hindering its catalytic function and failing to produce anthranilic acid. When V is introduced into the TrpE protein at the amino acid A63, the catalytic pocket of the TrpE protein is always closed regardless of the presence or absence of L-tryptophan by kinetic simulation. That is, the TrpE protein always functions normally as a catalyst to produce anthranilic acid, regardless of the presence of L-tryptophan. Thus, to release the inhibitory effect of the final product tryptophan on TrpE, V was introduced at residue A63 of TrpE. The amino acid sequence of the mutant TrpE (A63V) is shown in SEQ ID NO: 1 is shown. The nucleotide sequence of the coding gene adopted in the embodiment is shown as SEQ ID NO: 2 is shown in

PH5a-aroG-trpE^fbrConstructing a DCBA plasmid: the ligated trpE1-Gibson fragment was amplified using the plasmid pH5a-aroG-trpeDCBA as template and the primer trpE-M1-F, trpE-M1-R. Amplification of the adaptor-ligated trpE2-Gibson fragment using the primer trpE-M2-F, trpE-M2-R with the plasmid PH5a-aroG-trpeDCBA as template, and Gibson analysis of the above trpE1-Gibson fragment to give PH5a-aroG^fbr-trpE^fbrThe DCBA plasmid.

The primers used in this section were as follows:

TABLE 7 primers used for construction of L-tryptophan-producing strain KBD4

Primer name	Nucleotide sequence (5 '-3')
		Primer trpE-M1-F (SEQ ID NO: 27)	GCTGCGCATTACAGTTTTAGGTGACACTGTCACAA
Primer trpE-M1-R (SEQ ID NO: 28)	CGCCCCAGCTCATCAGGTCAGCGAGATATTGTGGG
		Primer trpE-M2-F (SEQ ID NO: 29)	CCACAATATCTCGCTGACCTGATGAGCTGGGGCGC
Primer trpE-M2-R (SEQ ID NO: 30)	CAGTGTCACCTAAAACTGTAATGCGCAGCGCACTG

Plasmid pH5a-aroG-trpE^fbrDCBA was introduced into strain KW or, on the basis of strain KBD1, plasmid PH5a-aroG-trpE^fbrReplacing the pH5a-aroG-trpeDCBA plasmid in KBD3 with DCBA to obtain KBD4 (i.e., culturing KBD3 without antibiotic to lose the pH5a-aroG-trpeDCBA, and introducing pH5a-aroG-trpE^fbrDCBA plasmid, the latter used in this example, due to the material of the pre-existing strain KBD 3). Used in this sectionThe strains and plasmids obtained were as follows:

TABLE 8 construction of L-Tryptophan-producing Strain KBD4 strains and plasmids

Strains or plasmids	Correlation property
		Strain MG1655	F^- λ^- ilvG- rfb-50 rph-1
Strain KBD3	KBD 2-derived strain, knock-out in KBD2 straintryR
		Strain KBD4	KBD 3-derived strain containing plasmid PH5a-aroG-trpE^fbrDCBA
Plasmid PH5a-aroG-trpE^fbrDCBA	PH5a-aroG-trpeDCBA derivative plasmid, the A63 amino acid of the mutant TrpE is V

Example 5 preparation of L-Tryptophan-producing Strain

1. Fermentation of L-tryptophan-producing strains

The shake flask fermentation process of the L-tryptophan producing strains KW and KBD1-KBD4 of escherichia coli is as follows:

(1) slant activation culture: from-80^oC refrigerator taking out the preserved strain and streaking on tetracycline resistant solid medium, 37^oC culturing for 12-18 h.

(2) Seed culture: by inoculationPicking single colony from fresh activated slant to seed basic culture medium (50 mL LB culture medium in 500mL triangular flask, sealing with sealing film), 37^oC. Shaking at 220r/min for 6-8h to OD₆₀₀About 2 to about 3.

(3) Shake flask batch fermentation culture: inoculating the seed culture solution into tetracycline resistant fermentation minimal medium (500 mL triangular flask, liquid loading amount of 50mL, sealing with sealing film) at an inoculation amount of 10%, and adding into 37% of the culture solution^oC. Shaking culture at 220r/min for L-tryptophan batch fermentation for 36-42 h. Shake flask fermentation media table 15:

TABLE 9L-Tryptophan fermentation Medium formulation

Media composition	Content (wt.)
		Glucose	20g/L
(NH₄)₂SO₄	10g/L
		KH₂PO₄	5g/L
yeast	2g/L
		mops	0.4M
MgSO₄	5g/L
		FeSO₄7H₂O	15mg/L
Sodium citrate	0.5g/L
		VB1	100mg/L
CuSO₄·5H₂O	4mg/L
		ZnSO₄·7H₂O	4mg/L
MnSO₄H₂O	15mg/L

2. High Performance Liquid Chromatography (HPLC) detection of fermentation strains

Centrifuging the fermentation liquid in a refrigerated centrifuge at 5500rpm/min for 15-20min, collecting supernatant, filtering the supernatant with 0.22 μm filter membrane, and performing HPLC detection.

The HPLC conditions were as follows: the column was a ZORBAX Eclipse AAA (amino acid analysis) column, mobile phase A: 40mM Na₂HPO₄pH 7.8, mobile phase B: methanol: acetonitrile: water =45:45:10, v/v/v. The elution gradient is 0-1min,100% A, 9.8min, 43% A +57% B, 10min, 100% B, 12min, 100% B, 12.5min, 100% A. The flow rate is 2.0mL/min, the RID and VWD detectors are connected in series, and the temperature of the detection cell is controlled to be 40^oC, the sample injection amount is 10 mu L, the analysis time is 26min, and the ultraviolet detection wavelength is 338 nm.

3. Fermentation results and analysis of L-tryptophan-producing strains KW and KBD1-KBD4

After the strains KW and KBD1-KBD4 are subjected to fermentation culture for 38-42h, HPLC detection is carried out on fermentation broth supernatant, and the results are shown in FIG. 3. As can be seen from the fermentation results, after DAHP synthase AroG and anthranilate synthase TrpE are introduced on the basis of the strain KW, the tryptophan production capacity of the strain KBD1 is improved by 38% on the basis of the strain KW, and the L-tryptophan yield reaches 0.32 g/L. On the basis, after PpSA is over-expressed and TrpR is knocked out, the tryptophan yield of the strain KBD3 is further improved to 0.44 g/L. Therefore, the efficiency of the L-tryptophan synthesis pathway is improved after the supply of the precursor PEP is improved and the tryptophan negative regulatory factor is removed. Finally, through introducing TrpE (A63V) mutation, the feedback inhibition of the final product tryptophan on TrpE is relieved, and the yield of L-tryptophan is improved to 0.62g/L, which is improved by 1.68 times compared with a control strain KW.

Sequence listing

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> TrpE mutant and application thereof in L-tryptophan production genetic engineering bacteria

<160> 30

<170> SIPOSequenceListing 1.0

<210> 1

<211> 520

<212> PRT

<213> Escherichia coli

<400> 1

Met Gln Thr Gln Lys Pro Thr Leu Glu Leu Leu Thr Cys Glu Gly Ala

1 5 10 15

Tyr Arg Asp Asn Pro Thr Ala Leu Phe His Gln Leu Cys Gly Asp Arg

20 25 30

Pro Ala Thr Leu Leu Leu Glu Ser Ala Asp Ile Asp Ser Lys Asp Asp

35 40 45

Leu Lys Ser Leu Leu Leu Val Asp Ser Ala Leu Arg Ile Thr Val Leu

50 55 60

Gly Asp Thr Val Thr Ile Gln Ala Leu Ser Gly Asn Gly Glu Ala Leu

65 70 75 80

Leu Ala Leu Leu Asp Asn Ala Leu Pro Ala Gly Val Glu Ser Glu Gln

85 90 95

Ser Pro Asn Cys Arg Val Leu Arg Phe Pro Pro Val Ser Pro Leu Leu

100 105 110

Asp Glu Asp Ala Arg Leu Cys Ser Leu Ser Val Phe Asp Ala Phe Arg

115 120 125

Leu Leu Gln Asn Leu Leu Asn Val Pro Lys Glu Glu Arg Glu Ala Met

130 135 140

Phe Phe Gly Gly Leu Phe Ser Tyr Asp Leu Val Ala Gly Phe Glu Asp

145 150 155 160

Leu Pro Gln Leu Ser Ala Glu Asn Asn Cys Pro Asp Phe Cys Phe Tyr

165 170 175

Leu Ala Glu Thr Leu Met Val Ile Asp His Gln Lys Lys Ser Thr Arg

180 185 190

Ile Gln Ala Ser Leu Phe Ala Pro Asn Glu Glu Glu Lys Gln Arg Leu

195 200 205

Thr Ala Arg Leu Asn Glu Leu Arg Gln Gln Leu Thr Glu Ala Ala Pro

210 215 220

Pro Leu Pro Val Val Ser Val Pro His Met Arg Cys Glu Cys Asn Gln

225 230 235 240

Ser Asp Glu Glu Phe Gly Gly Val Val Arg Leu Leu Gln Lys Ala Ile

245 250 255

Arg Ala Gly Glu Ile Phe Gln Val Val Pro Ser Arg Arg Phe Ser Leu

260 265 270

Pro Cys Pro Ser Pro Leu Ala Ala Tyr Tyr Val Leu Lys Lys Ser Asn

275 280 285

Pro Ser Pro Tyr Met Phe Phe Met Gln Asp Asn Asp Phe Thr Leu Phe

290 295 300

Gly Ala Ser Pro Glu Ser Ser Leu Lys Tyr Asp Ala Thr Ser Arg Gln

305 310 315 320

Ile Glu Ile Tyr Pro Ile Ala Gly Thr Arg Pro Arg Gly Arg Arg Ala

325 330 335

Asp Gly Ser Leu Asp Arg Asp Leu Asp Ser Arg Ile Glu Leu Glu Met

340 345 350

Arg Thr Asp His Lys Glu Leu Ser Glu His Leu Met Leu Val Asp Leu

355 360 365

Ala Arg Asn Asp Leu Ala Arg Ile Cys Thr Pro Gly Ser Arg Tyr Val

370 375 380

Ala Asp Leu Thr Lys Val Asp Arg Tyr Ser Tyr Val Met His Leu Val

385 390 395 400

Ser Arg Val Val Gly Glu Leu Arg His Asp Leu Asp Ala Leu His Ala

405 410 415

Tyr Arg Ala Cys Met Asn Met Gly Thr Leu Ser Gly Ala Pro Lys Val

420 425 430

Arg Ala Met Gln Leu Ile Ala Glu Ala Glu Gly Arg Arg Arg Gly Ser

435 440 445

Tyr Gly Gly Ala Val Gly Tyr Phe Thr Ala His Gly Asp Leu Asp Thr

450 455 460

Cys Ile Val Ile Arg Ser Ala Leu Val Glu Asn Gly Ile Ala Thr Val

465 470 475 480

Gln Ala Gly Ala Gly Val Val Leu Asp Ser Val Pro Gln Ser Glu Ala

485 490 495

Asp Glu Thr Arg Asn Lys Ala Arg Ala Val Leu Arg Ala Ile Ala Thr

500 505 510

Ala His His Ala Gln Glu Thr Phe

515 520

<210> 2

<211> 1563

<212> DNA

<213> Escherichia coli

<400> 2

atgcaaacac aaaaaccgac tctcgaactg ctaacctgcg aaggcgctta tcgcgacaat 60

cccaccgcgc tttttcacca gttgtgtggg gatcgtccgg caacgctgct gctggaatcc 120

gcagatatcg acagcaaaga tgatttaaaa agcctgctgc tggtagacag tgcgctgcgc 180

attacagttt taggtgacac tgtcacaatc caggcacttt ccggcaacgg cgaagccctc 240

ctggcactac tggataacgc cctgcctgcg ggtgtggaaa gtgaacaatc accaaactgc 300

cgtgtgctgc gcttcccccc tgtcagtcca ctgctggatg aagacgcccg cttatgctcc 360

ctttcggttt ttgacgcttt ccgtttattg cagaatctgt tgaatgtacc gaaggaagaa 420

cgagaagcca tgttcttcgg cggcctgttc tcttatgacc ttgtggcggg atttgaagat 480

ttaccgcaac tgtcagcgga aaataactgc cctgatttct gtttttatct cgctgaaacg 540

ctgatggtga ttgaccatca gaaaaaaagc acccgtattc aggccagcct gtttgctccg 600

aatgaagaag aaaaacaacg tctcactgct cgcctgaacg aactacgtca gcaactgacc 660

gaagccgcgc cgccgctgcc agtggtttcc gtgccgcata tgcgttgtga atgtaatcag 720

agcgatgaag agttcggtgg cgtagtgcgt ttgttgcaaa aagcgattcg cgctggagaa 780

attttccagg tggtgccatc tcgccgtttc tctctgccct gcccgtcacc gctggcggcc 840

tattacgtgc tgaaaaagag taatcccagc ccgtacatgt tttttatgca ggataatgat 900

ttcaccctat ttggcgcgtc gccggaaagc tcgctcaagt atgatgccac cagccgccag 960

attgagatct acccgattgc cggaacacgc ccacgcggtc gtcgcgccga tggttcactg 1020

gacagagatc tcgacagccg tattgaactg gaaatgcgta ccgatcataa agagctgtct 1080

gaacatctga tgctggttga tctcgcccgt aatgatctgg cacgcatttg cacccccggc 1140

agccgctacg tcgccgatct caccaaagtt gaccgttatt cctatgtgat gcacctcgtc 1200

tctcgcgtag tcggcgaact gcgtcacgat cttgacgccc tgcacgctta tcgcgcctgt 1260

atgaatatgg ggacgttaag cggtgcgccg aaagtacgcg ctatgcagtt aattgccgag 1320

gcggaaggtc gtcgccgcgg cagctacggc ggcgcggtag gttatttcac cgcgcatggc 1380

gatctcgaca cctgcattgt gatccgctcg gcgctggtgg aaaacggtat cgccaccgtg 1440

caagcgggtg ctggtgtagt ccttgattct gttccgcagt cggaagccga cgaaacccgt 1500

aacaaagccc gcgctgtact gcgcgctatt gccaccgcgc atcatgcaca ggagactttc 1560

tga 1563

<210> 3

<211> 39

<212> DNA

<213> Artificial sequence ()

<400> 3

cgcatccgac aattaaacct tacccgcgac gcgctttta 39

<210> 4

<211> 39

<212> DNA

<213> Artificial sequence ()

<400> 4

tggcaacact ggaacagaca tgaattatca gaacgacga 39

<210> 5

<211> 39

<212> DNA

<213> Artificial sequence ()

<400> 5

cgtcgttctg ataattcatg tctgttccag tgttgccat 39

<210> 6

<211> 39

<212> DNA

<213> Artificial sequence ()

<400> 6

agcggcgacg cgcagttaat cccacagccg ccagttccg 39

<210> 7

<211> 39

<212> DNA

<213> Artificial sequence ()

<400> 7

ggaactggcg gctgtgggat taactgcgcg tcgccgctt 39

<210> 8

<211> 39

<212> DNA

<213> Artificial sequence ()

<400> 8

acaaaattag agaataacaa tgcaaacaca aaaaccgac 39

<210> 9

<211> 39

<212> DNA

<213> Artificial sequence ()

<400> 9

tcggtttttg tgtttgcatt gttattctct aattttgtt 39

<210> 10

<211> 39

<212> DNA

<213> Artificial sequence ()

<400> 10

aaaagcgcgt cgcgggtaag gtttaattgt cggatgcgc 39

<210> 11

<211> 37

<212> DNA

<213> Artificial sequence ()

<400> 11

gaatccatgg gcctgttgaa agcataaatt aaaaacg 37

<210> 12

<211> 48

<212> DNA

<213> Artificial sequence ()

<400> 12

ttaaacaaaa ttattgggga attgttatcc gctcacaatt ccacacat 48

<210> 13

<211> 89

<212> DNA

<213> Artificial sequence ()

<400> 13

attccccaat aattttgttt aactttaaga aggagatata catatgtcca acaatggctc 60

gtcaccgctc gtgctttggt ataaccaacp psupOgaatc catgggcctg ttgaaagcat 120

aaattaaaaa cgppsupOtt aaacaaaatt attggggaat tgttatccgc tcacaattcc 180

acacattata cgagccgatg attaattgtc aacgaacaat ccttttgtga tappsdownO 240

attccccaat aattttgttt aactttaaga aggagatata catatgtcca acaatggctc 300

gtcaccgctc gtgctttggt ataaccaacp psdownOtcc aagcttccat tcagaaggga 360

gtgtcgataa tccppsverO tcgacactcc cttctgaatg gaagcttgga ttctcppsve 420

rOaatttatg ctttcaacag gcccatggat tcttcppsOt agccaacaat ggctcgtcac 480

cgcgttttag agctagaaat agcppsOcgc ggtgacgagc cattgttggc taagatctga 540

ctccataa 548

<210> 14

<211> 36

<212> DNA

<213> Artificial sequence ()

<400> 14

tccaagcttc cattcagaag ggagtgtcga taatcc 36

<210> 15

<211> 35

<212> DNA

<213> Artificial sequence ()

<400> 15

tcgacactcc cttctgaatg gaagcttgga ttctc 35

<210> 16

<211> 33

<212> DNA

<213> Artificial sequence ()

<400> 16

aatttatgct ttcaacaggc ccatggattc ttc 33

<210> 17

<211> 44

<212> DNA

<213> Artificial sequence ()

<400> 17

tagccaacaa tggctcgtca ccgcgtttta gagctagaaa tagc 44

<210> 18

<211> 41

<212> DNA

<213> Artificial sequence ()

<400> 18

cgcggtgacg agccattgtt ggctaagatc tgactccata a 41

<210> 19

<211> 34

<212> DNA

<213> Artificial sequence ()

<400> 19

aatccatggg cctgtagcag cttataacgc cgga 34

<210> 20

<211> 35

<212> DNA

<213> Artificial sequence ()

<400> 20

atcaggccta caaaaaatat gtcgccattg ttagc 35

<210> 21

<211> 35

<212> DNA

<213> Artificial sequence ()

<400> 21

caatggcgac atattttttg taggcctgat aagac 35

<210> 22

<211> 34

<212> DNA

<213> Artificial sequence ()

<400> 22

ccaagcttcc attcatggtc ccgtgatgtc gcgt 34

<210> 23

<211> 35

<212> DNA

<213> Artificial sequence ()

<400> 23

acatcacggg accatgaatg gaagcttgga ttctc 35

<210> 24

<211> 34

<212> DNA

<213> Artificial sequence ()

<400> 24

gcgttataag ctgctacagg cccatggatt cttc 34

<210> 25

<211> 40

<212> DNA

<213> Artificial sequence ()

<400> 25

gccagatgag cgcgaagcgt gttttagagc tagaaatagc 40

<210> 26

<211> 40

<212> DNA

<213> Artificial sequence ()

<400> 26

acgcttcgcg ctcatctggc gctaagatct gactccataa 40

<210> 27

<211> 35

<212> DNA

<213> Artificial sequence ()

<400> 27

gctgcgcatt acagttttag gtgacactgt cacaa 35

<210> 28

<211> 35

<212> DNA

<213> Artificial sequence ()

<400> 28

cgccccagct catcaggtca gcgagatatt gtggg 35

<210> 29

<211> 35

<212> DNA

<213> Artificial sequence ()

<400> 29

ccacaatatc tcgctgacct gatgagctgg ggcgc 35

<210> 30

<211> 35

<212> DNA

<213> Artificial sequence ()

<400> 30

cagtgtcacc taaaactgta atgcgcagcg cactg 35

Claims

1. The application of the L-tryptophan-producing genetically engineered bacterium in the production of L-tryptophan is characterized in that the L-tryptophan-producing genetically engineered bacterium mutates a TrpE protein gene in a starting bacterium by a gene site-directed mutagenesis method to relieve the inhibition effect of the TrpE by L-tryptophan, wherein the mutation is to replace an A63 amino acid residue in the TrpE protein with V; the amino acid sequence coded by the TrpE protein gene in the starting bacterium is shown as SEQ ID NO. 1; wherein the starting bacterium is Escherichia coli.

2. The use according to claim 1, wherein the nucleotide sequence of the TrpE protein gene in the starting bacterium is shown in SEQ ID No. 2.

3. The use of claim 1, wherein AroG, TrpE and PpsA are also overexpressed in the genetically engineered bacteria by genetic engineering techniques and TrpR is knocked out.

4. The use according to any one of claims 1 to 3, wherein L-tryptophan is collected after fermentation of the genetically engineered bacteria.