CN116555153B - Construction method and application of Escherichia coli for producing L-valine - Google Patents

Construction method and application of Escherichia coli for producing L-valine Download PDF

Info

Publication number
CN116555153B
CN116555153B CN202310809274.4A CN202310809274A CN116555153B CN 116555153 B CN116555153 B CN 116555153B CN 202310809274 A CN202310809274 A CN 202310809274A CN 116555153 B CN116555153 B CN 116555153B
Authority
CN
China
Prior art keywords
gene
escherichia coli
coli
trpr
valine
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202310809274.4A
Other languages
Chinese (zh)
Other versions
CN116555153A (en
Inventor
孟刚
周晓群
魏爱英
赵春光
张晓琴
毕国东
杨立鹏
蔡卫卫
王攀
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Heilongjiang Yipin Biotechnology Co ltd
Original Assignee
Heilongjiang Yipin Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Heilongjiang Yipin Biotechnology Co ltd filed Critical Heilongjiang Yipin Biotechnology Co ltd
Priority to CN202310809274.4A priority Critical patent/CN116555153B/en
Publication of CN116555153A publication Critical patent/CN116555153A/en
Application granted granted Critical
Publication of CN116555153B publication Critical patent/CN116555153B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245—Escherichia (G)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/34—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1022—Transferases (2.) transferring aldehyde or ketonic groups (2.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1096—Transferases (2.) transferring nitrogenous groups (2.6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C12N9/1252—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01086—Ketol-acid reductoisomerase (1.1.1.86)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y202/00—Transferases transferring aldehyde or ketonic groups (2.2)
    • C12Y202/01—Transketolases and transaldolases (2.2.1)
    • C12Y202/01006—Acetolactate synthase (2.2.1.6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y206/00—Transferases transferring nitrogenous groups (2.6)
    • C12Y206/01—Transaminases (2.6.1)
    • C12Y206/01042—Branched-chain-amino-acid transaminase (2.6.1.42)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/07—Nucleotidyltransferases (2.7.7)
    • C12Y207/07007—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y402/00—Carbon-oxygen lyases (4.2)
    • C12Y402/01—Hydro-lyases (4.2.1)
    • C12Y402/01009—Dihydroxy-acid dehydratase (4.2.1.9), i.e. acetohydroxyacid dehydratase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/185—Escherichia
    • C12R2001/19—Escherichia coli
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention discloses a construction method and application of escherichia coli for producing L-valine. According to the invention, after the trpR gene in the escherichia coli is knocked out and ilvH is expressed, or the lacI gene and the lacZ gene are knocked out and the DNA polymerase is expressed, the ycgH gene is knocked out and ilvC is expressed, the obtained recombinant bacterium can improve the yield of L-valine, can be used for producing L-valine, and has good application prospect.

Description

Construction method and application of escherichia coli for producing L-valine
Technical Field
The invention relates to a construction method and application of escherichia coli for producing L-valine in the field of biotechnology.
Background
In microorganisms, L-valine (one of branched-chain amino acids) is biosynthesized from pyruvic acid via acetolactate, dihydroxyisovalerate and ketoisovalerate. These intermediate metabolites are produced by reactions catalyzed by acetohydroxy acid synthase, acetohydroxy acid reductase isomerase, dihydroxy acid dehydratase and transaminase B. However, these enzymes are also involved in the biosynthesis of L-isoleucine starting from butanoic acid and pyruvic acid, and L-leucine also starts from ketoisovalerate (an intermediate metabolite) via 2-isopropyl malate, 3-isopropyl malate and ketoisohexanoate. Thus, since branched-chain amino acids (i.e., L-valine, L-isoleucine and L-leucine) use the same enzymes for their biosynthesis processes, it is known that it is difficult to industrially produce one type of branched-chain amino acid by fermentation. Furthermore, there is a problem in that industrial mass production is limited by feedback inhibition caused by L-valine (which is an end product) or a derivative thereof.
Coli has a clear genetic background and is an attractive industrial production chassis in amino acid production. However, there are fewer reports about E.coli strains producing L-valine than C.glutamicum, probably due to the more complex regulatory mechanism of E.coli on L-valine biosynthesis. Acetylhydroxy acid synthase (AHAS) is the rate-limiting enzyme for L-valine biosynthesis, and there are three AHAS isozymes from E.coli, encoded by ilvBN, ilvGM and ilvIH, with different properties and regulatory mechanisms. Park et al reported that the final L-valine production yield of 60.7g/L was achieved by metabolizing the L-valine producing strain via the systems of Escherichia coli W3110 and Escherichia coli W with a sugar acid conversion rate of 0.22g/g. In addition to mutation breeding and conventional metabolic engineering modifications, cofactor balance is also considered as a key bottleneck for improving L-valine production. Since intracellular cofactors influence metabolic networks, signal transduction and substance transport, and thus influence the physiological functions of microbial cells. In the fermentative production of chemicals by microorganisms, the potency and yield of the chemical is often limited by cofactor imbalance, which is mainly caused by unbalanced expression of cofactor dependent enzymes in the synthetic pathway. Savraova and Stoynova et al constructed an L-valine engineering strain with E.coli MG1655 as the starting strain by replacing the natural NADPH-dependent transaminase with a heterologous NADH-dependent leucine dehydrogenase. Under microaerophilic conditions, the sugar acid conversion (0.23 g/g) of this strain was only 35.4% of the maximum theoretical yield of 0.65 g/g. The development of a high-throughput screening method of a biosensor, the introduction of an exogenous coenzyme regeneration path to balance intracellular cofactors and the construction of an efficient industrial chassis production strain are key scientific problems to be solved.
Disclosure of Invention
The technical problem to be solved by the invention is how to improve L-Valine production.
In order to solve the technical problems, the invention firstly provides engineering bacteria for producing L-valine, wherein the engineering bacteria are recombinant bacteria obtained by modifying recipient bacteria; the modification comprises A3);
a3 Including a 31) and a 32):
a31 Knocking out trpR gene of the receptor bacteria, inhibiting expression of the trpR gene or inhibiting activity of protein encoded by the trpR gene;
a32 Increasing ilvH in the recipient bacterium G14D 、S17F Content of Gene-encoded protein or enhancement of the ilvH G14D 、S17F Activity of the gene encoding the protein; the ilvH G14D 、S17F The gene is obtained by replacing the 14 th glycine codon with an aspartic acid codon and the 17 th serine codon with a phenylalanine codon in the ilvH gene.
Wherein the recipient bacterium contains trpR gene (GeneID: 948917, date of update 2023-04-14).
In the engineering bacteria, the strain is prepared from the strain,the ilvH gene can be derived from Escherichia coliEscherichia coli）。
In the engineering bacteria, the ilvH G14D 、S17F The gene can code protein shown in SEQ ID No.8 in a sequence table.
In the engineering bacteria, the ilvH G14D 、S17F The gene may be a DNA molecule shown in the 835-1326 th position of SEQ ID No.7 of the sequence Listing.
The ilvH G14D 、S17F Expression of the Gene enables the initiation of the ilvH in the engineering bacterium G14D 、S17F Promoters for gene expression include, but are not limited to, strong promoters, constitutive promoters.
In another embodiment of the present invention, the ilvH G14D 、S17F The expression of the gene is promoted by the Ptrc promoter, which is a DNA molecule shown in positions 761-834 of SEQ ID No. 7.
Specifically, A3) can be realized by gene editing through a CRISPR/Cas9 system by using sgrnas targeting trpR genes and DNA fragments shown in SEQ ID No.7 as donors.
In the engineering bacteria, the receptor bacteria can be escherichia coli @, and the engineering bacteria can be the escherichia coli @Escherichia coli）。
In the engineering bacteria, the modification may further include A4) and/or A5):
a4 Including a 41), a 42), and a 43):
a41 Knocking out the lacI gene of the receptor bacteria, inhibiting the expression of the lacI gene or inhibiting the activity of the protein encoded by the lacI gene;
a42 Knocking out lacZ gene of the receptor bacteria, inhibiting expression of the lacZ gene or inhibiting activity of protein encoded by the lacZ gene;
a43 Increasing the amount of DNA polymerase in the recipient bacterium or enhancing the activity of the DNA polymerase;
a5 Including a 51) and a 52):
a51 Knocking out ycgH gene of the receptor bacteria, inhibiting expression of the ycgH gene or inhibiting activity of protein encoded by the ycgH gene;
A52 Increasing the content of or enhancing the activity of a protein encoded by the ilvC gene in the recipient bacterium.
Wherein the recipient bacterium further comprises a lacI gene (GeneID: 945007, update date 2023-04-14), a lacZ gene (GeneID: 945006, update date 2023-04-14) and a ycgH gene (GeneID: 2847703, update date 2023-04-14).
In the engineering bacteria, the DNA polymerase can be derived from escherichia coliEscherichia coli）；
The ilvC gene can be derived from Escherichia coliEscherichia coli）。
In the engineering bacteria, the DNA polymerase can be protein shown as SEQ ID No.10 in a sequence table;
the ilvC gene can code a protein shown as SEQ ID No.12 in a sequence table.
In the engineering bacteria, the coding gene of the DNA polymerase can be a DNA molecule shown in 701-3352 of SEQ ID No.9 in a sequence table;
the ilvC gene can be a DNA molecule shown in 794-2269 of SEQ ID No.11 in the sequence Listing.
The expression of the DNA polymerase encoding gene and the ilvC gene is promoted by a promoter capable of promoting the expression of the corresponding gene in the engineering bacteria, including but not limited to a strong promoter, a constitutive promoter.
In another embodiment of the present invention, the expression of the gene encoding the DNA polymerase is promoted by the PxylF promoter, which is the DNA molecule shown at positions 3353 to 3617 of SEQ ID No. 9.
In another embodiment of the present invention, the expression of the ilvC gene is promoted by Ptrc promoter, which is a DNA molecule shown at positions 2270 to 2343 of SEQ ID No. 11.
Specifically, A4) can be achieved by gene editing via CRISPR/Cas9 system using sgrnas targeting the lacI and lacZ genes with the DNA fragment shown in SEQ ID No.9 as donor.
A5 By CRISPR/Cas9 system, using sgrnas targeting the ycgH gene with the DNA fragment shown in SEQ ID No.11 as donor.
In the engineering bacteria, the receptor bacteria can be escherichia coli @, and the engineering bacteria can be the escherichia coli @Escherichia coli）。
The recipient bacteria of the invention include, but are not limited to, escherichia coliEscherichia coli) Any bacterium which contains trpR gene, lacI and lacZ gene, ycgH gene and can synthesize L-valine can be used to prepare recombinant bacterium and produce L-lysine by the method of the present invention, and the bacterium can be Escherichia coli @Escherichia coli) Corynebacterium glutamicumCorynebacterium glutamicum) Brevibacterium lactofermentum, corynebacterium beijing (Corynebacterium pekinense), brevibacterium ammoniagenes, corynebacterium crenatum, pantoea (Pantoea), pantoea ananatis (Pantoea ananatis), brevibacterium (Bacillus brevis), brevibacterium lactobacilli or Brevibacterium flavum. The yeast may be Saccharomyces cerevisiae or Pichia pastoris.
In one embodiment of the invention, the escherichia coli isEscherichia coli) Is Escherichia coliEscherichia coli) YP045 or Escherichia coliEscherichia coli）W3110。
In one embodiment of the present invention, the recombinant bacteria obtained are recombinant bacteria CGMCC22721-trpR and W3110-trpR, wherein the recombinant bacteria CGMCC22721-trpR and W3110-trpR are obtained by knocking out partial coding regions of trpR genes on the genomes of the L-valine producing bacteria CGMCC22721 and the wild type escherichia coli W3110, and simultaneously inserting mutated ilvH started by Ptrc promoter G14D 、S17F Genes, recombinant bacteria obtained by keeping other nucleotides in their genome unchanged.
In another embodiment of the present invention, the recombinant bacteria obtained are recombinant bacteria CGMCC22721-trpR-lacIZ and W3110-trpR-lacIZ, wherein the recombinant bacteria CGMCC22721-trpR-lacIZ and W3110-trpR-lacIZ are obtained by knocking out the coding region of trpR gene part on the genome of L-valine producing bacteria CGMCC22721 and wild E.coli W3110, respectively, and inserting the mutated ilvH initiated by Ptrc promoter G14D 、S17F A gene; at the same time, the coding region of part of lacI-lacZ gene was knocked out, and the DNA polymerase gene (from the large intestine) promoted by PxylF promoter was insertedBacillus [(s) ]Escherichia coli) BL 21), and the other nucleotides in the genome are maintained unchanged.
In another embodiment of the invention, the recombinant bacterium obtained is recombinant bacterium CGMCC22721-TrpR-lacIZ-ycgH and W3110-trpR-lacIZ-ycgH were obtained by knocking out the coding region of the trpR gene part on the genome of L-valine-producing bacterium CGMCC22721 and wild-type E.coli W3110, respectively, and inserting a Ptrc promoter-initiated mutant ilvH G14D 、S17F A gene; the coding region of part of lacI-lacZ gene was knocked out, and DNA polymerase gene (from Escherichia coli @ was inserted into the geneEscherichia coli) BL 21); meanwhile, partial coding region of ycgH gene is knocked out, ilvC gene (from colibacillus @ is inserted into the gene to be started by Ptrc promoterEscherichia coli) W3110) and maintaining the other nucleotides in the genome unchanged.
The present invention also provides a method for producing an engineering bacterium for producing L-valine, the method comprising: and (3) modifying the receptor bacteria to obtain the target engineering bacteria.
The above method may further comprise engineering the recipient bacterium with A4) and/or A5) as described above.
In the method, the recipient bacterium can be escherichia coli @, and the recipient bacterium can be escherichia coli @Escherichia coli）。
The invention also provides L-A process for the preparation of valine, the process comprising: culturing the engineering bacteria to obtain the L-valine.
In the method, the engineering bacteria can be cultured by adopting a culture medium capable of enabling the engineering bacteria to grow;
and/or culturing the recombinant engineering bacteria by adopting conditions capable of enabling the engineering bacteria to grow.
The invention also provides a product for producing L-valine, which is P3) or a product consisting of any one or any two of P3) and P4) -P5):
p3) is a substance that implements a 31) and a 32) separately or simultaneously:
a31 Knocking out trpR gene of receptor bacteria or inhibiting expression of the trpR gene or inhibiting activity of protein encoded by the trpR gene;
a32 Increasing ilvH in recipient bacteria G14D 、S17F Content of Gene-encoded protein or enhancement of the ilvH G14D 、S17F Activity of the gene encoding the protein;
p4) is a substance that implements a 41), a 42) and a 43), respectively or simultaneously:
a41 Knocking out the lacI gene of the recipient bacterium or inhibiting the expression of the lacI gene or inhibiting the activity of a protein encoded by the lacI gene;
a42 Knocking out lacZ gene of recipient bacterium or inhibiting expression of the lacZ gene or inhibiting activity of protein encoded by the lacZ gene;
a43 Increasing the content of or enhancing the activity of a DNA polymerase in a recipient bacterium;
P5) is a substance that achieves a 51) and a 52) separately or simultaneously:
a51 Knocking out the ycgH gene of the recipient bacterium or inhibiting the expression of the ycgH gene or inhibiting the activity of a protein encoded by the ycgH gene;
a52 Increasing the content of or enhancing the activity of a protein encoded by the ilvC gene in a recipient bacterium.
The application of the engineering bacteria or the product in the production of L-valine or the application in the preparation of the product for producing L-valine also belongs to the protection scope of the invention.
The engineering bacteria, the preparation method and the related products thereof can be used for producing various products, including but not limited to L-valine in the embodiment, and the produced products can also be glutamic acid, threonine, tryptophan, arginine, lysine, glycine, alanine, leucine, isoleucine, methionine, proline, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, aspartic acid, histidine, shikimic acid, protocatechuic acid, succinic acid, alpha ketoglutaric acid, citric acid, ornithine, citrulline and the like.
Experiments prove that the engineering bacteria modified by the invention can improve the yield of L-valine, can be used for producing L-valine, and has good application prospect.
The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.
Preservation description:
classification naming: escherichia coli @Escherichia coli）。
Strain number: YP045.
Preservation unit name: china general microbiological culture Collection center (China Committee for culture Collection).
The preservation unit is abbreviated as: CGMCC.
Deposit unit address: beijing, chaoyang, north Chen West Lu 1, 3, postal code: 100101.
preservation date: 2021, 06, 15.
Accession numbers of the preservation center: CGMCC No.22721.
Drawings
FIG. 1, fermentation medium formulation (balance water).
FIG. 2, fermentation control process.
FIG. 3, L-valine yield and significance analysis.
Detailed Description
The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents, instruments and the like used in the examples described below are commercially available unless otherwise specified. The quantitative tests in the following examples were all set up in triplicate and the results averaged. In the following examples, unless otherwise specified, the 1 st position of each nucleotide sequence in the sequence listing is the 5 'terminal nucleotide of the corresponding DNA/RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA/RNA.
The following implementationIn the example, the L-valine producing strain CGMCC22721 is Escherichia coliEscherichia coli) YP045, the strain is preserved in China general microbiological culture Collection center (CGMCC) with the preservation number of CGMCC No.22721 in 2021, 06 and 15.
Example 1 engineering strains were constructed which lack the yjiT gene on the genome while overexpressing the brnF-brnE gene.
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, knock out L using CRISPR/Cas9 gene editing technique-The yjiT gene in the valine-producing bacterium CGMCC22721 and the wild E.coli W3110 gene (it was confirmed by sequencing that the complete yjiT gene remained on the chromosome of these strains (GeneID: 945056, date of update 2023-04-14)), and the brnF-brnE gene (branched chain amino acid exporter, branched-chain amino acid export protein) initiated by Ptrc promoter was inserted simultaneously, derived from Corynebacterium glutamicum @Corynebacterium glutamicum) ATCC13032, by which the influence of these genes on the synthesis of L-valine was studied more intensively.
1. Construction of sgRNA
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, using CRISPR RGEN Tools (http:// www.rgenome.net/cas-designer /) to design a sgRNA target sequence, after selecting a suitable sgRNA target sequence, linearization pGRB cloning vector homology arm sequences are added at the 5 'and 3' extremities of the target sequence to form the complete sgRNA plasmid by recombination.
The sgRNA fragment is amplified without a template, and only the PCR annealing process is needed, and the system and the program are as follows: PCR reaction system: 10 mu L of sgRNA-1F and 10 mu L of sgRNA-1R; PCR reaction procedure: denaturation at 95℃for 5min and annealing at 50℃for 1min. After annealing, the sgRNA target DNA fragment was recovered using a DNA purification kit, its DNA concentration was determined, and the concentration was diluted to 100 ng/. Mu.L.
pGRB plasmid utilizationSpeI cleavage was followed by dephosphorylation, and recombination of sgRNA and dephosphorylated linearized plasmid was performed using Gibson Assembly kit (New England Co.). Recombination system: NEB assembled enzyme 2.5. Mu.L, dephosphorylation2. Mu.L of linearized plasmid and 0.5. Mu.L of sgRNA target DNA fragment. After 30min of assembly at 50 ℃, DH5 alpha competent cells are transformed from the product, plasmids are extracted, and sequencing primers sgRNA-PF/sgRNA-PR are used for sequencing and identification. The plasmid with correct sequencing was designated pGRB-sgRNA-1.
The primers used in this experiment were as follows (synthesized by Shanghai Invitrogen) with underlined nucleotides as pGRB cloning vector homology arm sequence and bolded nucleotides as sgRNA sequence:
sgRNA-1F:5'-TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTGTACGCGTTGCCAATTCTATGT TTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3'，
sgRNA-1R:5'-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACATAGAATTGGCAACGCGTACAC TAGTATTATACCTAGGACTGAGCTAGCTGTCA-3'，
sgRNA-PF: 5'-GTCTCATGAGCGGATACATATTTG-3'，
sgRNA-PR: 5'-GCGTCAGGTGCATAAACAGA-3'。
2. PCR amplification of homologous recombination fragments
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, designing and synthesizing a primer for knocking out yjiT gene while inserting a primer for Ptrc-brnF-brnE gene sequence, knocking out yjiT gene in L-valine-producing bacterium CGMCC22721 and wild E.coli W3110 gene in CRISPR/Cas9 gene editing mode while inserting brnF-brnE gene (from Corynebacterium glutamicum Corynebacterium glutamicum）ATCC13032）。
Primers were as follows (synthesized by the company epivitrogen):
P1:5'-GAGTGATGAGCGGTTGAAG-3'，
P2:5'-CTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAAAAAACAGGCAGCAAAGTCC-3'，
P3:5'-CGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCGTGCAAAAAACGCAAGAG-3'，
P4: 5'-CTTCACAGGTAGTGCTTTTAGTTAGAAAAGATTCACCAGTCCAAC-3'，
P5: 5'-GTGAATCTTTTCTAACTAAAAGCACTACCTGTGAAGG-3'，
P6: 5'-CTGCGGCAATAATCAACG-3'。
PCR amplification was performed using E.coli W3110 genomic DNA as a template and primers P1/P2, P5/P6 and KAPA HiFi HotStart (KK 2601, shanghai Hua ya Chuang Biotechnology Co., ltd.) to obtain upper and 684bp and lower homology arm fragments of 801bp in size, respectively; PCR amplification was performed using Corynebacterium glutamicum ATCC13032 genomic DNA as a template and primers P3/P4 and KAPA HiFi HotStart to obtain a Ptrc-brnF-brnE gene fragment of 1153bp in size. After the PCR reaction is finished, agarose gel electrophoresis recovery is respectively carried out by adopting a column type DNA gel recovery kit. The recovered DNA was subjected to overlap PCR with primers P1/P6 to obtain a homologous recombinant DNA fragment DeltayjiT-Ptrc-brnF-brnE (SEQ ID No. 1) having a size of 2579 and bp.
In SEQ ID No.1, positions 758-831 show Ptrc promoter, positions 832-1910 show brnF-brnE gene, and the brnF protein shown in SEQ ID No.2 (the coding sequence is the 832-1587 of SEQ ID No. 1) and the brnE protein shown in SEQ ID No.3 (the coding sequence is the 1584-1910 of SEQ ID No. 1) are encoded.
3. Competent preparation and transformation
Extracting pREDCas9 plasmid (containing spectinomycin resistance gene), respectively transforming into L-valine producing bacterium CGMCC22721 and escherichia coli W3110 competent cells, coating onto a 2-YT agar plate containing spectinomycin (100 mg/L), culturing at 32 ℃, selecting a single colony resisting the spectinomycin (100 mg/L), and carrying out PCR identification by using a primer pRedCas9-PF/pRedCas9-PR to obtain 943bp CGMCC22721-Cas9 and W3110-Cas9 transformants containing the pREDCas9 plasmid.
Primers were as follows (synthesized by the company epivitrogen):
pRedCas9-PF: 5'-GCAGTGGCGGTTTTCATG-3'；
pRedCas9-PR:5'-CCTTGGTGATCTCGCCTTTC-3'。
CGMCC22721-Cas9 and W3110-Cas9 competent cells were prepared. When the bacterial cells grow to OD 600 =0.1 IPTG was added at a final concentration of 0.1mM to induce λ -Red mediated homologous recombination. When OD is 600 When=0.4, the bacterial preparation competent cells were collected and transformed with pGRB-sgRNA-1 plasmid and homologous weight, respectivelyThe group DNA fragment DeltayjiT-Ptrc-brnF-brnE was spread on 2-YT agar plates containing spectinomycin (100 mg/L) and ampicillin (100 mg/L) and incubated at 32℃for 12 h. After single colony generated by culture is passaged, PCR identification is carried out through a primer P7/P8, and the PCR amplification is carried out to obtain a positive transformant with 1720bp fragment.
Primers were as follows (synthesized by the company epivitrogen):
P7: 5'-GCTGTATTCCTTATGTGGACC-3'，
P8: 5'-GCAGGAATCCAAAGTCAGC-3'。
the positive transformants were inoculated into 2-YT medium containing spectinomycin (100 mg/L) and final concentration to 0.2% arabinose to eliminate plasmid pGRB-sgRNA-1, colonies which grew on spectinomycin (100 mg/L) but did not grow on ampicillin (100 mg/L) were selected, these colonies were transferred to 2-YT medium for 42℃cultivation to eliminate pREDCas9 plasmid, colonies which did not grow on spectinomycin (100 mg/L) but grew on nonreactive 2-YT were selected, PCR identification was performed again by primer P1/P6, and the fragments of 2579bp (SEQ ID No. 1) were amplified as positive colonies, which were sequenced and the strains with correct sequencing results were designated CGMCC 721-yjiT and W3110-yjiT, respectively;
Recombinant bacterium CGMCC22721-yjiT and W3110-yjiT both lack yjiT gene, and simultaneously overexpress brnF-brnE gene (from Corynebacterium glutamicum @ started by Ptrc promoterCorynebacterium glutamicum) ATCC 13032); specifically, the recombinant strain CGMCC22721-yjiT and W3110-yjiT are obtained by knocking out partial coding regions of yjiT genes on the genomes of the L-valine producing strain CGMCC22721 and the wild escherichia coli W3110, and inserting brnF-brnE genes (from corynebacterium glutamicum @ started by Ptrc promoterCorynebacterium glutamicum) ATCC 13032), a recombinant bacterium obtained by keeping other nucleotides in its genome unchanged.
Example 2 construction of a deletion of the yjiV Gene on the genome while overexpressing ilvE-Engineering strain of ilvD gene.
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, knock out L using CRISPR/Cas9 gene editing technique-ValinThe yjiV genes in the acid-producing bacterium CGMCC22721 and the wild-type E.coli W3110 gene (it was confirmed by sequencing that the complete yjiV gene was maintained on the chromosome of these strains (GeneID: 2847669, date of renewal 2023-04-14), while inserting the ilvE gene (branched-chain amino-acid aminotransferase, branched-chain amino acid aminotransferase from Bacillus subtilis) initiated by Ptrc promoter Bacillus subtilis subsp. subtilis str. 168) And ilvD gene (dihydroxyacid dehydratase, dihydroxyacid dehydratase from Escherichia coli @ promoted by the PicvD promoterEscherichia coli) W3110), the influence of these genes on the synthesis of L-valine was studied more intensively.
1. Construction of sgRNA
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, using CRISPR RGEN Tools (http:// www.rgenome.net/cas-designer /) to design a sgRNA target sequence, after selecting a suitable sgRNA target sequence, linearization pGRB cloning vector homology arm sequences are added at the 5 'and 3' extremities of the target sequence to form the complete sgRNA plasmid by recombination.
The sgRNA fragment is amplified without a template, and only the PCR annealing process is needed, and the system and the program are as follows: PCR reaction system: sgRNA-2F 10. Mu.L, sgRNA-2R 10. Mu.L; PCR reaction procedure: denaturation at 95℃for 5min and annealing at 50℃for 1min. After annealing, the sgRNA target DNA fragment was recovered using a DNA purification kit, its DNA concentration was determined, and the concentration was diluted to 100 ng/. Mu.L.
pGRB plasmid utilizationSpeI cleavage was followed by dephosphorylation, and recombination of sgRNA and dephosphorylated linearized plasmid was performed using Gibson Assembly kit (New England Co.). Recombination system: NEB assembly enzyme 2.5. Mu.L, linearized plasmid after dephosphorylation 2. Mu.L, sgRNA target DNA fragment 0.5. Mu.L. After 30min of assembly at 50 ℃, DH5 alpha competent cells are transformed from the product, plasmids are extracted, and sequencing primers sgRNA-PF/sgRNA-PR are used for sequencing and identification. The plasmid with correct sequencing was designated pGRB-sgRNA-2.
The primers used in this experiment were as follows (synthesized by Shanghai Invitrogen) with underlined nucleotides as pGRB cloning vector homology arm sequence and bolded nucleotides as sgRNA sequence:
sgRNA-2F:5'-TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTCTATTGATATTATCAATACAGT TTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3'，
sgRNA-2R:5'-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACTGTATTGATAATATCAATAGAC TAGTATTATACCTAGGACTGAGCTAGCTGTCA-3'。
2. PCR amplification of homologous recombination fragments
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, designing and synthesizing primers for knocking out yjiV gene while inserting primers for Ptrc-ilvE gene and pilvD-ilvD gene, knocking out yjiV gene in L-valine-producing bacterium CGMCC22721 and wild type E.coli W3110 gene in CRISPR/Cas9 gene editing mode while inserting ilvE gene (from Bacillus subtilis)Bacillus subtilis subsp. subtilis str. 168) And ilvD gene (from E.coli @ promoted by the pilvD promoterEscherichia coli）W3110）。
Primers were as follows (synthesized by the company epivitrogen):
P9: 5'-TGAATGGACTGCTATGCG-3'，
P10: 5'-CACAGTGTATTAAGCAGACGTTAACAACGCAGTACTTCCTGCTG-3'，
P11: 5'-GAAGTACTGCGTTGTTAACGTCTGCTTAATACACTGTG-3'，
P12:5'-GTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGGAACTTTTTAAATATATGGAG-3'，
P13:5'-CTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAATTAACCCCCCAGTTTCGATTTAT-3'，
P14: 5'-CCACCAGCACATCCGTTGAAATACAAAAAATGGGAC-3'，
P15: 5'-TCCCATTTTTTGTATTTCAACGGATGTGCTGGTGG-3'，
P16: 5'-TGAAGACACGCTGGCTAAC-3'。
PCR amplification was performed using E.coli W3110 genomic DNA as a template and primers P9/P10, P13/P14, P15/P16 and KAPA HiFi HotStart to obtain upper homology arm of 831bp, pilvD-ilvD gene of 1979bp and homonucleotide sequence of 856bp, respectivelyA source arm segment; by bacillus subtilisBacillus subtilis subsp. subtilis str. 168PCR amplification is carried out by taking genomic DNA as a template and using primers P11/P12 and KAPA HiFi HotStart to obtain Ptrc with 1161bp-ilvE gene. After the PCR reaction is finished, agarose gel electrophoresis recovery is respectively carried out by adopting a column type DNA gel recovery kit. The recovered DNA was subjected to overlap PCR with primers P9/P16 to obtain a homologous recombinant DNA fragment DeltayjiV-Ptrc -ilvE-PilvD-ilvD (SEQ ID No. 4) size 4732 bp.
In SEQ ID No.4, the positions 3828 to 3893 show the pilvD promoter, the positions 1977 to 3827 show the ilvD gene, and the ilvD protein shown in SEQ ID No.5 is encoded; the Ptrc promoter is shown at positions 1903-1976, the ilvE gene is shown at positions 808-1902, and the ilvE protein shown in SEQ ID No.6 is encoded.
3. Competent preparation and transformation
Competent cells were prepared from CGMCC22721-Cas9 and W3110-Cas9 of example 1. When the bacterial cells grow to OD 600 =0.1 IPTG was added at a final concentration of 0.1mM to induce λ -Red mediated homologous recombination. When OD is 600 When=0.4, cells were collected to prepare competent cells, and pGRB-sgRNA-2 plasmid and homologous recombinant DNA fragment ΔyjiV-Ptrc were transformed, respectively-ilvE-PilvD-ilvD was spread on 2-YT agar plates containing spectinomycin (100 mg/L) and ampicillin (100 mg/L) and incubated at 32℃for 12 h. After single colony generated by culture is passaged, PCR identification is carried out through a primer P17/P18, and the PCR amplification is carried out to obtain a positive transformant with a fragment of 1543 bp.
Primers were as follows (synthesized by the company epivitrogen):
P17: 5'-AGCGAGTTTCCAATACCG-3'，
P18: 5'-ATTTCTCCTGCTTTCGGC-3'。
the positive transformants were inoculated into 2-YT medium containing spectinomycin (100 mg/L) and final concentration to 0.2% arabinose to eliminate plasmid pGRB-sgRNA-2, colonies which grew on spectinomycin (100 mg/L) but did not grow on ampicillin (100 mg/L) were selected, these colonies were transferred to 2-YT medium for 42℃cultivation to eliminate pREDCas9 plasmid, colonies which did not grow on spectinomycin (100 mg/L) but grew on nonreactive 2-YT were selected, PCR identification was performed again by primer P9/P16, positive colonies were sequenced, and strains with correct sequencing results were named CGMCC 721-yjiV and W3110-yjiV, respectively, and a fragment of 4732bp (SEQ ID No. 4) was amplified as positive colonies;
Recombinant bacterium CGMCC22721-yjiV and W3110-yjiV both lack yjiV gene, and simultaneously overexpress ilvE gene (from bacillus subtilis) started by Ptrc promoterBacillus subtilis subsp. subtilis str. 168) And ilvD gene (from E.coli @ promoted by the pilvD promoterEscherichia coli) W3110); specifically, recombinant bacteria CGMCC22721-yjiV1 and W3110-yjiV were obtained by knocking out yjiV gene coding regions on the genomes of L-valine-producing bacteria CGMCC22721 and wild E.coli W3110, respectively, and inserting ilvE gene (from Bacillus subtilis) started by Ptrc promoterBacillus subtilis subsp. subtilis str. 168) And ilvD gene (from E.coli @ promoted by the pilvD promoterEscherichia coli) W3110) and maintaining the other nucleotides in the genome unchanged.
Example 3 construction of an engineering strain with deletion of trpR Gene on genome while overexpressing ilvH Gene.
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, knock out L using CRISPR/Cas9 gene editing technique-The trpR gene in the valine-producing strain CGMCC22721 and the wild E.coli W3110 gene (it was confirmed by sequencing that the complete trpR gene (DNA-binding transcriptional repressor, DNA-binding transcription repressor; geneID:948917, date of update 2023-04-14) remained on the chromosome of these strains), and ilvH was inserted at the same time as the Ptrc promoter was used G14D 、S17F Genes (acetolactate synthase ) to investigate the effect of these genes on the synthesis of L-valine.
1. Construction of sgRNA
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, using CRISPR RGEN Tools (http:// www.rgenome.net/cas-designator /) to design the sgRNA target sequence, after selection of the appropriate sgRNA target sequenceThe 5 'and 3' extreme ends of the target sequence were added with linearized pGRB cloning vector homology arm sequences to form the complete sgRNA plasmid by recombination.
The sgRNA fragment is amplified without a template, and only the PCR annealing process is needed, and the system and the program are as follows: PCR reaction system: 10 mu L of sgRNA-3F and 10 mu L of sgRNA-3R; PCR reaction procedure: denaturation at 95℃for 5min and annealing at 50℃for 1min. After annealing, the sgRNA target DNA fragment was recovered using a DNA purification kit, its DNA concentration was determined, and the concentration was diluted to 100 ng/. Mu.L.
pGRB plasmid utilizationSpeI cleavage was followed by dephosphorylation, and recombination of sgRNA and dephosphorylated linearized plasmid was performed using Gibson Assembly kit (New England Co.). Recombination system: NEB assembly enzyme 2.5. Mu.L, linearized plasmid after dephosphorylation 2. Mu.L, sgRNA target DNA fragment 0.5. Mu.L. After 30min of assembly at 50 ℃, DH5 alpha competent cells are transformed from the product, plasmids are extracted, and sequencing primers sgRNA-PF/sgRNA-PR are used for sequencing and identification. The plasmid with correct sequencing was designated pGRB-sgRNA-3.
The primers used in this experiment were as follows (synthesized by Shanghai Invitrogen) with underlined nucleotides as pGRB cloning vector homology arm sequence and bolded nucleotides as sgRNA sequence:
sgRNA-3F:5'-TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTCGTGAGTTAAAAAATGAACTGT TTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3'，
sgRNA-3R:5'-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACAGTTCATTTTTTAACTCACGAC TAGTATTATACCTAGGACTGAGCTAGCTGTCA-3'。
2. PCR amplification of homologous recombination fragments
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, design and Synthesis of primer for knocking out trpR Gene, and insertion of Ptrc-ilvH G14D 、S17F The primer of the gene sequence knocks out the trpR gene in the gene CGMCC22721 and the wild E.coli W3110 of the L-valine producing strain in the CRISPR/Cas9 gene editing mode, and simultaneously inserts the ilvH started by Ptrc promoter G14D 、S17F And (3) a gene.
Primers were as follows (synthesized by the company epivitrogen):
P19:5'-CCAATCTGGTGAAGAGCAAG-3'，
P20:5'-CTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAATGCTGAATAGGGTGATTGTTG-3'，
P21:5'-CAATTTCACACAGGAAACAGACCATGCGCCGGATATTATCAGTCTTACTCGAAAATGAATCAGACGCGTTATTCCGC-3'，
P22: 5'-GTCTTATCATGCCTACCAAATCAACGCATTATTTTATCG-3'，
P23: 5'-CGATAAAATAATGCGTTGATTTGGTAGGCATGATAAGAC-3'，
P24: 5'-GTGCGTCCTAAATCGCTAC-3'。
PCR amplification was performed using E.coli W3110 genomic DNA as a template and primers P19/P20, P21/P22, P23/P24 and KAPA HiFi HotStart to obtain upper homology arms of 831bp and 535bp Ptrc, respectively-ilvH G14D 、S17F Gene and 801bp and lower homology arm fragments; after the PCR reaction is finished, agarose gel electrophoresis recovery is respectively carried out by adopting a column type DNA gel recovery kit. The recovered DNA was subjected to overlap PCR with primers P19/P24 to obtain a homologous recombinant DNA fragment DeltatrpR-Ptrc-ilvH (SEQ ID No. 7) size 2108 bp.
In SEQ ID No.7, positions 761-834 are shown as Ptrc promoter and positions 835-1326 are shown as ilvH G14D 、S17F Gene encoding ilvH shown in SEQ ID No.8 G14D 、S17F And (3) protein.
3. Competent preparation and transformation
Competent cells were prepared from CGMCC22721-Cas9 and W3110-Cas9 of example 1. When the bacterial cells grow to OD 600 =0.1 IPTG was added at a final concentration of 0.1mM to induce λ -Red mediated homologous recombination. When OD is 600 When=0.4, cells were collected to prepare competent cells, and pGRB-sgRNA-3 plasmid and homologous recombinant DNA fragment ΔtrpR-Ptrc were transformed, respectively-ilvH was spread on 2-YT agar plates containing spectinomycin (100 mg/L) and ampicillin (100 mg/L) and incubated at 32℃for 12 h. After single colony generated by culture is passaged, PCR identification is carried out through a primer P25/P26, and the PCR amplification is carried out to obtain a positive transformant with a fragment of 1437 bp.
Primers were as follows (synthesized by the company epivitrogen):
P25: 5'-CATCGGCGAAGAGTATGAG-3'，
P26: 5'-AAAGTCCGACCACACCAGAG-3'。
the positive transformants were inoculated into 2-YT medium containing spectinomycin (100 mg/L) and final concentration to 0.2% arabinose to eliminate plasmid pGRB-sgRNA-3, colonies which grew on spectinomycin (100 mg/L) but did not grow on ampicillin (100 mg/L) were selected, these colonies were transferred to 2-YT medium for 42℃cultivation to eliminate pREDCas9 plasmid, colonies which did not grow on spectinomycin (100 mg/L) but grew on nonreactive 2-YT were selected, and PCR identification was performed again by primer P19/P24, and a fragment of 2108bp (SEQ ID No. 7) was amplified as a positive seed, which was sequenced and the strains with correct sequencing results were designated CGMCC 721-pR and W3110-trpR, respectively;
Recombinant bacteria CGMCC22721-trpR and W3110-trpR are deleted in trpR genes, and ilvH started by Ptrc promoter is overexpressed G14D 、S17F A gene; specifically, recombinant bacteria CGMCC22721-trpR and W3110-trpR are obtained by knocking out partial coding regions of trpR genes on the genomes of L-valine producing bacteria CGMCC22721 and wild escherichia coli W3110, and inserting mutant ilvH started by Ptrc promoter G14D 、S17F Genes, recombinant bacteria obtained by keeping other nucleotides in their genome unchanged.
Example 4 construction of an engineering strain with deletion of the lacI-lacZ Gene on the genome while overexpressing the DNA polymerase Gene.
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, knock out L using CRISPR/Cas9 gene editing technique-The lacI-lacZ gene in the valine-producing bacterium CGMCC22721 and the wild-type E.coli W3110 gene (it was confirmed by sequencing that the lacI-lacZ gene remained intact on the chromosome of these strains (DNA-binding transcriptional repressor, DNA binding transcription repressor; beta-D-galactosidase,. Beta. -D-galactosidase; lacI GeneID:945007, date of renewal 2023-04-14;lacZ GeneID:945006, date of renewal 2023-04-14), while inserting PxylF promoterThe DNA polymerase gene (from E.coli @ Escherichia coli) BL 21) to further investigate the effect of these genes on the synthesis of L-valine.
1. Construction of sgRNA
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, using CRISPR RGEN Tools (http:// www.rgenome.net/cas-designer /) to design a sgRNA target sequence, after selecting a suitable sgRNA target sequence, linearization pGRB cloning vector homology arm sequences are added at the 5 'and 3' extremities of the target sequence to form the complete sgRNA plasmid by recombination.
The sgRNA fragment is amplified without a template, and only the PCR annealing process is needed, and the system and the program are as follows: PCR reaction system: 10 mu L of sgRNA-4F and 10 mu L of sgRNA-4R; PCR reaction procedure: denaturation at 95℃for 5min and annealing at 50℃for 1min. After annealing, the sgRNA target DNA fragment was recovered using a DNA purification kit, its DNA concentration was determined, and the concentration was diluted to 100 ng/. Mu.L.
pGRB plasmid utilizationSpeI cleavage was followed by dephosphorylation, and recombination of sgRNA and dephosphorylated linearized plasmid was performed using Gibson Assembly kit (New England Co.). Recombination system: NEB assembly enzyme 2.5. Mu.L, linearized plasmid after dephosphorylation 2. Mu.L, sgRNA target DNA fragment 0.5. Mu.L. After 30min of assembly at 50 ℃, DH5 alpha competent cells are transformed from the product, plasmids are extracted, and sequencing primers sgRNA-PF/sgRNA-PR are used for sequencing and identification. The plasmid with correct sequencing was designated pGRB-sgRNA-4.
The primers used in this experiment were as follows (synthesized by Shanghai Invitrogen) with underlined nucleotides as pGRB cloning vector homology arm sequence and bolded nucleotides as sgRNA sequence:
sgRNA-4F:5'-TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTTCACTGCCCGCTTTCCAGTCGT TTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3'，
sgRNA-4R: 5'-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACGACTGGAAAG CGGGCAGTGAACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3'。
2. PCR amplification of homologous recombination fragments
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, design and synthesis of primers for knocking out lacI-lacZ gene sequence and primers for inserting PxylF-DNA polymerase gene sequence, knocking out lacI-lacZ gene in L-valine-producing bacterium CGMCC22721 and wild E.coli W3110 gene in CRISPR/Cas9 gene editing mode, simultaneously inserting DNA polymerase gene (from E.coli @ promoter-initiated DNA polymerase geneEscherichia coli） BL21）。
Primers were as follows (synthesized by the company epivitrogen):
P27:5'-CGGTAATAATCCACAGCAGG-3'，
P28: 5'-GACTTCGCGTTCGCGTAACAGGTAGCAGAGCGGGTA-3'，
P29: 5'-TACCCGCTCTGCTACCTGTTACGCGAACGCGAAGTC-3'，
P30: 5'-CTAACTACAGAAGGCCCTACACCATGAACACGATTAACATCGC-3'，
P31: 5'-GCGATGTTAATCGTGTTCATGGTGTAGGGCCTTCTGTAGTTAG-3'，
P32: 5'-CATTAAGTTCTGTCTCGGCGGAGATAATTCACAAGTGTGCG-3'，
P33: 5'-CGCACACTTGTGAATTATCTCCGCCGAGACAGAACTTAATG-3'，
P34: 5'-GGTTACGGACAGAACTACCG-3'。
performing PCR amplification by using the escherichia coli W3110 genome DNA as a template and using primers P27/P28, P31/P32, P33/P34 and KAPA HiFi HotStart to obtain an upper homology arm with 718bp, a PxylF promoter with 305bp and 928bp and a lower homology arm fragment with the sizes respectively; the DNA polymerase gene with the size of 2693bp is obtained by PCR amplification with the escherichia coli BL21 genome DNA as a template and the primers P29/P30 and KAPA HiFi HotStart. After the PCR reaction is finished, agarose gel electrophoresis recovery is respectively carried out by adopting a column type DNA gel recovery kit. The recovered DNA was subjected to overlap PCR with primers P27/P34 to obtain a homologous recombinant DNA fragment DeltalacIZ-PxylF-DNA polymerase (SEQ ID No. 9) having a size of 4524 bp.
In SEQ ID No.9, positions 3353 to 3617 show the PxylF promoter, positions 701 to 3352 show the DNA polymerase gene, and the DNA polymerase shown in SEQ ID No.10 is encoded.
3. Competent preparation and transformation
Competent cells were prepared from CGMCC22721-Cas9 and W3110-Cas9 of example 1. When the bacterial cells grow to OD 600 =0.1 IPTG was added at a final concentration of 0.1mM to induce λ -Red mediated homologous recombination. When OD is 600 At=0.4, cells were collected to prepare competent cells, and pGRB-sgRNA-4 plasmid and homologous recombinant DNA fragment ΔlacIZ-PxylF-DNA polymerase were transformed, respectively, and plated onto 2-YT agar plates containing spectinomycin (100 mg/L) and ampicillin (100 mg/L) and cultured at 32℃for 12 h. After single colony generated by culture is passaged, PCR identification is carried out through a primer P35/P36, and a fragment with the size of 1655bp is amplified by PCR to be a positive transformant.
Primers were as follows (synthesized by the company epivitrogen):
P35: 5'-TTCGCCCATTGTCGTTAC-3'，
P36: 5'-AGTTCCGCTTACAGCCTACC-3'。
the positive transformants were inoculated into 2-YT medium containing spectinomycin (100 mg/L) and final concentration to 0.2% arabinose to eliminate plasmid pGRB-sgRNA-4, colonies which grew on spectinomycin (100 mg/L) but did not grow on ampicillin (100 mg/L) were selected, these colonies were transferred to 2-YT medium for 42℃cultivation to eliminate pREDCas9 plasmid, colonies which did not grow on spectinomycin (100 mg/L) but grew on nonreactive 2-YT were selected, PCR identification was performed again by primer P27/P34, a fragment of 4524bp (SEQ ID No. 9) was amplified as a positive, the positive colonies were sequenced, and the strains with correct sequencing results were named CGMCC 721-IZ and W3110-lacIZ, respectively;
Recombinant bacterium CGMCC22721-lacIZ and W3110-lacIZ both lack lacI-lacZ gene, and simultaneously over-express DNA polymerase gene (from Escherichia coli @ started by PxylF promoterEscherichia coli) BL 21); specifically, the recombinant bacteria CGMCC22721-lacIZ and W3110-lacIZ are obtained by knocking out the coding region of lacI-lacZ gene on the genome of L-valine producing bacteria CGMCC22721 and wild E.coli W3110, respectively, and inserting DNA polymerase gene (from E.coli @ started by PxylF promoterEscherichia coli) BL 21), retains it in its genomeThe nucleotide of the recombinant bacterium is unchanged.
Example 5 construction of engineering strains with deletion of the ycgH gene on the genome while overexpressing the ilvC gene.
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, knock out L using CRISPR/Cas9 gene editing technique-The ycgH genes in the valine-producing strain CGMCC22721 and the wild E.coli W3110 genes (it was confirmed by sequencing that the complete ycgH genes remained on the chromosomes of these strains (GeneID: 2847703, date of update 2023-04-14)), and the ilvC gene (ketol-acid reductoisomerase, ketol-acid reductase isomerase from E.coli) initiated by Ptrc promoter was inserted at the same timeEscherichia coli) W3110), the influence of these genes on the synthesis of L-valine was studied more intensively.
1. Construction of sgRNA
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, using CRISPR RGEN Tools (http:// www.rgenome.net/cas-designer /) to design a sgRNA target sequence, after selecting a suitable sgRNA target sequence, linearization pGRB cloning vector homology arm sequences are added at the 5 'and 3' extremities of the target sequence to form the complete sgRNA plasmid by recombination.
The sgRNA fragment is amplified without a template, and only the PCR annealing process is needed, and the system and the program are as follows: PCR reaction system: sgRNA-5F 10. Mu.L, sgRNA-5R 10. Mu.L; PCR reaction procedure: denaturation at 95℃for 5min and annealing at 50℃for 1min. After annealing, the sgRNA target DNA fragment was recovered using a DNA purification kit, its DNA concentration was determined, and the concentration was diluted to 100 ng/. Mu.L.
pGRB plasmid utilizationSpeI cleavage was followed by dephosphorylation, and recombination of sgRNA and dephosphorylated linearized plasmid was performed using Gibson Assembly kit (New England Co.). Recombination system: NEB assembly enzyme 2.5. Mu.L, linearized plasmid after dephosphorylation 2. Mu.L, sgRNA target DNA fragment 0.5. Mu.L. After 30min of assembly at 50 ℃, DH5 alpha competent cells are transformed from the product, plasmids are extracted, and sequencing primers sgRNA-PF/sgRNA-PR are used for sequencing and identification. The plasmid with correct sequencing was designated pGRB-sgRNA-5.
The primers used in this experiment were as follows (synthesized by Shanghai Invitrogen) with underlined nucleotides as pGRB cloning vector homology arm sequence and bolded nucleotides as sgRNA sequence:
sgRNA-5F:5'-TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTCCCGTCCTGCGCCCCGAAGCGT TTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3'，
sgRNA-5R:5'-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACGCTTCGGGGCGCAGGACGGGAC TAGTATTATACCTAGGACTGAGCTAGCTGTCA-3'。
2. PCR amplification of homologous recombination fragments
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, design and synthesis of primer for knocking out ycgH gene, and insertion of primer for Ptrc-ilvC gene, knocking out ycgH gene in L-valine-producing bacterium CGMCC22721 and wild E.coli W3110 gene in CRISPR/Cas9 gene editing mode, simultaneously inserting ilvC gene started by Ptrc promoter (from E.coli [ ]Escherichia coli）W3110）。
Primers were as follows (synthesized by the company epivitrogen):
P37:5'-AAATGGAGGGATAACAGCC-3'，
P38: 5'-GCTGTTGCGGGTTAACGCTCCATTTAGAATAGAGTCGGACGAAAT-3'，
P39: 5'-CTAAATGGAGCGTTAACCCGCAACAGCAATAC-3'，
P40:5'-GCCATTTACGCCAAGTTTTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAG-3'，
P41:5'-CAGTGTATTGAAGTAGTTAGCCATGGTCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACATTATAC-3'，
P42: 5'-TTGCCTTCGGGCTTATCTC-3'。
PCR amplification was performed using E.coli W3110 genomic DNA as template and primers P37/P38, P39/P40, P41/P42 and KAPA HiFi HotStart to obtain Ptrc of size 808bp upper homology arm, 1580bp, respectively-ilvC gene and 944bp and lower homology arm fragment; after the PCR reaction is finished, agarose gel electrophoresis recovery is respectively carried out by adopting a column type DNA gel recovery kit. The recovered DNA was over-ridden with primers P37/P42The homologous recombination DNA fragment ΔycgH-Ptrc-ilvC (SEQ ID No. 11) was obtained by lap PCR, with a size of 3189 bp.
In SEQ ID No.11, the Ptrc promoter is shown at positions 2270 to 2343, the ilvC gene is shown at positions 794 to 2269, and the ilvC protein shown in SEQ ID No.12 is encoded.
4. Competent preparation and transformation
Competent cells were prepared from CGMCC22721-Cas9 and W3110-Cas9 of example 1. When the bacterial cells grow to OD 600 =0.1 IPTG was added at a final concentration of 0.1mM to induce λ -Red mediated homologous recombination. When OD is 600 At=0.4, cells were collected to prepare competent cells, and pGRB-sgRNA-5 plasmid and homologous recombinant DNA fragment Δycgh-Ptrc-ilvC were transformed, respectively, and plated onto 2-YT agar plates containing spectinomycin (100 mg/L) and ampicillin (100 mg/L) and cultured at 32℃for 12 h. After single colony generated by culture is passaged, PCR identification is carried out through a primer P43/P44, and positive transformant with 1669bp fragment is amplified by PCR.
Primers were as follows (synthesized by the company epivitrogen):
P43: 5'-AAGACCTCTGGAAGCGTATC-3'，
P44: 5'- CGTTGCGGAAGTGAAATC-3'。
the positive transformants were inoculated into 2-YT medium containing spectinomycin (100 mg/L) and final concentration to 0.2% arabinose to eliminate plasmid pGRB-sgRNA-5, colonies which grew on spectinomycin (100 mg/L) but did not grow on ampicillin (100 mg/L) were selected, these colonies were transferred to 2-YT medium for 42℃cultivation to eliminate pREDCas9 plasmid, colonies which did not grow on spectinomycin (100 mg/L) but grew on nonreactive 2-YT were selected, PCR identification was performed again by primer P37/P42, positive colonies which amplified fragments of 3189bp (SEQ ID No. 11) were positive, and the strains with correct sequencing results were designated CGMCC 721-ycgH and W3110-ycgH, respectively;
Recombinant bacterium CGMCC22721-ycgH and W3110-ycgH both lack ycgH gene, and simultaneously overexpress ilvC gene (from Escherichia coli @ started by Ptrc promoterEscherichia coli) W3110); specifically, the recombinant bacteria CGMCC22721-ycgH and W3110-ycgH are L-valiaThe coding region of ycgH gene part on the genome of amino acid producing strain CGMCC22721 and wild E.coli W3110 is knocked out, and simultaneously the ilvC gene started by Ptrc promoter is inserted (from E.coli [ ]Escherichia coli) W3110) and maintaining the other nucleotides in the genome unchanged.
EXAMPLE 6 construction of CGMCC22721-yjiT and deletion of yjiV Gene on W3110-yjiT Simultaneous overexpression of ilvE-Engineering strain of ilvD gene.
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, knock out L using CRISPR/Cas9 gene editing technique-The yjiV gene in the valine-producing bacterium CGMCC22721-yjiT and the wild-type E.coli W3110-yjiT gene (it was confirmed by sequencing that the complete yjiV gene was maintained on the chromosome of these strains), while inserting the ilvE gene (from Bacillus subtilis) initiated by Ptrc promoterBacillus subtilis subsp. subtilis str. 168) And ilvD gene (from E.coli @ promoted by the pilvD promoterEscherichia coli) W3110), the influence of these genes on the synthesis of L-valine was studied more intensively.
1. PCR amplification of homologous recombination fragments
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, primers for knocking out yjiV gene were designed and synthesized while inserting Ptrc-Primers of ilvE gene and pilvD-ilvD gene knock out L in CRISPR/Cas9 gene editing mode-Valine-producing bacterium CGMCC22721-yjiT and yjiV Gene in the genome of wild-type E.coli W3110-yjiT, together with the ilvE Gene (from Bacillus subtilis) which is promoted by Ptrc promoterBacillus subtilis) And ilvD gene promoted by the pilvD promoter.
Primers were as follows (synthesized by the company epivitrogen):
P45: 5'-AGTTCGCCCTTTGCTCTCTC-3'。
PCR amplification was performed using E.coli W3110-yjiT genomic DNA as a template and primers P45/P10, P13/P14, P15/P16 and KAPA HiFi HotStart to obtain an upper homology arm of 812bp, a pilvD-ilvD gene of 1979bp and a lower homology of 856bp, respectivelyAn arm segment; by bacillus subtilisBacillus subtilis subsp. subtilis str. 168PCR amplification is carried out by taking genomic DNA as a template and using primers P11/P12 and KAPA HiFi HotStart to obtain Ptrc with 1161bp-ilvE gene. After the PCR reaction is finished, agarose gel electrophoresis recovery is respectively carried out by adopting a column type DNA gel recovery kit. The recovered DNA was subjected to overlap PCR with primer P45/P16 to obtain a homologous recombinant DNA fragment DeltayjiV-Ptrc -ilvE-PilvD-ilvD-2 (SEQ ID No. 13) size 4713 bp.
In SEQ ID No.13, positions 3809-3874 show the pilvD promoter, positions 1958-3808 show the ilvD gene, encoding the ilvD protein shown in SEQ ID No. 5; the Ptrc promoter is shown at positions 1884-1957, the ilvE gene is shown at positions 789-1883, and the ilvE protein shown in SEQ ID No.6 is encoded.
2. Competent preparation and transformation
pREDCas9 plasmid (containing spectinomycin resistance gene) was extracted and transformed into CGMCC22721-yjiT and W3110-yjiT competent cells of example 1, spread on 2-YT agar plates containing spectinomycin (100 mg/L) for culture at 32℃and single colony resistant to spectinomycin (100 mg/L) was selected for PCR identification with primer pRedCas9-PF/pRedCas9-PR to obtain 943bp CGMCC22721-yjiT-Cas9 and W3110-yjiT-Cas9 transformants containing pREDCas9 plasmid, respectively.
CGMCC22721-yjiT-Cas9 and W3110-yjiT-Cas9 competent cells were prepared. When the bacterial cells grow to OD 600 =0.1 IPTG was added at a final concentration of 0.1mM to induce λ -Red mediated homologous recombination. When OD is 600 When=0.4, cells were collected to prepare competent cells, and pGRB-sgRNA-2 plasmid and homologous recombination DNA fragment ΔyjiV-Ptrc of example 2 were transformed, respectively -ilvE-PilvD-ilvD-2 was spread on 2-YT agar plates containing spectinomycin (100 mg/L) and ampicillin (100 mg/L) and incubated at 32℃for 12 h. After single colony generated by culture is passaged, PCR identification is carried out through a primer P46/P18, and the PCR amplification is carried out to obtain a fragment 1561bp positive transformant.
Primers were as follows (synthesized by the company epivitrogen):
P46: 5'-AGCGTTTCACTCCTACTGGG-3'。
positive transformants were inoculated into 2-YT medium containing spectinomycin (100 mg/L) and final concentration of arabinose to 0.2% to eliminate plasmid pGRB-sgRNA-2, colonies which grew on spectinomycin (100 mg/L) but did not grow on ampicillin (100 mg/L) were selected, these colonies were transferred to 2-YT medium for 42℃culture to eliminate pREDCas9 plasmid, colonies which did not grow on spectinomycin (100 mg/L) but grew on nonreactive 2-YT were selected, PCR identification was performed again by primer P45/P16, a fragment of 4713bp (SEQ ID No. 13) was identified as a positive, the positive colonies were sequenced, and the strains with correct sequencing results were designated CGMCC 721-yjiT, respectively-yjiV and W3110-yjiT-yjiV；
Recombinant bacterium CGMCC22721-yjiT-yjiV and W3110-yjiT-yjiV lacks yjiT gene, and the brnF-brnE gene (from Corynebacterium glutamicum @ is overexpressed by Ptrc promoter Corynebacterium glutamicum) ATCC 13032); deletion of yjiV Gene, overexpression of the ilvE Gene (from Bacillus subtilis) which is promoted by Ptrc promoterBacillus subtilis subsp. subtilis str. 168) And ilvD gene (from E.coli @ promoted by the pilvD promoterEscherichia coli) W3110); specifically, recombinant bacterium CGMCC22721-yjiT-yjiV and W3110-yjiT-yjiV is obtained by knocking out partial coding region of yjiT gene on genome of L-valine producing strain CGMCC22721 and wild E.coli W3110, inserting brnF-brnE gene (from Corynebacterium glutamicum @ with Ptrc promoterCorynebacterium glutamicum) ATCC 13032); at the same time, a partial coding region of the yjiV gene was knocked out, and the ilvE gene (from Bacillus subtilis) which was promoted by the Ptrc promoter was insertedBacillus subtilis subsp. subtilis str. 168) And ilvD gene (from E.coli @ promoted by the pilvD promoterEscherichia coli) W3110) and maintaining the other nucleotides in the genome unchanged.
EXAMPLE 7 construction of CGMCC22721-yjiT-yjiV and W3110-yjiT-An engineering strain deleted of trpR gene on yjiV and simultaneously overexpressing ilvH gene.
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, knock out L using CRISPR/Cas9 gene editing technique-Valine-producing bacterium CGMCC22721-yjiT-yjiV and wild E.coli W3110-yjiT-The trpR gene in the yjiV gene (it was confirmed by sequencing that the entire trpR gene was maintained on the chromosome of these strains) was inserted at the same time with the ilvH promoter of Ptrc promoter G14D 、S17F Genes, the influence of these genes on the synthesis of L-valine was studied more intensively.
Extraction of pREDCas9 plasmid (containing spectinomycin resistance gene) and transformation to CGMCC22721-yjiT of example 6, respectively-yjiV and W3110-yjiT-In yjiV competent cells, coating the cells on a 2-YT agar plate containing spectinomycin (100 mg/L) for culture at 32 ℃, selecting single colony resisting the spectinomycin (100 mg/L), and carrying out PCR identification by using a primer pRedCas9-PF/pRedCas9-PR to obtain 943bp CGMCC22721-yjiT containing pREDCas9 plasmid-yjiV-Cas9 and W3110-yjiT-yjiV-Cas9 transformants.
Preparation of CGMCC22721-yjiT-yjiV-Cas9 and W3110-yjiT-yjiV-Cas9 competent cells. When the bacterial cells grow to OD 600 =0.1 IPTG was added at a final concentration of 0.1mM to induce λ -Red mediated homologous recombination. When OD is 600 When=0.4, cells were collected to prepare competent cells, and pGRB-sgRNA-3 plasmid and homologous recombination DNA fragment ΔtrpR-Ptrc of example 3 were transformed, respectively-ilvH was spread on 2-YT agar plates containing spectinomycin (100 mg/L) and ampicillin (100 mg/L) and incubated at 32℃for 12 h. After single colony generated by culture is passaged, PCR identification is carried out through a primer P25/P26, and the PCR amplification is carried out to obtain a positive transformant with a fragment of 1437 bp.
Positive transformants were inoculated into 2-YT medium containing spectinomycin (100 mg/L) and final concentration of arabinose to 0.2% to eliminate plasmid pGRB-sgRNA-3, colonies which grew on spectinomycin (100 mg/L) but did not grow on ampicillin (100 mg/L) were selected, these colonies were transferred to 2-YT medium for 42℃culture to eliminate pREDCas9 plasmid, colonies which did not grow on spectinomycin (100 mg/L) but did not grow on nonreactive 2-YT were selected, and PCR identification was performed again by primer P19/P24, which amplified a fragment of 2108bp (SEQ ID No. 7) as positiveSex seed, sequencing the positive seed, and respectively naming the strains with correct sequencing result as CGMCC22721-yjiT-yjiV-trpR and W3110-yjiT-yjiV-trpR；
Recombinant bacterium CGMCC22721-yjiT-yjiV-trpR and W3110-yjiT-The yjiV-trpR was deleted for the yjiT gene while the brnF-brnE gene (from Corynebacterium glutamicum @ was overexpressed by the Ptrc promoterCorynebacterium glutamicum) ATCC 13032); deletion of yjiV Gene while overexpression of the ilvE Gene (from Bacillus subtilis) which is promoted by Ptrc promoterBacillus subtilis subsp. subtilis str. 168) And ilvD gene (from E.coli @ promoted by the pilvD promoterEscherichia coli) W3110); deletion of trpR Gene while overexpression of ilvH from Ptrc promoter G14D 、S17F And (3) a gene. Specifically, recombinant bacterium CGMCC22721-yjiT-yjiV-trpR and W3110-yjiT-yjiV-trpR is obtained by knocking out partial coding regions of yjiT gene on the genome of L-valine-producing bacterium CGMCC22721 and wild E.coli W3110, respectively, and inserting brnF-brnE gene (from Corynebacterium glutamicum @ with Ptrc promoterCorynebacterium glutamicum) ATCC 13032); the yjiV gene coding region was knocked out, and the ilvE gene (from Bacillus subtilis) which was promoted by Ptrc promoter was insertedBacillus subtilis subsp. subtilis str. 168) And ilvD gene (from E.coli @ promoted by the pilvD promoterEscherichia coli) W3110); at the same time, partial coding region of trpR gene is knocked out, and mutant ilvH started by Ptrc promoter is inserted G14D 、S17F Genes, recombinant bacteria obtained by keeping other nucleotides in their genome unchanged.
Example 8 construction of CGMCC22721-yjiT-yjiV-trpR and W3110-yjiT-An engineering strain deleted for the lacI-lacZ gene and simultaneously overexpressing the DNA polymerase gene on yjiV-trpR.
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, knock out L using CRISPR/Cas9 gene editing technique-Valine-producing bacterium CGMCC22721-yjiT-yjiV-trpR and wild E.coli W3110-yjiT-The lacI-lacZ gene in the yjiV-trpR gene (confirmed by sequencing The complete lacI-lacZ gene is remained on the chromosome of the strains, and the DNA polymerase gene (from Escherichia coli @ is inserted into the strainEscherichia coli) BL 21) to further investigate the effect of these genes on the synthesis of L-valine.
Extraction of pREDCas9 plasmid (containing spectinomycin resistance gene) and transformation to CGMCC22721-yjiT of example 7, respectively-yjiV-trpR and W3110-yjiT-In yjiV-trpR competent cells, coating the competent cells on a 2-YT agar plate containing spectinomycin (100 mg/L) for culture at 32 ℃, selecting a single colony of the spectinomycin (100 mg/L) and carrying out PCR identification by using a primer pRedCas9-PF/pRedCas9-PR to obtain 943bp CGMCC22721-yjiT containing pREDCas9 plasmid-yjiV-trpR-Cas9 and W3110-yjiT-yjiV-trpR-Cas9 transformants.
Preparation of CGMCC22721-yjiT-yjiV-trpR-Cas9 and W3110-yjiT-yjiV-trpR-Cas9 competent cells. When the bacterial cells grow to OD 600 =0.1 IPTG was added at a final concentration of 0.1mM to induce λ -Red mediated homologous recombination. When OD is 600 At=0.4, cells were collected to prepare competent cells, and pGRB-sgRNA-4 plasmid and homologous recombinant DNA fragment ΔlacIZ-PxylF-DNA polymerase of example 4 were transformed, respectively, and plated onto 2-YT agar plates containing spectinomycin (100 mg/L) and ampicillin (100 mg/L) and cultured at 32℃for 12 h. After single colony generated by culture is passaged, PCR identification is carried out through a primer P35/P36, and a fragment with the size of 1655bp is amplified by PCR to be a positive transformant.
Positive transformants were inoculated into 2-YT medium containing spectinomycin (100 mg/L) and final concentration of arabinose to 0.2% to eliminate plasmid pGRB-sgRNA-4, colonies which grew on spectinomycin (100 mg/L) but did not grow on ampicillin (100 mg/L) were selected, these colonies were transferred to 2-YT medium for 42℃culture to eliminate pREDCas9 plasmid, colonies which did not grow on spectinomycin (100 mg/L) but did not grow on nonreactive 2-YT were selected, PCR identification was performed again by primer P27/P34, a fragment of 4524bp (SEQ ID No. 9) was identified as a positive, the positive colonies were sequenced, and the strains with correct sequencing results were designated CGMCC 721-yjiT, respectively-yjiV-trpR-lacIZ and W3110-yjiT-yjiV-trpR-lacIZ；
Recombinant bacterium CGMCC22721-yjiT-yjiV-trpR-lacIZ and W3110-yjiT-The yjiV-trpR-lacIZ gene was deleted, and the brnF-brnE gene (derived from Corynebacterium glutamicum @ which was promoted by Ptrc promoter was overexpressedCorynebacterium glutamicum) ATCC 13032); deletion of yjiV Gene while overexpression of the ilvE Gene (from Bacillus subtilis) which is promoted by Ptrc promoterBacillus subtilis subsp. subtilis str. 168) And ilvD gene (from E.coli @ promoted by the pilvD promoterEscherichia coli) W3110); deletion of trpR Gene while overexpression of ilvH from Ptrc promoter G14D 、S17F A gene; deletion of lacI-lacZ Gene while over-expressing PxylF promoter-initiated DNA polymerase Gene (from Escherichia coli [. About.Escherichia coli) BL 21). Specifically, recombinant bacterium CGMCC22721-yjiT-yjiV-trpR-lacIZ and W3110-yjiT-The yjiV-trpR-lacIZ gene was obtained by knocking out the coding region of the yjiT gene in the genome of the bacterium CGMCC22721 and the wild E.coli W3110, respectively, and inserting the brnF-brnE gene (from Corynebacterium glutamicum @ with Ptrc promoter insertedCorynebacterium glutamicum) ATCC 13032); the yjiV gene coding region was knocked out, and the ilvE gene (from Bacillus subtilis) which was promoted by Ptrc promoter was insertedBacillus subtilis subsp. subtilis str. 168) And ilvD gene (from E.coli @ promoted by the pilvD promoterEscherichia coli) W3110); knocking out partial coding region of trpR gene, inserting Ptrc promoter-initiated mutant ilvH G14D 、S17F A gene; meanwhile, the partial coding region of the lacI-lacZ gene is knocked out, and a DNA polymerase gene (from Escherichia coli @ is inserted into the coding regionEscherichia coli) BL 21), and the other nucleotides in the genome are maintained unchanged.
Example 9 construction of CGMCC22721-yjiT-yjiV-trpR-lacIZ and W3110-yjiT-An engineering strain deleted for ycgH gene and simultaneously overexpressing ilvC gene on yjiV-trpR-lacIZ.
Coli according to NCBI publicationEscherichia coli) W3110 genomic sequence, using CRISPR/Cas9 gene editing technology knockout L-Valine-producing bacterium CGMCC22721-yjiT-yjiV-trpR-lacIZ and wild type E.coli W3110-yjiT-The ycgH gene in yjiV-trpR-lacIZ gene (it was confirmed by sequencing that the whole ycgH gene remained on the chromosome of these strains) was inserted together with the ilvC gene (from E.coli @Escherichia coli) W3110), the influence of these genes on the synthesis of L-valine was studied more intensively.
Extraction of pREDCas9 plasmid (containing spectinomycin resistance gene) and transformation to CGMCC22721-yjiT of example 8, respectively-yjiV-trpR-lacIZ and W3110-yjiT-Coating the cells on 2-YT agar plates containing spectinomycin (100 mg/L) in yjiV-trpR-lacIZ competent cells, culturing at 32 ℃, selecting a primer pRedCas9-PF/pRedCas9-PR for PCR identification for single colony of the spectinomycin (100 mg/L) to obtain 943bp CGMCC22721-yjiT containing pREDCas9 plasmid-yjiV-trpR-lacIZ-Cas9 and W3110-yjiT-yjiV-trpR-lacIZ-Cas9 transformants.
Preparation of CGMCC22721-yjiT-yjiV-trpR-lacIZ-Cas9 and W3110-yjiT-yjiV-trpR-lacIZ-Cas9 competent cells. When the bacterial cells grow to OD 600 =0.1 IPTG was added at a final concentration of 0.1mM to induce λ -Red mediated homologous recombination. When OD is 600 At=0.4, cells were collected to prepare competent cells, and pGRB-sgRNA-5 plasmid and homologous recombinant DNA fragment Δycgh-Ptrc-ilvC of example 5 were transformed, respectively, and plated onto 2-YT agar plates containing spectinomycin (100 mg/L) and ampicillin (100 mg/L) and cultured at 32℃for 12 h. After single colony generated by culture is passaged, PCR identification is carried out through a primer P43/P44, and positive transformant with 1669bp fragment is amplified by PCR.
Positive transformants were inoculated into 2-YT medium containing spectinomycin (100 mg/L) and final concentration to 0.2% arabinose to eliminate plasmid pGRB-sgRNA-5, colonies grown on spectinomycin (100 mg/L) but not on ampicillin (100 mg/L) were selected, these colonies were transferred to 2-YT medium for 42℃culture to eliminate pREDCas9 plasmid, colonies grown on spectinomycin (100 mg/L) but not on nonreactive 2-YT were selected, and colonies passing through primer P37 againThe PCR identification is carried out on/P42, the fragment with the size of 3189bp (SEQ ID No. 11) can be amplified to be a cation, the cation is sent to be sequenced, and the strains with the correct sequencing result are respectively named CGMCC22721-yjiT -yjiV-trpR-lacIZ-ycgH and W3110-yjiT-yjiV-trpR-lacIZ-ycgH；
Recombinant bacterium CGMCC22721-yjiT-yjiV-trpR-lacIZ-ycgH and W3110-yjiT-The yjiV-trpR-lacIZ-ycgH gene was deleted, while the brnF-brnE gene (derived from Corynebacterium glutamicum @ was overexpressed from the Ptrc promoterCorynebacterium glutamicum) ATCC 13032); deletion of yjiV Gene while overexpression of the ilvE Gene (from Bacillus subtilis) which is promoted by Ptrc promoterBacillus subtilis subsp. subtilis str. 168) And ilvD gene (from E.coli @ promoted by the pilvD promoterEscherichia coli) W3110); deletion of trpR Gene while overexpression of ilvH from Ptrc promoter G14D 、S17F A gene; deletion of lacI-lacZ Gene while over-expressing PxylF promoter-initiated DNA polymerase Gene (from Escherichia coli [. About.Escherichia coli) BL 21); deletion of the ycgH Gene while overexpression of the Ptrc promoter-initiated ilvC Gene (from E.coli [ ]Escherichia coli) W3110). Specifically, recombinant bacterium CGMCC22721-yjiT-yjiV-trpR-lacIZ-ycgH and W3110-yjiT-The yjiV-trpR-lacIZ-ycgH was obtained by knocking out the coding region of the yjiT gene in the genome of L-valine-producing bacterium CGMCC22721 and wild E.coli W3110, respectively, and inserting the Ptrc promoter-initiated brnF-brnE gene (from Corynebacterium glutamicum @Corynebacterium glutamicum) ATCC 13032); the yjiV gene coding region was knocked out, and the ilvE gene (from Bacillus subtilis) which was promoted by Ptrc promoter was inserted Bacillus subtilis subsp. subtilis str. 168) And ilvD gene (from E.coli @ promoted by the pilvD promoterEscherichia coli) W3110); knocking out partial coding region of trpR gene, inserting Ptrc promoter-initiated mutant ilvH G14D 、S17F A gene; the coding region of part of lacI-lacZ gene was knocked out, and DNA polymerase gene (from Escherichia coli @ was inserted into the geneEscherichia coli) BL 21); at the same time by the ycgH radicalThe ilvC gene (from E.coli.. Times.Escherichia coli) W3110) and maintaining the other nucleotides in the genome unchanged.
Example 10 construction of CGMCC22721-yjiV and W3110-An engineering strain deleted of trpR gene on yjiV and simultaneously overexpressing ilvH gene.
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, knock out L using CRISPR/Cas9 gene editing technique-Valine-producing bacterium CGMCC22721-yjiV and wild type E.coli W3110-The trpR gene in the yjiV gene (it was confirmed by sequencing that the entire trpR gene was maintained on the chromosome of these strains) was inserted at the same time with the ilvH promoter of Ptrc promoter G14D 、S17F Genes, the influence of these genes on the synthesis of L-valine was studied more intensively.
Extraction of pREDCas9 plasmid (containing spectinomycin resistance gene), transformation into CGMCC22721 of example 2, respectively -yjiV and W3110-In yjiV competent cells, coating the cells on a 2-YT agar plate containing spectinomycin (100 mg/L) for culture at 32 ℃, selecting single colony resisting the spectinomycin (100 mg/L), and carrying out PCR identification by using a primer pRedCas9-PF/pRedCas9-PR to obtain 943bp CGMCC22721 containing pREDCas9 plasmid-yjiV-Cas9 and W3110-yjiV-Cas9 transformants.
Preparation of CGMCC22721-yjiV-Cas9 and W3110-yjiV-Cas9 competent cells. When the bacterial cells grow to OD 600 =0.1 IPTG was added at a final concentration of 0.1mM to induce λ -Red mediated homologous recombination. When OD is 600 When=0.4, cells were collected to prepare competent cells, and pGRB-sgRNA-3 plasmid and homologous recombination DNA fragment ΔtrpR-Ptrc of example 3 were transformed, respectively-ilvH was spread on 2-YT agar plates containing spectinomycin (100 mg/L) and ampicillin (100 mg/L) and incubated at 32℃for 12 h. After single colony generated by culture is passaged, PCR identification is carried out through a primer P25/P26, and the PCR amplification is carried out to obtain a positive transformant with a fragment of 1437 bp.
The positive transformants were inoculated in a 2-YT medium containing spectinomycin (100 mg/L) and a final concentration of arabinose of 0.2% to eliminate plasmid pGRB-sgRNA-3, colonies which grew on spectinomycin (100 mg/L) but did not grow on ampicillin (100 mg/L) were selected, these colonies were then transferred to a 2-YT medium for 42℃cultivation to eliminate pREDCas9 plasmid, colonies which did not grow on spectinomycin (100 mg/L) but grew on nonreactive 2-YT were selected, and PCR identification was performed again by primer P19/P24, and a fragment of 2108bp (SEQ ID No. 7) was amplified as positive colonies, which were sequenced and the strains with correct sequencing results were designated CGMCC 721-yjiV-pR-and W3110-yjiV-tr, respectively;
Recombinant bacterium CGMCC22721-yjiV-trpR and W3110-yjiV-trpR were deleted for yjiV gene while the ilvE gene (from Bacillus subtilis) which was promoted by Ptrc promoter was overexpressedBacillus subtilis subsp. subtilis str. 168) And ilvD gene (from E.coli @ promoted by the pilvD promoterEscherichia coli) W3110); deletion of trpR Gene while overexpression of ilvH from Ptrc promoter G14D 、S17F And (3) a gene. In particular, recombinant bacterium CGMCC22721-yjiV-trpR and W3110-yjiV-trpR is obtained by knocking out the coding region of yjiV gene on the genome of L-valine-producing bacterium CGMCC22721 and wild E.coli W3110, respectively, and inserting ilvE gene (from Bacillus subtilis) which is started by Ptrc promoterBacillus subtilis subsp. subtilis str. 168) And ilvD gene (from E.coli @ promoted by the pilvD promoterEscherichia coli) W3110); at the same time, partial coding region of trpR gene is knocked out, and mutant ilvH started by Ptrc promoter is inserted G14D 、S17F Genes, recombinant bacteria obtained by keeping other nucleotides in their genome unchanged.
Example 11 construction of CGMCC22721-yjiV-trpR and W3110-An engineering strain deleted for the lacI-lacZ gene and simultaneously overexpressing the DNA polymerase gene on yjiV-trpR.
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, knock out L using CRISPR/Cas9 gene editing technique -Valine-producing bacterium CGMCC22721-yjiV-trpR and wild type E.coli W3110-The lacI-lacZ gene in the yjiV-trpR gene (these strains were confirmed to be stained by sequencingThe whole lacI-lacZ gene is remained in the body, and the DNA polymerase gene (from colibacillus) started by PxylF promoter is inserted simultaneouslyEscherichia coli) BL 21) to further investigate the effect of these genes on the synthesis of L-valine.
pREDCas9 plasmid (containing spectinomycin resistance gene) was extracted and transformed into CGMCC22721-yjiV-trpR and W3110-yjiV-trpR competent cells of example 10, spread on 2-YT agar plates containing spectinomycin (100 mg/L) and cultured at 32℃and single colonies resistant to spectinomycin (100 mg/L) were selected and PCR identified with primer pRedCas9-PF/pRedCas9-PR to obtain 943bp CGMCC22721-yjiV-tr pR 9 and W3110-yjiV-trpR-Cas9 transformants containing pREDCas9 plasmid.
CGMCC22721-yjiV-trpR-Cas9 and W3110-yjiV-trpR-Cas9 competent cells were prepared. When the bacterial cells grow to OD 600 =0.1 IPTG was added at a final concentration of 0.1mM to induce λ -Red mediated homologous recombination. When OD is 600 At=0.4, cells were collected to prepare competent cells, and pGRB-sgRNA-4 plasmid and homologous recombinant DNA fragment ΔlacIZ-PxylF-DNA polymerase of example 4 were transformed, respectively, and plated onto 2-YT agar plates containing spectinomycin (100 mg/L) and ampicillin (100 mg/L) and cultured at 32℃for 12 h. After single colony generated by culture is passaged, PCR identification is carried out through a primer P35/P36, and a fragment with the size of 1655bp is amplified by PCR to be a positive transformant.
Positive transformants were inoculated into 2-YT medium containing spectinomycin (100 mg/L) and final concentration of arabinose to 0.2% to eliminate plasmid pGRB-sgRNA-4, colonies which grew on spectinomycin (100 mg/L) but did not grow on ampicillin (100 mg/L) were selected, these colonies were transferred to 2-YT medium for 42℃culture to eliminate pREDCas9 plasmid, colonies which did not grow on spectinomycin (100 mg/L) but did not grow on nonreactive 2-YT were selected, PCR identification was performed again by primer P27/P34, a fragment of 4524bp (SEQ ID No. 9) was amplified as a positive, the positive colonies were sequenced, and the strains with correct sequencing results were named CGMCC22721, respectively-yjiV-trpR-lacIZ and W3110-yjiV-trpR-lacIZ；
Recombinant bacterium CGMCC22721-yjiV-trpR-lacIZ andW3110-the yjiV gene was deleted from both yjiV-trpR-lacIZ while the ilvE gene (from Bacillus subtilis) which was promoted by Ptrc promoter was overexpressedBacillus subtilis subsp. subtilis str. 168) And ilvD gene (from E.coli @ promoted by the pilvD promoterEscherichia coli) W3110); deletion of trpR Gene while overexpression of ilvH from Ptrc promoter G14D 、S17F A gene; deletion of lacI-lacZ Gene while over-expressing PxylF promoter-initiated DNA polymerase Gene (from Escherichia coli [. About.Escherichia coli) BL 21). Specifically, recombinant bacteria CGMCC22721-yjiV-trpR-lacIZ and W3110 -yjiV-trpR-lacIZ was obtained by knocking out the coding region of the yjiV gene part of the genome of L-valine-producing bacterium CGMCC22721 and the wild E.coli W3110, respectively, and inserting the ilvE gene (from Bacillus subtilis) which was promoted by Ptrc promoterBacillus subtilis subsp. subtilis str. 168) And ilvD gene (from E.coli @ promoted by the pilvD promoterEscherichia coli) W3110); knocking out partial coding region of trpR gene, inserting Ptrc promoter-initiated mutant ilvH G14D 、S17F A gene; meanwhile, the partial coding region of the lacI-lacZ gene is knocked out, and a DNA polymerase gene (from Escherichia coli @ is inserted into the coding regionEscherichia coli) BL 21), and the other nucleotides in the genome are maintained unchanged.
Example 12 construction of CGMCC22721-yjiV-trpR-lacIZ and W3110-An engineering strain deleted for ycgH gene and simultaneously overexpressing ilvC gene on yjiV-trpR-lacIZ.
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, knock out L using CRISPR/Cas9 gene editing technique-Valine-producing bacterium CGMCC22721-yjiV-trpR-lacIZ and wild type E.coli W3110-The ycgH gene in yjiV-trpR-lacIZ gene (it was confirmed by sequencing that the whole ycgH gene remained on the chromosome of these strains) was inserted together with the ilvC gene (from E.coli @ Escherichia coli) W3110), the influence of these genes on the synthesis of L-valine was studied more intensively.
pREDCas9 plasmid (containing spectinomycin resistance gene) was extracted and transformed into CGMCC22721-yjiV-trpR-lacIZ and wild type E.coli W3110-yjiV-trpR-lacIZ competent cells of example 11, spread on 2-YT agar plates containing spectinomycin (100 mg/L) and cultured at 32℃and single colonies resistant to spectinomycin (100 mg/L) were selected and PCR identified with primer pRedCas9-PF/pRedCas9-PR to obtain 943bp CGMCC22721-yjiV-trpR-lacIZ-Cas9 and W3110-yjiV-trpR-lacIZ-Cas9 transformants.
CGMCC22721-yjiV-trpR-lacIZ-Cas9 and W3110-yjiV-trpR-lacIZ-Cas9 competent cells were prepared. When the bacterial cells grow to OD 600 =0.1 IPTG was added at a final concentration of 0.1mM to induce λ -Red mediated homologous recombination. When OD is 600 At=0.4, cells were collected to prepare competent cells, and pGRB-sgRNA-5 plasmid and homologous recombinant DNA fragment Δycgh-Ptrc-ilvC of example 5 were transformed, respectively, and plated onto 2-YT agar plates containing spectinomycin (100 mg/L) and ampicillin (100 mg/L) and cultured at 32℃for 12 h. After single colony generated by culture is passaged, PCR identification is carried out through a primer P43/P44, and positive transformant with 1669bp fragment is amplified by PCR.
Positive transformants were inoculated into 2-YT medium containing spectinomycin (100 mg/L) and final concentration of arabinose to 0.2% to eliminate plasmid pGRB-sgRNA-5, colonies which grew on spectinomycin (100 mg/L) but did not grow on ampicillin (100 mg/L) were selected, these colonies were transferred to 2-YT medium for 42℃culture to eliminate pREDCas9 plasmid, colonies which did not grow on spectinomycin (100 mg/L) but grew on nonreactive 2-YT were selected, PCR identification was performed again by primer P37/P42, fragments of 3189bp (SEQ ID No. 11) were positive, the positive colonies were sequenced, and the strains with correct sequencing results were named CGMCC 721-yjiV-tr-lacIZ-ycgH and W3110, respectively-yjiV-trpR-lacIZ-ycgH；
Recombinant bacteria CGMCC22721-yjiV-trpR-lacIZ-ycgH and W3110-The yjiV gene was deleted from yjiV-trpR-lacIZ-ycgH while the ilvE gene (from Bacillus subtilis) which was promoted by Ptrc promoter was overexpressedBacillus subtilis subsp. subtilis str. 168) And ilvD gene (from E.coli @ promoted by the pilvD promoterEscherichia coli) W3110); deletion of trpR Gene while overexpression of ilvH from Ptrc promoter G14D 、S17F A gene; deletion of lacI-lacZ Gene while over-expressing PxylF promoter-initiated DNA polymerase Gene (from Escherichia coli [. About. Escherichia coli) BL 21); deletion of the ycgH Gene while overexpression of the Ptrc promoter-initiated ilvC Gene (from E.coli [ ]Escherichia coli) W3110). In particular, recombinant bacterium CGMCC22721-yjiV-trpR-lacIZ-ycgH and W3110-The yjiV-trpR-lacIZ-ycgH gene was obtained by knocking out the coding region of the yjiV gene on the genome of L-valine-producing bacterium CGMCC22721 and the wild E.coli W3110, respectively, and inserting the ilvE gene (from Bacillus subtilis) which was started by Ptrc promoterBacillus subtilis subsp. subtilis str. 168) And ilvD gene (from E.coli @ promoted by the pilvD promoterEscherichia coli) W3110); knocking out partial coding region of trpR gene, inserting Ptrc promoter-initiated mutant ilvH G14D 、S17F A gene; the coding region of part of lacI-lacZ gene was knocked out, and DNA polymerase gene (from Escherichia coli @ was inserted into the geneEscherichia coli) BL 21); meanwhile, partial coding region of ycgH gene is knocked out, ilvC gene (from colibacillus @ is inserted into the gene to be started by Ptrc promoterEscherichia coli) W3110) and maintaining the other nucleotides in the genome unchanged.
Example 13 construction of CGMCC22721-trpR and W3110-An engineering strain deleted for the lacI-lacZ gene on trpR and simultaneously overexpressing the DNA polymerase gene.
Coli according to NCBI publication Escherichia coli) W3110 genome sequence, knock out L using CRISPR/Cas9 gene editing technique-The lacI-lacZ gene in the valine-producing strain CGMCC22721-trpR and the wild E.coli W3110-trpR gene (the complete lacI-lacZ gene is remained on the chromosome of the strain confirmed by sequencing), and the DNA polymerase gene started by PxylF promoter (from E.coli @ is insertedEscherichia coli) BL 21) to further investigate these gene pairsInfluence of L-valine synthesis.
pREDCas9 plasmid (containing spectinomycin resistance gene) was extracted and transformed into CGMCC22721-trpR and W3110-trpR competent cells of example 3, spread on 2-YT agar plates containing spectinomycin (100 mg/L) and cultured at 32℃and single colonies resistant to spectinomycin (100 mg/L) were selected for PCR identification with the primer pREDCas9-PF/pRedCas9-PR to obtain 943 bp) as CGMCC22721-trpR-Cas9 and W3110-trpR-Cas9 transformants containing pREDCas9 plasmid.
CGMCC22721-trpR-Cas9 and W3110-trpR-Cas9 competent cells were prepared. When the bacterial cells grow to OD 600 =0.1 IPTG was added at a final concentration of 0.1mM to induce λ -Red mediated homologous recombination. When OD is 600 At=0.4, cells were collected to prepare competent cells, and pGRB-sgRNA-4 plasmid and homologous recombinant DNA fragment ΔlacIZ-PxylF-DNA polymerase of example 4 were transformed, respectively, and plated onto 2-YT agar plates containing spectinomycin (100 mg/L) and ampicillin (100 mg/L) and cultured at 32℃for 12 h. After single colony generated by culture is passaged, PCR identification is carried out through a primer P35/P36, and a fragment with the size of 1655bp is amplified by PCR to be a positive transformant.
Positive transformants were inoculated into 2-YT medium containing spectinomycin (100 mg/L) and final concentration of arabinose to 0.2% to eliminate plasmid pGRB-sgRNA-4, colonies which grew on spectinomycin (100 mg/L) but did not grow on ampicillin (100 mg/L) were selected, these colonies were transferred to 2-YT medium for 42℃culture to eliminate pREDCas9 plasmid, colonies which did not grow on spectinomycin (100 mg/L) but did not grow on nonreactive 2-YT were selected, PCR identification was performed again by primer P27/P34, a fragment of 4524bp (SEQ ID No. 9) was amplified as a positive, the positive colonies were sequenced, and the strains with correct sequencing results were named CGMCC22721, respectively-trpR-lacIZ and W3110-trpR-lacIZ;
recombinant bacterium CGMCC22721-trpR-lacIZ and W3110-trpR-lacIZ are deleted in trpR gene, and ilvH started by Ptrc promoter is over-expressed G14D 、S17F A gene; deletion of lacI-lacZ Gene while over-expressing PxylF promoter-initiated DNA polymerase Gene (from Escherichia coli [. About.Escherichia coli） BL21）。Specifically, recombinant bacteria CGMCC22721-trpR-lacIZ and W3110-trpR-lacIZ are obtained by knocking out partial coding regions of trpR genes on the genomes of L-valine producing bacteria CGMCC22721 and wild type escherichia coli W3110, respectively, and inserting mutated ilvH started by Ptrc promoter G14D 、S17F A gene; meanwhile, the partial coding region of the lacI-lacZ gene is knocked out, and a DNA polymerase gene (from Escherichia coli @ is inserted into the coding regionEscherichia coli) BL 21), and the other nucleotides in the genome are maintained unchanged.
Example 14 construction of CGMCC22721-trpR-lacIZ and W3110-An engineering strain deleted for ycgH gene and simultaneously overexpressing ilvC gene on trpR-lacIZ.
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, knock out L using CRISPR/Cas9 gene editing technique-The ycgH gene in the valine-producing bacterium CGMCC22721-trpR-lacIZ and the wild-type E.coli W3110-trpR-lacIZ genes (it was confirmed by sequencing that the complete ycgH gene remained on the chromosomes of these strains) was inserted together with the ilvC gene (from E.coli @ that was started by the Ptrc promoterEscherichia coli) W3110), the influence of these genes on the synthesis of L-valine was studied more intensively.
pREDCas9 plasmid (containing spectinomycin resistance gene) was extracted and transformed into CGMCC22721-trpR-lacIZ and wild type E.coli W3110-trpR-lacIZ competent cells of example 13, spread on 2-YT agar plates containing spectinomycin (100 mg/L) and cultured at 32℃and single colonies resistant to spectinomycin (100 mg/L) were selected and PCR identified with the primer pRedCas9-PF/pRedCas9-PR to obtain 943bp CGMCC22721-trpR-lacIZ-Cas9 and W3110-trpR-lacIZ-Cas9 transformants containing pREDCas9 plasmid, respectively.
CGMCC22721-trpR-lacIZ-Cas9 and W3110-trpR-lacIZ-Cas9 competent cells were prepared. When the bacterial cells grow to OD 600 =0.1 IPTG was added at a final concentration of 0.1mM to induce λ -Red mediated homologous recombination. When OD is 600 When=0.4, cells were collected to prepare competent cells, and pGRB-sgRNA-5 plasmid and homologous recombination DNA fragment Δycgh-Ptrc-ilvC of example 5 were transformed, respectively, and plated onto a cell containing the same2-YT agar plates with spectinomycin (100 mg/L) and ampicillin (100 mg/L) were incubated at 32℃for 12 h. After single colony generated by culture is passaged, PCR identification is carried out through a primer P43/P44, and positive transformant with 1669bp fragment is amplified by PCR.
The positive transformants were inoculated in 2-YT medium containing spectinomycin (100 mg/L) and final concentration to 0.2% arabinose to eliminate plasmid pGRB-sgRNA-5, colonies which grew on spectinomycin (100 mg/L) but did not grow on ampicillin (100 mg/L) were selected, these colonies were then transferred to 2-YT medium for 42℃cultivation to eliminate pREDCas9 plasmid, colonies which did not grow on spectinomycin (100 mg/L) but grew on nonreactive 2-YT were selected, PCR identification was performed again by primer P37/P42, positive colonies were sequenced, and strains with correct sequencing results were named CGMCC 721-pR-tr-IZ-gH and W3110-tr-pR-IZ-ycgH, respectively, and fragments with size 3189bp (SEQ ID No. 11) were amplified as positive colonies;
Recombinant bacterium CGMCC22721-trpR-lacIZ-ycgH and W3110-trpR-lacIZ-ycgH are deleted in trpR gene, and ilvH started by Ptrc promoter is overexpressed G14D 、S17F A gene; deletion of lacI-lacZ Gene while over-expressing PxylF promoter-initiated DNA polymerase Gene (from Escherichia coli [. About.Escherichia coli) BL 21); deletion of the ycgH Gene while overexpression of the Ptrc promoter-initiated ilvC Gene (from E.coli [ ]Escherichia coli) W3110). In particular, recombinant bacterium CGMCC22721-TrpR-lacIZ-ycgH and W3110-trpR-lacIZ-ycgH were obtained by knocking out the coding region of the trpR gene part on the genome of L-valine-producing bacterium CGMCC22721 and wild-type E.coli W3110, respectively, and inserting a Ptrc promoter-initiated mutant ilvH G14D 、S17F A gene; the coding region of part of lacI-lacZ gene was knocked out, and DNA polymerase gene (from Escherichia coli @ was inserted into the geneEscherichia coli) BL 21); meanwhile, partial coding region of ycgH gene is knocked out, ilvC gene (from colibacillus @ is inserted into the gene to be started by Ptrc promoterEscherichia coli) W3110) and maintaining the other nucleotides in the genome unchanged.
EXAMPLE 15,Construction of CGMCC22721-lacIZ and W3110-An engineering strain lacking the ycgH gene on lacIZ while overexpressing the ilvC gene.
Coli according to NCBI publicationEscherichia coli) W3110 genome sequence, knock out L using CRISPR/Cas9 gene editing technique-The ycgH gene in the valine-producing strain CGMCC22721-lacIZ and the wild E.coli W3110-lacIZ genes (it was confirmed by sequencing that the complete ycgH gene remained on the chromosome of these strains) was inserted simultaneously with the ilvC gene (from E.coli @ that was initiated by Ptrc promoterEscherichia coli) W3110), the influence of these genes on the synthesis of L-valine was studied more intensively.
The pREDCas9 plasmid (containing the spectinomycin resistance gene) was extracted and transformed into CGMCC22721-lacIZ and wild type E.coli W3110-lacIZ competent cells of example 4, respectively, plated onto 2-YT agar plates containing spectinomycin (100 mg/L) and cultured at 32℃and single colonies resistant to spectinomycin (100 mg/L) were selected and PCR-identified with the primers pRedCas9-PF/pRedCas9-PR to obtain 943bp CGMCC22721-lacIZ-Cas9 and W3110-lacIZ-Cas9 transformants containing pREDCas9 plasmid.
CGMCC22721-lacIZ-Cas9 and W3110-lacIZ-Cas9 competent cells were prepared. When the bacterial cells grow to OD 600 =0.1 IPTG was added at a final concentration of 0.1mM to induce λ -Red mediated homologous recombination. When OD is 600 At=0.4, cells were collected to prepare competent cells, and pGRB-sgRNA-5 plasmid and homologous recombinant DNA fragment Δycgh-Ptrc-ilvC of example 5 were transformed, respectively, and plated onto 2-YT agar plates containing spectinomycin (100 mg/L) and ampicillin (100 mg/L) and cultured at 32℃for 12 h. After single colony generated by culture is passaged, PCR identification is carried out through a primer P43/P44, and positive transformant with 1669bp fragment is amplified by PCR.
The positive transformants were inoculated in 2-YT medium containing spectinomycin (100 mg/L) and final concentration to 0.2% arabinose to eliminate plasmid pGRB-sgRNA-5, colonies which grew on spectinomycin (100 mg/L) but did not grow on ampicillin (100 mg/L) were selected, these colonies were then transferred to 2-YT medium for 42℃cultivation to eliminate pREDCas9 plasmid, colonies which did not grow on spectinomycin (100 mg/L) but grew on nonreactive 2-YT were selected, PCR identification was performed again by primer P37/P42, positive colonies were sequenced, and strains with correct sequencing results were named CGMCC 721-IZ-ycgH and W3110-IZ-ycgH, respectively, and the fragments with size 3189bp (SEQ ID No. 11) were amplified as positive colonies;
recombinant bacterium CGMCC22721-lacIZ-ycgH and W3110-lacIZ-ycgH both lack lacI-lacZ gene, and simultaneously over-express DNA polymerase gene (from Escherichia coli @ started by PxylF promoterEscherichia coli) BL 21); deletion of the ycgH Gene while overexpression of the Ptrc promoter-initiated ilvC Gene (from E.coli [ ]Escherichia coli) W3110). Specifically, the recombinant bacteria CGMCC22721-lacIZ-ycgH and W3110-lacIZ-ycgH are obtained by knocking out the coding region of lacI-lacZ gene part on the genome of L-valine producing bacteria CGMCC22721 and wild E.coli W3110, respectively, and inserting DNA polymerase gene (from E.coli @ started by PxylF promoter Escherichia coli) BL 21); meanwhile, partial coding region of ycgH gene is knocked out, ilvC gene (from colibacillus @ is inserted into the gene to be started by Ptrc promoterEscherichia coli) W3110) and maintaining the other nucleotides in the genome unchanged.
Example 16L-valine fermentation experiments.
The strains constructed in examples 1 to 15 and L-valine-producing bacterium CGMCC22721 and wild type E.coli W3110 were subjected to fermentation experiments in a BLBIO-5GC-4-H type fermenter (Shanghai Bai Biotechnology Co., ltd.) with the medium shown in FIG. 1 and the control process shown in FIG. 2. Each strain was repeated three times and the results are shown in fig. 3. As shown by the above fermentation results, both the strain CGMCC22721 producing L-valine and the model strain wild-type E.coli W3110 were transformed in examples 1-15 to contribute to the improvement of L-valine production.
The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains.

Claims (10)

1. Coli for producing L-valine, characterized in that: the escherichia coli is recombinant bacteria obtained by modifying recipient escherichia coli; the modification includes A3) and A4);
a3 Including a 31) and a 32):
a31 Knocking out trpR gene of the receptor escherichia coli, inhibiting expression of the trpR gene or inhibiting activity of protein encoded by the trpR gene;
a32 Increasing ilvH in E.coli at said receptor G14D 、S17F Content of Gene-encoded protein or enhancement of the ilvH G14D 、S17F Activity of the gene encoding the protein; the ilvH G14D 、S17F The gene is obtained by replacing a 14 th glycine codon in the ilvH gene with an aspartic acid codon and a 17 th serine codon with a phenylalanine codon; the ilvH gene is derived from Escherichia coliEscherichia coli）；
A4 Including a 41), a 42), and a 43):
a41 Knocking out the lacI gene of the receptor escherichia coli, and inhibiting the expression of the lacI gene or inhibiting the activity of a protein encoded by the lacI gene;
a42 Knocking out lacZ gene of the receptor escherichia coli, inhibiting expression of the lacZ gene or inhibiting activity of protein encoded by the lacZ gene;
a43 Increasing the amount of or enhancing the activity of a DNA polymerase in said recipient escherichia coli; the DNA polymerase is derived from Escherichia coli Escherichia coli）。
2. The escherichia coli as set forth in claim 1, wherein: the ilvH G14D 、S17F The gene codes the protein shown in SEQ ID No.8 in the sequence table.
3. The escherichia coli as set forth in claim 2, wherein: the ilvH G14D 、S17F The gene is DNA molecule shown in 835-1326 th position of SEQ ID No.7 in the sequence table.
4. An escherichia coli as claimed in any one of claims 1-3, wherein: the modification further comprises A5):
a5 Including a 51) and a 52):
a51 Knocking out the ycgH gene of the receptor escherichia coli, and inhibiting the expression of the ycgH gene or inhibiting the activity of a protein encoded by the ycgH gene;
a52 Increasing the content of or enhancing the activity of a protein encoded by the ilvC gene in the recipient escherichia coli; the ilvC gene is derived from Escherichia coliEscherichia coli）。
5. The escherichia coli as set forth in claim 4, wherein:
the DNA polymerase is a protein shown as SEQ ID No.10 in a sequence table;
the ilvC gene codes for a protein shown in SEQ ID No.12 of the sequence Listing.
6. The escherichia coli as set forth in claim 5, wherein:
the coding gene of the DNA polymerase is a DNA molecule shown in 701-3352 of SEQ ID No.9 in a sequence table;
The ilvC gene is a DNA molecule shown in 794-2269 of SEQ ID No.11 in the sequence Listing.
7. A process for producing L-valine using Escherichia coli, characterized by: the method comprises the following steps: carrying out modification of the A3) and the A4 according to any one of claims 1 to 3 on recipient escherichia coli to obtain the target escherichia coli.
8. The method according to claim 7, wherein: the method further comprises engineering the recipient E.coli with A5) according to any one of claims 4 to 6.
9.L-A process for producing valine, characterized by: the method comprises the following steps: culturing the E.coli according to any one of claims 1 to 6 to obtain L-valine.
10. Use of the E.coli according to any one of claims 1 to 6 for the production of L-valine or for the preparation of a product for the production of L-valine.
CN202310809274.4A 2023-07-04 2023-07-04 Construction method and application of Escherichia coli for producing L-valine Active CN116555153B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310809274.4A CN116555153B (en) 2023-07-04 2023-07-04 Construction method and application of Escherichia coli for producing L-valine

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310809274.4A CN116555153B (en) 2023-07-04 2023-07-04 Construction method and application of Escherichia coli for producing L-valine

Publications (2)

Publication Number Publication Date
CN116555153A CN116555153A (en) 2023-08-08
CN116555153B true CN116555153B (en) 2023-09-29

Family

ID=87486440

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310809274.4A Active CN116555153B (en) 2023-07-04 2023-07-04 Construction method and application of Escherichia coli for producing L-valine

Country Status (1)

Country Link
CN (1) CN116555153B (en)

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1310233A (en) * 2000-01-26 2001-08-29 味之素株式会社 Mutant iLvH gene and process for producing L-valine
EP1715056A1 (en) * 2005-04-23 2006-10-25 Degussa AG Process for the production of L-amino acids using improved Enterobacteriaceae strains
EP2163613A2 (en) * 2008-08-28 2010-03-17 Evonik Degussa GmbH Method for manufacturing organic chemical compounds using improved strains of the enterobacteriaceae family
CN110468092A (en) * 2019-08-26 2019-11-19 天津科技大学 The genetic engineering bacterium and its construction method of one plant height production Valine and application
CN110607268A (en) * 2019-10-24 2019-12-24 天津科技大学 Genetically engineered bacterium for high yield of L-valine and method for producing L-valine by fermentation
CN111926002A (en) * 2020-09-16 2020-11-13 中国科学院天津工业生物技术研究所 TrpE mutant and application thereof in gene engineering bacteria for producing L-tryptophan
CN113278568A (en) * 2020-05-27 2021-08-20 巴彦淖尔华恒生物科技有限公司 Recombinant escherichia coli for producing L-valine and application thereof
CN114717172A (en) * 2022-03-21 2022-07-08 江南大学 Escherichia coli for synthesizing L-valine and construction method and application thereof
CN116004500A (en) * 2022-12-29 2023-04-25 天津科技大学 Genetically engineered bacterium for producing L-valine and construction method and application thereof

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1310233A (en) * 2000-01-26 2001-08-29 味之素株式会社 Mutant iLvH gene and process for producing L-valine
EP1715056A1 (en) * 2005-04-23 2006-10-25 Degussa AG Process for the production of L-amino acids using improved Enterobacteriaceae strains
EP2163613A2 (en) * 2008-08-28 2010-03-17 Evonik Degussa GmbH Method for manufacturing organic chemical compounds using improved strains of the enterobacteriaceae family
CN110468092A (en) * 2019-08-26 2019-11-19 天津科技大学 The genetic engineering bacterium and its construction method of one plant height production Valine and application
CN110607268A (en) * 2019-10-24 2019-12-24 天津科技大学 Genetically engineered bacterium for high yield of L-valine and method for producing L-valine by fermentation
CN113278568A (en) * 2020-05-27 2021-08-20 巴彦淖尔华恒生物科技有限公司 Recombinant escherichia coli for producing L-valine and application thereof
CN111926002A (en) * 2020-09-16 2020-11-13 中国科学院天津工业生物技术研究所 TrpE mutant and application thereof in gene engineering bacteria for producing L-tryptophan
CN114717172A (en) * 2022-03-21 2022-07-08 江南大学 Escherichia coli for synthesizing L-valine and construction method and application thereof
CN116004500A (en) * 2022-12-29 2023-04-25 天津科技大学 Genetically engineered bacterium for producing L-valine and construction method and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
High-level production of L-valine in Escherichia coli using multi-modular engineering;Yanan Hao et al.;《Bioresource Technology》;第359卷;第2页表1、第6页第3.5节 *

Also Published As

Publication number Publication date
CN116555153A (en) 2023-08-08

Similar Documents

Publication Publication Date Title
AU2019243241B2 (en) A Novel Promoter And A Method For Producing L-Amino Acid Using The Same
EP3597738B1 (en) Modified homoserine dehydrogenase, and method for producing homoserine or homoserine-derived l-amino acid using same
CN114835783A (en) NCgl2747 gene mutant and application thereof in preparation of L-lysine
CN116555153B (en) Construction method and application of Escherichia coli for producing L-valine
WO2008007914A1 (en) A nucleotide sequence of a mutant argf with increased activity and a method for producing l-arginine using a transformed cell containing the same
CN116555152B (en) Coli, construction method thereof and application thereof in L-valine production
CN116555154B (en) Coli for producing L-valine and construction method thereof
CN116555155B (en) Coli for producing L-valine and construction method and application thereof
CN116555151B (en) L-valine-producing engineering bacterium, construction method and application
CN116284282A (en) tkt gene mutant and application thereof in preparation of L-lysine
CN116063417A (en) BBD29_14255 gene mutant and application thereof in preparation of L-glutamic acid
CN115925834A (en) Amino acid yield related protein coding gene pyrG and related strain, biological material and application thereof
CN112625992B (en) Recombinant strain for producing L-glutamic acid by modifying gene BBD 29-11265 as well as construction method and application thereof
CN115975957A (en) Escherichia coli flagellum specific ATP synthetase gene fliI and application of mutant thereof in L-amino acid production
CN112175894B (en) Recombinant strain for producing L-amino acid and construction method and application thereof
US20220340940A1 (en) Novel promoter and method for producing desired substance using same
WO2022143762A1 (en) Recombinant strain of modifying gene bbd29_14900, and construction method and use thereof
KR20230002331A (en) Recombinant strain producing L-lysine and its construction method and application
CN116555150B (en) Recombinant Escherichia coli for fermentative production of L-valine
CN116536237B (en) Modified escherichia coli and application thereof in fermentation production of L-valine
CN116463304B (en) Threonine dehydrogenase gene mutant and application thereof
CN114369559B (en) Recombinant strain for producing L-amino acid and construction method and application thereof
CN117535335A (en) BBD29_12340 gene promoter mutant and application thereof in fermentation production of L-glutamic acid
CN117568299A (en) BBD29_06321 gene mutant and application thereof
US20230323412A1 (en) Recombinant strain for producing l-amino acid and construction method and use thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant