CN112899245A

CN112899245A - Acetaldehyde dehydrogenase gene DkALDH10 and application thereof

Info

Publication number: CN112899245A
Application number: CN202110412610.2A
Authority: CN
Inventors: 张青林; 张萌; 徐莉清; 郭大勇; 罗正荣
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2021-04-16
Filing date: 2021-04-16
Publication date: 2021-06-04
Also published as: CN114807068A; CN114807068B

Abstract

The invention discloses an acetaldehyde dehydrogenase gene DkALDH10 and application thereof, wherein the nucleotide sequence is shown as SEQ ID NO. 2. The invention clones and identifies an important member DkALDH10 gene of a Chinese sweet persimmon acetaldehyde dehydrogenase gene family for the first time by carrying out expression difference screening on pulp transcriptome data of the Chinese sweet persimmon 'Eben No. 1' in a key period of fruit development. Further, the relative content of soluble tannin and insoluble tannin in fruits is adjusted by constructing a DkALDH10 gene interference vector and an overexpression vector and verifying through genetic transformation through regulating acetaldehyde metabolism of the DkALDH10 gene, and then the astringent taste removing process of the persimmons is adjusted. The invention firstly clarifies the relation between the DkALDH10 gene and the natural deastringency of the Chinese sweet persimmon, perfects the natural deastringency molecular regulation network of the Chinese sweet persimmon and provides new scientific basis and gene resources for genetic improvement of the Chinese sweet persimmon.

Description

Acetaldehyde dehydrogenase gene DkALDH10 and application thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to an acetaldehyde dehydrogenase gene DkALDH10 and application thereof.

Background

China is the origin of persimmon (Diospyros kaki Thunb.) and the world with the longest history of persimmon tree cultivation, the largest area and the largest yield, but astringent persimmons are the main reasons in the traditional production area. The persimmon fruit contains specialized tannin cells, and procyanidin (also called tannin) accumulated in vacuole is the main reason of generating astringent feeling after eating. The existing persimmon varieties are classified into complete persimmon (PCNA; abbreviated as "sweet persimmon") and incomplete persimmon (non-PCNA; abbreviated as "astringent persimmon") according to whether the fruit can naturally lose astringency on trees when it is ripe or not and the hereditary character of the persimmon. The astringent persimmon fruits are ripe and then can be eaten after being subjected to astringent taste removing treatment, so that the labor, material and financial resources are consumed, and the shelf life of the astringent persimmon fruits is short; on the other hand, the incompletely deastringented persimmon fruit not only has reduced marketability, but also causes fear of consumers to induce gastrolithiasis (gastrophytobuzoar). Therefore, the fully sweet persimmon, in which the ripe fruit can naturally lose astringency on trees, is a key target for industrial development and genetic improvement worldwide at present.

It has been shown that natural deastringency of Chinese persimmon is an acetaldehyde-mediated insoluble process of soluble tannin, i.e. acetaldehyde in the fruit is combined with soluble tannin and transformed into insoluble gel substances (generally called "coagulation effect") which do not cause astringent feeling, and the process is mainly controlled by three enzyme gene families in the acetaldehyde metabolic pathway: pyruvate Decarboxylase (PDC), Alcohol Dehydrogenase (ADH), and aldehyde dehydrogenase (ALDH). Wherein acetaldehyde dehydrogenase (ALDH) catalyzes the oxidation of acetaldehyde to form acetic acid and CO₂And H₂And O. Has already been used forThe research results show that the ethanol and the CO are utilized₂The treatments remarkably enhance the activities of ADH and PDC, induce the increase of fruit acetaldehyde content, promote the conversion of soluble tannin to insoluble tannin and finally cause fruit deastringency.

The persimmon has complex genetic background and high ploidy of chromosomes, and particularly, the research on the genetic rules of genome information and sweetness and astringency is relatively lagged. Acetaldehyde dehydrogenase and its related genes have been less studied in woody plants. In addition, the nature of persimmon tannin monomers, the selectivity of cytoplasmic transport and transmembrane transport, the polymerization mode in vacuole and the like cause Chinese sweet persimmon and Japanese sweet persimmon to have different natural astringency removal mechanisms. Wherein, the effect of the downstream key gene DkALDH of acetaldehyde metabolism in natural deastringency of Chinese sweet persimmons has no direct relevant evidence, and the gene function of the DkALDH is verified.

Disclosure of Invention

Aiming at blank spots in the prior art, the invention carries out expression differential screening according to pulp transcriptome data of the Chinese sweet persimmon 'Ebei persimmon No. 1' in a key period of fruit development, clones and identifies a differential expression gene, namely, an acetaldehyde dehydrogenase gene DkALDH10, verifies the relation between the differential expression gene and the natural deastringency of the Chinese sweet persimmon for the first time, perfects a natural deastringency molecular regulation network of the Chinese sweet persimmon, and provides new scientific basis and gene resources for further genetic improvement and regulation of the deastringency of the persimmon.

The invention aims to provide acetaldehyde dehydrogenase DkALDH10, wherein the amino acid sequence of the acetaldehyde dehydrogenase DkALDH10 is shown as SEQ ID NO: 1 is shown.

Further, the acetaldehyde dehydrogenase DkALDH10 is localized in the cytoplasmic membrane and the vacuolar membrane.

The invention also aims to provide a gene for coding the acetaldehyde dehydrogenase DkALDH10, wherein the gene is DkALDH10 gene, and the nucleotide sequence of the gene is shown as SEQ ID NO:2, respectively.

The invention also aims to provide an amplification primer for coding the DkALDH10 gene, wherein the nucleotide sequence of the amplification primer is shown as SEQ ID NO: 3-4.

The fourth purpose of the invention is to provide a fluorescent quantitative PCR specific primer for detecting the DkALDH10 gene, wherein the nucleotide sequence of the fluorescent quantitative PCR specific primer is shown as SEQ ID NO: 5-6.

The fifth object of the present invention is to provide a vector containing the DkALDH10 gene.

Further, the vector is a overexpression vector or an interference expression vector of the DkALDH10 gene.

The sixth purpose of the present invention is to provide a genetically engineered bacterium comprising the vector.

The seventh purpose of the invention is to provide the application of the DkALDH10 gene, the vector or the genetic engineering bacterium in regulating the astringent taste of persimmon.

Furthermore, the DkALDH10 gene, or a vector or a genetic engineering bacterium regulates the content of soluble tannin and insoluble tannin to regulate the astringent taste of the persimmon.

Compared with the prior art, the invention has the beneficial effects that:

the invention firstly obtains and identifies an important member DkALDH10 gene of a Chinese sweet persimmon acetaldehyde dehydrogenase gene family and obtains a full-length sequence of the DkALDH10 gene by carrying out expression difference screening on transcriptome data of the fruit development period (10 weeks and 20 weeks after flowering) of the Chinese sweet persimmon 'Eben No. 1'. According to the invention, through constructing a DkALDH10 gene interference vector and an overexpression vector and measuring the content of soluble tannin and insoluble tannin in fruits transformed by different vectors, the DkALDH10 gene is verified to decompose acetaldehyde and inhibit the transformation from the soluble tannin to the insoluble tannin, so that the 'solidification effect' in the natural deastringency of Chinese sweet persimmons is influenced, namely the DkALDH10 gene regulates the content of the soluble tannin and the insoluble tannin in the persimmons fruits by regulating acetaldehyde metabolism, and further regulates the deastringency process of the persimmons. The invention firstly clarifies the relation between the DkALDH10 gene and the natural deastringency of Chinese sweet persimmons, perfects the natural deastringency molecular regulation network of the sweet persimmons and provides new scientific basis and gene resources for regulating the deastringency of the persimmons.

Drawings

FIG. 1 is a graph showing the fruit morphology and tannin content changes of three persimmon varieties according to example 1 of the present invention, wherein FIG. 1-A is a graph showing the fruit morphology 2.5-27.5 weeks after flowering of Chinese sweet persimmon "Ebei persimmon" No. 1 ", Japanese sweet persimmon" Yangfeng ", incomplete sweet persimmon" Mopan persimmon ", and FIG. 1-B is a graph showing the dynamic changes in the soluble tannin and the insoluble tannin content of the three persimmons;

FIG. 2 shows the trend of the expression level of the differentially expressed gene DkALDH10 gene expressed in example 2 of the present invention, which changes from 2.5 to 27.5 weeks after the flowering of Ebena Ebenaria 1;

FIG. 3 shows the results of cluster analysis in ALDH families of different species in example 2 of the present invention;

FIG. 4 is the subcellular localization of DkALDH10 in tobacco leaves according to example 2 of the present invention;

FIG. 5 is the result of the transient interference expression of DkALDH10 on persimmon fruit discs in example 3 of the present invention, wherein FIG. 5-A is the result of DMACA staining of fruit discs, FIG. 5-B is the change of soluble tannin content, and FIG. 5-C is the change of insoluble tannin content;

FIG. 6 shows the content analysis results of soluble tannins and insoluble tannins in different strains after constructing the DkALDH10 overexpression strain or the interference expression strain by using the 'Gongcheng water persimmon' tissue culture seedling in example 3 of the present invention, wherein FIG. 6-A shows the content of soluble tannins and insoluble tannins in the DkALDH10 overexpression strain, and FIG. 6-B shows the content of soluble tannins and insoluble tannins in the DkALDH10 interference expression strain.

Detailed Description

The technical solutions of the present invention will be described clearly and completely with reference to the following embodiments of the present invention, and it should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1 determination of tannin content in different persimmon varieties

Selecting three persimmon varieties: chinese sweet persimmon 'Ebei persimmon No. 1' (C-PCNA), Japanese sweet persimmon 'Yangfeng' (J-PCNA) and incomplete sweet persimmon 'Mopan persimmon' (non-PCNA). The fruit morphology of three persimmon varieties is sampled and observed at 2.5 weeks, 5 weeks, 10 weeks, 15 weeks, 20 weeks, 25 weeks and 27.5 weeks after flowering, and the accumulation mode of tannin in the fruit development process is analyzed by quantitatively measuring the content of soluble tannin and insoluble tannin in different persimmon varieties by Folin-Ciocalteu method. The results are shown in FIG. 1.

The Folin-Ciocalteu method is specifically as follows:

(1) preparing a tannic acid standard curve: respectively taking 0mL, 0.2mL, 0.4mL, 0.6mL, 0.8mL and 1.0mL of standard tannic acid solution in a graduated test tube, respectively adding 7.5mL of distilled water and 0.5mL of phenolic reagent into each tube, adding 1.0mL of saturated sodium carbonate after 3min, finally diluting to 10.0mL with water, and carrying out colorimetry at 725nm after 1h to determine the absorbance of the sample.

(2) And (3) tannin content determination: taking 0.1g of fruit pulp from the equator of the fruit, cutting the fruit pulp, putting the fruit pulp into a mortar, adding 0.6mL of 80% methanol solution, fully grinding the fruit pulp, transferring the fruit pulp into a 2mL centrifuge tube, centrifuging the fruit pulp for 10min at 5000g, taking supernatant into the 2mL centrifuge tube, cleaning residues with 0.4mL of 80% methanol solution, repeating the steps, finally placing the fruit pulp in the 1mL centrifuge tube, diluting the fruit pulp by 10 times with distilled water, taking 1.0mL of sample during determination, adding 7.5mL of distilled water and 0.5mL of phenolic reagent, adding 1.0mL of saturated sodium carbonate after 3min, reacting for 1h, determining absorbance at 725nm by using a spectrophotometer, and finding out the corresponding soluble tannin content on a tannic acid standard curve.

The method for determining the content of the insoluble tannin by using the persimmon fruit residue after the content of the soluble tannin is determined comprises the following steps: dissolving with 0.6mL of 1% hydrochloric acid-methanol solution, standing at room temperature for 30min, centrifuging for 10min at 5000g, collecting supernatant, cleaning the residue with 0.4mL of 1% hydrochloric acid-methanol solution, repeating the above steps, and diluting the supernatant to a constant volume of 1mL centrifuge tube, and performing the subsequent determination steps with the soluble tannin.

Wherein FIG. 1-A is an observation diagram of fruit morphology of three persimmon varieties, and FIG. 1-B is a change in tannin content of three persimmon varieties. According to the results of FIG. 1-B, the soluble tannin content of the three varieties all showed a decreasing trend with the development of the fruit, wherein the soluble tannin concentration of the 'Yangfeng' (J-PCNA) was 1.85% FW at 2.5 weeks after the flower of the fruit, and rapidly decreased to 0.83% FW at 5 weeks after the flower, but the decreasing trend was slowed down at 15 weeks after the flower, at which time the soluble tannin concentration had decreased to below 0.2% FW and remained at an extremely low level, and in combination with the taste test, the 'Yangfeng' had no astringency, which is consistent with the previously reported results. 'Eben No. 1' (C-PCNA) can be directly eaten after the fruit flesh soluble tannin content is reduced to a very low level (0.21% FW) 25 weeks after blooming, while the soluble tannin content of the Mopan persimmon (non-PCNA) fruit is always higher than that of two completely sweet persimmons, and the fruit still has obvious astringent feeling until 25 weeks after blooming and cannot be directly eaten. The results, which show that the natural deastringency process of C-PCNA is related to the conversion of soluble tannin into insoluble tannin, show that the content of insoluble tannin in C-PCNA is increased in the later stage of fruit natural development (20-25 weeks after blossom) compared with J-PCNA and non-PCNA.

Example 2 DkALDH10 expression analysis, Gene cloning and sequence analysis

1. Expression analysis

According to the analysis result of the example 1, the phenomenon that soluble tannin is converted into insoluble tannin exists in the fruit development stage of the Chinese persimmon 'Eben No. 1', so that the transcriptome data of 10 weeks and 20 weeks after the flower formation of the 'Eben No. 1' is subjected to expression differential screening, a differential expression gene DkALDH10 is identified, and qRT-PCR expression analysis is carried out on the differential expression gene.

(1) RNA extraction and cDNA Synthesis

At different periods after flowering, fruits of 'Esche 1' are respectively taken, and the total RNA is extracted by adopting an RNAPlant Plus (TIANGEN) kit according to the operation of an instruction. RNA purity and integrity were checked by 1% gel electrophoresis and quantified by measuring its absorbance at 260nm using an ultraspectrophotometer. Then the PrimeScript is adopted^TMRT reagent Kit with gDNAeraser (Takara) Kit, according to the Kit instructions for cDNA synthesis.

(2) qRT-PCR expression analysis

According to the differential expression gene, designing a corresponding fluorescent quantitative PCR specific primer, which specifically comprises the following steps:

f: CCGATTCCTTCTCGTATGCT (shown in SEQ ID NO: 5);

r: ACTTTGCTCGATGTGCTCCA (shown in SEQ ID NO: 6).

Persimmon (D.kaki Thunb.) Actin (primer F: CATGGAGAAAATCTGGCATCATAC; R: GAAGCACTGGGTGCTCTTCTG) was used as an internal reference gene for qRT-PCR

Green Realtime PCR Master Mix fluorescent dye (TOYOBO, Japan), as described and on the QuantStaudio 7Flex real-time quantitative PCR instrument (Applied Biosystems) for fluorescent quantitative PCR analysis, the reaction program 95 ℃ 30s, followed by 95 ℃ 5s, 58 ℃ 10s, 72 ℃ 15s, run 45 cycles, then 95 ℃ 60s, 40 ℃ 30s, each sample for 4 mechanical repetitions.

The change in the expression level of the differentially expressed gene is shown in FIG. 2. The DkALDH10 gene showed a tendency of up-regulation of expression 5-15 weeks after flowering, while the expression 25-27.5 weeks after flowering showed a tendency of down-regulation of expression, which is consistent with the tendency of variation of the insoluble tannin content of Ebena 1 determined in example 1. The gene is proved to be related to the conversion of soluble tannin to insoluble tannin in the 'Eben No. 1', namely the natural deastringency of the 'Eben No. 1' of the Chinese sweet persimmon.

2. Gene cloning and sequence analysis

The cultivated persimmon variety has complicated genetic background, high ploidy of chromosome and long childhood period, and the genome sequence information of cultivated persimmon is not available at present, so that the acquisition of the full-length sequence of the DkALDH10 gene is difficult. After the unigene sequence full length of the differential expression gene is obtained by a conventional 3 '5' -RACE method, a specific primer is designed:

f: ATGGGGAAAGGGCGAGAGAGG (shown in SEQ ID NO: 3);

r; AAGCTTTGGCTTTTCAGGAGA (shown in SEQ ID NO: 4),

the full-length sequence of the gene is obtained by PCR amplification with 'Escheki No. 1' cDNA as a template, wherein the PCR program is 94 ℃ for 3min, then 94 ℃ for 30s, 58 ℃ for 30s and 72 ℃ for 80s, 35 cycles are operated, and finally 72 ℃ for 5min extension is carried out. Separating the amplified product by gel electrophoresis, cutting and recovering. The gene was cloned into pEASYTM-Blunt Simple Cloning Vector (holo-type gold, Beijing, China) to obtain pEASY-DkALDH10 recombinant plasmid and sequenced.

According to the sequencing result, the full-length sequence and the corresponding amino acid sequence are analyzed by using ORFfinder online software, and clustering analysis is carried out on the DkALDH10 and related proteins by using MEGA7.0 (adjacency method, Bootstrap value 2000). The results of cluster analysis are shown in FIG. 3, and the gene was clustered in acetaldehyde dehydrogenase ALDH10 subfamily. The gene is named as DkALDH10 gene, and the nucleotide sequence of the gene is shown as SEQ ID NO:2, the total length of the gene is 1566bp, and the corresponding protein DkALDH10 has an amino acid sequence shown as SEQ ID NO: 1, encodes 521 amino acids.

3. Subcellular localization

Designing a primer containing restriction enzyme sites BamH I and Kpn I, wherein the primer sequence is as follows:

f: CGCGGATCCATGGGGAAAGGGCGAGAGAGG (shown in SEQ ID NO: 7);

r: CGGGGTACC AAGCTTTGGCTTTTCAGGAGA (shown as SEQ ID NO: 8)

The full-length sequence of DkALDH10 obtained by PCR amplification was subjected to PCR procedures of 94 ℃ for 3min, 94 ℃ for 30s, 58 ℃ for 30s, 72 ℃ for 80s, 35 cycles, and 72 ℃ for an additional 5min extension. And recovering the PCR product through gel electrophoresis, connecting the PCR product to a YFP vector through a double enzyme digestion method to construct a fusion plasmid of 35S: DkALDH10: YFP, confirming the sequence accuracy through sequencing, and transferring the recombinant plasmid and a control into agrobacterium GV3101 through a heat shock method.

Adding the agrobacterium GV3101 single clone containing target gene into 1mL LB liquid culture medium containing corresponding antibiotic, culturing at 28 deg.C for 1 d; then adding into 50mL LB liquid culture medium containing corresponding antibiotics, culturing at 28 deg.C and 250r/min overnight to OD₆₀₀1.6-1.8 or the bacterial liquid is golden yellow; centrifuging at 25 deg.C under 4000 Xg for 10min to collect thallus; resuspending with permeate to bacterial liquid concentration OD₆₀₀Is 0.75, the penetrating fluid is sterile double distilled water containing 10mM MgCl₂10mM MES, pH 5.6 and 150. mu.M acetosyringone; before injection infection, the resuspended bacterial liquid is cultured for 3h at 28 ℃ and 100r/min, so that the gene participating in T-DNA transfer is pre-expressed, and the infectivity of agrobacterium is improved.

Injecting tobacco leaves with the seedling age of 6 weeks by using an injection and penetration method, culturing the transformed tobacco for 2-3 days, and observing the transient expression of YFP by using a confocal microscope, wherein the observation result is shown in figure 4, which shows that DkALDH10 is positioned on a cytoplasmic membrane and a vacuolar membrane.

Example 3 persimmon fruit disk transient transformation and leaf disk method Stable genetic transformation

1. Instant conversion of persimmon fruit wafer

Persimmon belongs to one of woody plants difficult to be genetically transformed, and has the problems of large genotype difference, low transformation rate, difficult regeneration and the like, so that the cloning and verification of the function of the DkALDH10 gene are very difficult. According to the method, the persimmon fruit wafer is used as a transformation object, so that the interference of temperature, environment and tissue difference factors is avoided, and a stable genetic transformation strain is constructed.

The experimental process of the instant transformation of the persimmon fruit wafer is as follows:

by adopting Gateway technology, a full-length sequence of DkALDH10 and a 5' end sequence of 150-300BP are respectively introduced into a pDONRTM222 intermediate vector and a pMDC32 expression vector or a pH7GWIWG1 interference vector through BP recombination reaction, and the recombinant plasmid is introduced into the GV3101 agrobacterium tumefaciens by a heat shock method after the accuracy is verified by sequencing.

Wherein, the primers for amplifying the full-length sequence of DkALDH10 are as follows:

F：

5’-GGGGACAACTTTGTACAAAAAAGTTGGAATGGGGAAAGGGCGAGAGAGG-3’；

R：

5’-GGCGGCCGCACAACTTTGTACAAGAAAGTTGGGTAAAGCTTTGGCTTTTCAGGAGA-3’；

the primers used for amplifying the 5' end sequence of 150-300bp are:

F：

5’-GGGGACAACTTTGTACAAAAAAGTTGGATGCTGTTCATCGACGGCGAGT-3’；

R：

5’-GGCGGCCGCACAACTTTGTACAAGAAAGTTGGGTACAGCAAGGTCTGCATAATACT-3’。

the preparation method of the agrobacterium infection solution is the same as the above.

Practical flowing water cleaning of collected 'Ezeki No. 1' persimmon, placing in a sterilization beaker, adding 75% absolute ethyl alcohol for sterilization, then sterilizing with 1% sodium hypochlorite, and finally cleaning with sterile double distilled water; placing sterilized fructus kaki on sterilized dry filter paper, and cutting into slices with thickness of about 0.2cm with sterilized fruit knife; uniformly beating the cut sheets into round sheets by using a sterilized puncher with the diameter of 1.0cm, and placing the round sheets on clean sterilized and dried filter paper; putting the beaten persimmon fruit wafer into the prepared osmotic suspension, and slightly oscillating on an oscillator for a period of time; taking out the infected persimmon fruit wafer, placing the persimmon fruit wafer on dry sterile filter paper to suck dry bacterial liquid on the surface of the wafer, and uniformly placing the persimmon fruit wafer on a culture dish of an MS solid culture medium paved with the filter paper; the plates were incubated at 25 ℃ in the dark for 3 d.

Empty vector and interference vector (pHG-DkALDH10) connected with DkALDH10 gene are respectively taken and transferred into fruit disc No. 1' Eben, and 15 discs are taken every day for analysis. The wafer of 'Ezeki No. 1' is dyed by a DMACA dyeing method, wherein the DMACA dyeing method comprises the following specific steps: the fruit disk is soaked in 30% glacial acetic acid ethanol solution for 12-20h to ensure complete removal of pigments such as anthocyanin and chlorophyll, then rinsed with 75% ethanol for 12h, then rinsed with distilled water for 10s, and finally dyed in 0.6% DMACA solution (6N HCl: methanol ═ 1:1) for 2min, observed and recorded by photography, the deeper the dyeing color indicates higher tannin content. The Folin-Ciocalteu method was used to quantitatively determine the soluble and insoluble tannin content in fruit disks. The measurement results are shown in FIG. 5.

Wherein FIG. 5-A is DMACA staining results, FIG. 5-B is soluble tannin content, and FIG. 5-C is insoluble tannin content. The results show that the interference vector of DkALDH10 gene (pHG-DkALDH10) was significantly lighter in color after staining compared to the control group with empty vector, i.e. the interference vector affected the total tannin content in the fruit disks. According to the quantitative detection result, after the expression of the interference vector pHG-DkALDH10, the content of soluble tannin in the fruit wafer is reduced, and the content of insoluble tannin is increased, which shows that DkALDH10 can inhibit the conversion of soluble tannin to insoluble tannin by decomposing acetaldehyde, and further influences the solidification effect in natural deastringency of Chinese sweet persimmons.

2. Stable genetic transformation by leaf disc method

Cutting leaves from the tissue culture seedlings of the 'Gongcheng water persimmon' with good growth vigor after subculture for one month, cutting the leaves into square leaf blocks with the side length of 1.0cm, putting the cut leaves with the back facing downwards on a callus pre-culture medium filled with filter paper, and culturing in the dark for 3 d; placing the pre-cultured leaves into the activated bacterial liquid, slowly shaking for several minutes, taking out the leaves on sterile filter paper, and removing the excess bacterial liquid on the surfaces of the leaves; placing the leaves on a co-culture medium with filter paper, and co-culturing at 25 deg.C in dark for 3 days; washing the leaves with sterile water containing Cef (400mg/L), washing with sterile water, and drying the water on the surface of the leaves on sterile filter paper; transferring the leaves to a callus induction culture medium, and culturing for 1 month at 25 ℃ in the dark; the callus derived from the leaf was excised, and subcultured to an adventitious bud formation medium under illumination at 25 ℃ to induce adventitious buds. The callus can be maintained for many years in its ability to form adventitious buds by subculture using the same medium.

Respectively constructing and obtaining DkALDH10 overexpression and interference stable expression strains, respectively and quantitatively determining the content of soluble tannin and insoluble tannin in different strains, wherein the detection result is shown in figure 6. Wherein FIG. 6-A is soluble and insoluble tannin content in DkALDH10 overexpression strain, and FIG. 6-B is soluble and insoluble tannin content in DkALDH10 interference expression strain. The results show that after the DkALDH10 is over-expressed, the content of soluble tannin in the plants #20, #21 and #23 is increased, the content of insoluble tannin is reduced, after the DkALDH10 is in interference expression, the content of soluble tannin in the plants #1, #3 and #11 is obviously reduced, and the content of insoluble tannin is obviously increased, and the results also further prove that the DkALDH10 regulates the content of soluble tannin and insoluble tannin of the plants by regulating acetaldehyde metabolism, and further participates in the regulation and control of the astringency removal process. The invention clarifies the relation between the DkALDH10 gene and the natural deastringency of the Chinese sweet persimmon, perfects the molecular control network for natural deastringency of the Chinese sweet persimmon, and provides new scientific basis and gene resources for further genetic improvement.

The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope of the present invention are included in the scope of the present invention.

Claims

1. An acetaldehyde dehydrogenase DkALDH10, wherein the amino acid sequence of the acetaldehyde dehydrogenase DkALDH10 is shown in SEQ ID NO: 1 is shown.

2. The acetaldehyde dehydrogenase DkALDH10 according to claim 1, wherein the acetaldehyde dehydrogenase DkALDH10 is localized in cytoplasmic membranes and vacuoles.

3. A gene encoding the acetaldehyde dehydrogenase DkALDH10 of claim 1, wherein the gene is DkALDH10 gene having a nucleotide sequence set forth in SEQ ID NO:2, respectively.

4. An amplification primer for amplifying the DkALDH10 gene as claimed in claim 3, wherein the nucleotide sequence of the amplification primer is as shown in SEQ ID NO: 3-4.

5. A fluorescent quantitative PCR specific primer for detecting the DkALDH10 gene as claimed in claim 3, wherein the nucleotide sequence of the fluorescent quantitative PCR specific primer is as shown in SEQ ID NO: 5-6.

6. A vector comprising the DkALDH10 gene according to claim 3.

7. The vector of claim 6, wherein the vector is an overexpression vector or an interference expression vector of DkALDH10 gene.

8. A genetically engineered bacterium comprising the vector of claim 6.

9. The DkALDH10 gene according to claim 3, or the vector according to claim 6, or the genetically engineered bacterium according to claim 8, for use in regulating the astringency removal of persimmon.

10. The use of claim 9, wherein the DkALDH10 gene of claim 3, the vector of claim 6, or the genetically engineered bacterium of claim 8 is used to regulate the content of soluble and insoluble tannins, thereby regulating the astringency of persimmon.