CN112877444B - Molecular marker for identifying Changfeng silver carp, identification method and application - Google Patents
Molecular marker for identifying Changfeng silver carp, identification method and application Download PDFInfo
- Publication number
- CN112877444B CN112877444B CN202110143680.2A CN202110143680A CN112877444B CN 112877444 B CN112877444 B CN 112877444B CN 202110143680 A CN202110143680 A CN 202110143680A CN 112877444 B CN112877444 B CN 112877444B
- Authority
- CN
- China
- Prior art keywords
- silver carp
- changfeng
- identifying
- silver
- molecular marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of aquatic organism identification, and particularly relates to a molecular marker for identifying Changfeng silver carp, an identification method and application. The primers for identifying Changfeng silver carp provided by the invention are B22V 21F: TGTCAGCAAGCCGGTAACAC, B22V 21R: GACTTCGAGCTTCTGTACTCCA are provided. The method provided by the invention is simple and easy to implement, convenient to operate and high in identification success rate, and can be used for quickly, efficiently, accurately and massively identifying the Changfeng silver carps.
Description
Technical Field
The invention belongs to the technical field of aquatic organism identification, and particularly relates to a molecular marker for identifying Changfeng silver carp, an identification method and application.
Background
Silver carp (Hypophthalmichthys molitrix) is one of the four unique Chinese fishes and is widely distributed in Yangtze river, Zhujiang river and Heilongjiang river basin in China. The silver carps have the advantages of short food chain, easy feeding, low cost, capability of adjusting water quality and the like, become one of important freshwater aquaculture species in China, stably live the second place of freshwater fish aquaculture yield all the year round, are second to grass carps, and have a great importance in the freshwater aquaculture industry in China. Changfeng silver carp is a new variety cultivated by a comprehensive breeding technology combining artificial gynogenesis, molecular marker assistance and population breeding in Changjiang aquatic product research institute of Chinese aquatic product science, passes the examination of the national original improved breed examination and approval committee in 2010 in a formal way, and is the first artificially cultivated new variety of 'four major fishes' in China (new variety certificate: GS-01-001-. The new variety has the following main excellent economic characters: the growth speed is high and the yield is high. The weight of the second-instar fish is increased by 13.3-17.9% more than that of the common silver carp on average, and the yield per mu is increased by 14-25% on average; the weight of the third-instar fish is increased by 20.47 percent more quickly than that of the common silver carp on average. High and neat shape. High adaptability and high survival rate. The Changfeng silver carp is suitable for being cultivated in controllable fresh water in the whole country, and the cultivation survival rate is improved by more than 10 percent compared with the common silver carp group. High degree of purity and stable hereditary character. By the current popularization to 27 provinces (municipalities) in China, the accumulative popularization of improved fry reaches more than 10 hundred million.
The shape characteristics of the Changfeng silver carp are similar to those of the common silver carp, compared with the common silver carp, the Changfeng silver carp has a wider body, and the shape difference between the Changfeng silver carp and the common silver carp is mainly reflected on the body height and the head. The individual of the Changfeng silver carp and the common silver carp is difficult to be accurately identified only by the shape. Therefore, the invention is particularly necessary to provide a method for identifying the Changfeng silver carp and the common silver carp. The basis of the research of the method is to develop a specific molecular marker of the Changfeng silver carp by genome re-sequencing so as to accurately identify the Changfeng silver carp and the common silver carp. The development of the specific molecular marker of the Changfeng silver carp plays an important role in the cultivation popularization of the Changfeng silver carp in controllable fresh water, the prevention of the mixing of a new variety and the cultivation process of the common silver carp, the formulation of the breeding scheme of the Changfeng silver carp and the effective management of the breeding plan.
Disclosure of Invention
Aiming at the problems in the prior art, the invention provides a molecular marker for identifying Changfeng silver carp, an identification method and application thereof, aiming at solving a part of problems in the prior art or at least relieving a part of problems in the prior art. The method provided by the invention is simple and easy to implement, convenient to operate and high in identification success rate.
The invention is realized in such a way that the molecular marker for identifying Changfeng silver carp has the primer sequence of B22V 21F: TGTCAGCAAGCCGGTAACAC, B22V 21R: GACTTCGAGCTTCTGTACTCCA are provided.
The invention also provides a Changfeng silver carp identification method, which comprises the step of amplifying the DNA of a sample by using the molecular marker, and obtaining a 872bp strip as a Changfeng silver carp sample.
Further, a PCR reaction system for amplifying the sample DNA comprises: 2.5. mu.L of 10 XPCR buffer mix, 0.5. mu.L of each of the upstream and downstream primers, 1. mu.L of the template, 0.5. mu.L of 5U/. mu.L of Taq DNA polymerase, and 20. mu.L of ddH2O。
Further, the PCR reaction procedure for amplifying the sample DNA was pre-denaturation at 95 ℃ for 5min, 35 cycles (denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 40s), extension at 72 ℃ for 10min, and storage at 4 ℃.
Further, after the amplification is finished, 2 μ L of PCR amplification product and 2 μ L of bromophenol blue are mixed uniformly and subjected to electrophoresis detection.
The invention also provides application of the molecular marker for identifying the Changfeng silver carp in identifying the Changfeng silver carp.
The invention also provides application of the method for identifying the Changfeng silver carp in identifying the Changfeng silver carp.
In summary, the advantages and positive effects of the invention are:
1. at present, no specific marker of the Changfeng silver carp is seen for identifying the Changfeng silver carp and the silver carp, and the method is original.
2. The population can be quickly, efficiently, accurately and massively identified.
Drawings
FIG. 1 shows the result of molecular identification electrophoresis of Changfeng silver carp;
FIG. 2 is an amplification electrophoretogram of multiple pairs of primers designed according to the present invention;
FIG. 3 shows the results of B22V21F/B22V21R in 72 Changfeng silver carp and common silver carp groups, respectively.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to examples, and the equipment and reagents used in the examples and test examples are commercially available without specific reference. The specific embodiments described herein are merely illustrative of the invention and are not intended to be limiting.
Various modifications to the precise description of the invention will be readily apparent to those skilled in the art from the information contained herein without departing from the spirit and scope of the appended claims. It is to be understood that the scope of the invention is not limited to the procedures, properties, or components defined, as these embodiments, as well as others described, are intended to be merely illustrative of particular aspects of the invention. Indeed, various modifications of the embodiments of the invention which are obvious to those skilled in the art or related fields are intended to be covered by the scope of the appended claims.
For a better understanding of the invention, and not as a limitation on the scope thereof, all numbers expressing quantities, percentages, and other numerical values used in this application are to be understood as being modified in all instances by the term "about". Accordingly, unless expressly indicated otherwise, the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. In the present invention, "about" means within 10%, preferably within 5% of a given value or range.
The normal temperature in the following embodiments of the present invention refers to a natural room temperature condition in four seasons, and is not subjected to additional cooling or heating treatment, and is generally controlled at 10 to 30 ℃, preferably 15 to 25 ℃.
The invention discloses a molecular marker for identifying Changfeng silver carp, an identification method and application. According to the method, inactivated sperm of the carps is used as an activation source for breeding the Changfeng silver carps, and the carps are infiltrated in the Changfeng silver carps, so that the infiltrated fragments of the carps in the Changfeng silver carps are effectively found out, and the fragments are used for developing molecular markers, so that the accurate identification of the Changfeng silver carps can be realized, and the Changfeng silver carps and the common silver carps can be distinguished. The technical scheme comprises the following steps:
1. 50 DNA of Changfeng silver carp and common silver carp are respectively extracted to carry out second-generation whole genome re-sequencing, and after a sequencing primer and a low-mass sequence are filtered, the data volume is not lower than 10G, and the genome of the silver carp is covered by at least 10 times. Comparing the Reads of each sample of the Changfeng silver carp with a mem module of BWA to a silver carp genome respectively, and taking the unmatched Reads as the specific Reads of the Changfeng silver carp.
2. And (3) comparing the specific Reads of each Changfeng silver carp sample to a carp reference genome (GenBank association access: GCA-004011555.1) by using a mem module of BWA, selecting the Reads with high comparison quality (MAPQ is more than or equal to 30), unique position and expected double-end distance according with the size of a sequencing library, and extracting the compared position on the carp genome. These carp genome fragments may be present in the genome of Changfeng silver carp.
3. The comparison positions of the Changfeng silver carp specificity Reads in the carp genome are respectively extended by 1000bp upwards and downwards to be used as candidate difference regions. The Reads of 50 common silver carps are respectively aligned to the candidate difference regions by using a mem module of BWA. If a candidate region also has at least 1 Reads of an average silver carp individual, the region is considered to be present in the genome of the average silver carp. Further, we removed these areas that existed in chub and normal chub.
For the reserved candidate difference region, a high-reliability site is obtained by further screening, and the requirement of (1) all common silver carp Reads are not compared with the site is met; (2) at least 30 Changfeng silver carp samples Reads are compared with the site.
For the high-reliability sites obtained by screening, DNA sequence information is extracted by utilizing a samtools faidx module to be used for designing primers and amplifying.
4. Specific amplification primers were designed based on the extracted DNA sequence using Primer 5, and the primers were selected based on Primer length, GC content, base distribution, and whether Primer dimer could be formed. The obtained primer is used for PCR amplification of genome DNA of Changfeng silver carp, and then electrophoresis detection of an amplification product is carried out on 1.5-2.0% agarose gel, and sequencing detection is carried out after electrophoresis band gel cutting, recovery and purification.
5. Extracting genome DNA of Changfeng silver carp and common silver carp, and storing in ultra-pure water.
6. The designed primers are used for amplification in chub and chub individuals.
7. The amplification results were detected by electrophoresis on a 1.5% agarose gel.
8. And identifying the Changfeng silver carp and the common silver carp.
In the experimental process, more than 200 pairs of primers are designed, 104 pairs of amplified fragments can be stably obtained from carps, Changfeng silver carps or silver carps (figure 2), the 104 pairs of primers are used for carrying out primary screening on 8 Changfeng silver carps and common silver carps respectively, the screening standard is that the carps and the Changfeng silver carps have fragments without the target fragments, and further the B22V21F/B22V21R primer can amplify stable specific bands in the Changfeng silver carps and has no bands in the common silver carps.
The sequence of the primer obtained by screening is as follows:
B22V21F：TGTCAGCAAGCCGGTAACAC
B22V21R：GACTTCGAGCTTCTGTACTCCA
the primers B22V21F/B22V21R are used for batch verification of 72 Changfeng silver carp populations and common silver carp populations respectively, and the silver carp population with an obvious specific band about 872bp is a Changfeng silver carp individual, and the silver carp population without amplified specific band is a common silver carp individual. The identification results are shown in the figure, and the identification accuracy is 100% (fig. 3). The following table shows the partial primer sequences designed during the experiments of the present application.
Examples
1. Collection of identification samples
The method comprises the steps of collecting fin samples of Changfeng Silver carps and common Silver carps respectively, storing the samples in absolute ethyl alcohol, recording the Changfeng Silver carps and the common Silver carps as Silver carp, and bringing the samples back to a laboratory.
2. Genomic DNA extraction
(1) Taking about 0.5g of fin-shaped tissue, repeatedly washing absolute ethyl alcohol on the surface of the tissue by using ultrapure water, fully shearing the tissue, and then putting the tissue into a 1.5mL centrifuge tube.
(2) Adding 10-15 mu L of proteinase K and 500 mu L of HOM buffer into a centrifuge tube, and digesting for 4-6 h at 55 ℃.
(3) mu.L of 4.5M NaCl solution and 300. mu.L of chloroform were added thereto, and after thoroughly mixing for 20min, the mixture was centrifuged at 13000rpm for 10 min.
(4) The supernatant was transferred to another sterilized new tube, 600. mu.L of anhydrous isopropanol was added, shaken well for 20min, and centrifuged at 13000rpm for 10 min.
(5) The supernatant was discarded, 500. mu.L of 75% ethanol was added, digested at 55 ℃ for 5min, and then centrifuged at 13000rpm for 5 min.
(6) The supernatant was discarded, and the tube was inverted on absorbent paper and naturally dried at room temperature.
(7) The DNA was dissolved in 100. mu.L of sterile double distilled water and left overnight at 4 ℃.
(8) After DNA detection with 1% agarose gel, it was stored at-20 ℃ until use.
3. Amplification of specific fragment of Changfeng silver carp
(1) Primer information
B22V21F：TGTCAGCAAGCCGGTAACAC
B22V21R：GACTTCGAGCTTCTGTACTCCA
(2) PCR reaction system
(3) Procedure for PCR reaction
Pre-denaturation at 95 deg.C for 5min, 35 cycles (denaturation at 95 deg.C for 30s, annealing at 60 deg.C for 30s, and extension at 72 deg.C for 40s), extension at 72 deg.C for 10min, and storage at 4 deg.C.
4. Electrophoresis of Changfeng silver carp specific fragment
After the amplification is finished, 2 mu L of PCR amplification product and 2 mu L of bromophenol blue are uniformly mixed, then the mixture is loaded on 1.5-2.0% agarose gel, DL2000 marker is loaded on the leftmost side, the voltage is 120V, the power supply is turned off after electrophoresis is carried out for 30min, and then the observation of the electrophoresis result is carried out by using a gel imaging system.
5. Identification of Changfeng silver carp and common silver carp
Individual primer sets were determined individually:
(1) the electrophoresis result shows that about 872bp of the silver carp is a Changfeng silver carp individual with an obvious specific strip, and the individual without the amplified specific strip is a common silver carp (figure 1).
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.
Sequence listing
<110> Changjiang aquatic products institute of aquatic science and research in China
CHINESE ACADEMY OF FISHERY SCIENCES
<120> molecular marker for identifying Changfeng silver carp, identification method and application
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> B22V21F
<400> 1
tgtcagcaag ccggtaacac 20
<210> 2
<211> 22
<212> DNA
<213> B22V21R
<400> 2
gacttcgagc ttctgtactc ca 22
<210> 3
<211> 872
<212> DNA
<213> Sequence
<400> 3
tgtcagcaag ccggtaacac tgtctgtgga cacaagctca gaagggattg gagcggtgat 60
cttgcaagaa gaaaggccag tggtgtatgg ttccagagcc ctgagtgact gtcagcacag 120
atatgcacaa atagagaaag aaatgctcgc catagtatat ggctgtgaga agttccacca 180
gtatgtatgg tggccgggaa gtgcaaaaca acattacaaa gtgtgaaaca cttttaacga 240
agcctttccg gaaaagggaa caaatttaca ttttggaaaa catttttacc tatcataaaa 300
cacaatttac atgggaaaaa cacttttacc aaggacgaaa caaatttaca ttttagaaaa 360
caaatgaaca agacgcaaaa cacttttacc agtcccgaaa caaatttaca atgacagatt 420
cttcatggaa agggaatgta ccacacaccg gaagtgacgc ggtgacaggt gttgttgttg 480
gtgagcgtgg taaattcgtg ttgtggttgt ggagtaaatg gcgtaaataa agtagccgag 540
ggatgttttg cggcaaacac atgagcagct taacgcggtt ttgctttatg tgtgtggtcg 600
gtgtttggag tttctaagga cgcggaccag acggaaacac aggggacgtc tcgacagccg 660
gacagtgcta agcaaagtaa gttgttattt gttatttttt agtgtagcaa aacgctagct 720
atctgaggcc atgtgaataa aaatcagtaa tgctgataat gatttttttg agtggcttat 780
aactttctgt tttgaaacgg aactctgtcc atttcagcag aacaaccatg cccatcatac 840
aaacagttca tggagtacag aagctcgaag tc 872
Claims (7)
1. A molecular marker for identifying Changfeng silver carp is characterized in that the sequence of the molecular marker is shown in SEQ ID NO. 3; the sequence of the molecular marker primer is B22V 21F: TGTCAGCAAGCCGGTAACAC, B22V 21R: GACTTCGAGCTTCTGTACTCCA are provided.
2. An identification method for distinguishing Changfeng silver carp from common silver carp, characterized in that it comprises the steps of amplifying the DNA of sample by using the primer of molecular marker as claimed in claim 1, and obtaining the sample with 872bp band.
3. The identification method for distinguishing Changfeng silver carp from common silver carp as claimed in claim 2The method is characterized in that a PCR reaction system for amplifying the sample DNA comprises: 2.5. mu.L of 10 XPCR buffer mix, 0.5. mu.L of each of the upstream and downstream primers, 1. mu.L of the template, 0.5. mu.L of 5U/. mu.L of Taq DNA polymerase, and 20. mu.L of ddH2O。
4. The identification method for distinguishing Changfeng silver carp from common silver carp as claimed in claim 2, characterized in that the PCR reaction program for amplifying the sample DNA is pre-denaturation at 95 ℃ for 5 min; 35 cycles, the cycle program comprises denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s and extension at 72 ℃ for 40 s; extending for 10min at 72 ℃, and storing at 4 ℃.
5. The identification method for distinguishing Changfeng silver carp from common silver carp as claimed in claim 2, wherein after the amplification is finished, 2 μ L of PCR amplification product and 2 μ L of bromophenol blue are mixed uniformly and subjected to electrophoresis detection.
6. The use of the molecular marker for identifying Changfeng silver carp as claimed in claim 1 in identifying Changfeng silver carp.
7. Use of the method for identifying silver carp from chub according to any one of claims 2 to 5 for identifying silver carp from chub.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110143680.2A CN112877444B (en) | 2021-02-02 | 2021-02-02 | Molecular marker for identifying Changfeng silver carp, identification method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110143680.2A CN112877444B (en) | 2021-02-02 | 2021-02-02 | Molecular marker for identifying Changfeng silver carp, identification method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112877444A CN112877444A (en) | 2021-06-01 |
| CN112877444B true CN112877444B (en) | 2021-10-26 |
Family
ID=76055750
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110143680.2A Active CN112877444B (en) | 2021-02-02 | 2021-02-02 | Molecular marker for identifying Changfeng silver carp, identification method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112877444B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116769927B (en) * | 2023-06-20 | 2024-01-02 | 中国水产科学研究院长江水产研究所 | Introgression gene, primer, method and application for identifying silver carp in Changfeng |
| CN116949135A (en) * | 2023-06-20 | 2023-10-27 | 中国水产科学研究院长江水产研究所 | Identification method of Changfeng silver carp introgression gene and application thereof |
| CN117165695A (en) * | 2023-09-12 | 2023-12-05 | 中国水产科学研究院长江水产研究所 | Introgression gene, primer, method and application for identifying Changfeng silver carp |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112725465A (en) * | 2021-02-02 | 2021-04-30 | 中国水产科学研究院长江水产研究所 | Precise Changfeng silver carp identification primer, identification method and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104450881A (en) * | 2014-10-22 | 2015-03-25 | 甘肃农业大学 | Six common fish identification kits based on DNA Barcoding |
| CN104450921B (en) * | 2014-12-12 | 2016-06-22 | 中国水产科学研究院长江水产研究所 | A kind of method of accurate identification Changfeng crucian carp |
| US20200115765A1 (en) * | 2018-10-11 | 2020-04-16 | The United States of America, as represented by the Secretary of the Department of the Interior | In situ detection of multiple predominant species of asian carp |
-
2021
- 2021-02-02 CN CN202110143680.2A patent/CN112877444B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112725465A (en) * | 2021-02-02 | 2021-04-30 | 中国水产科学研究院长江水产研究所 | Precise Changfeng silver carp identification primer, identification method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112877444A (en) | 2021-06-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112877444B (en) | Molecular marker for identifying Changfeng silver carp, identification method and application | |
| CN112725465B (en) | Precise Changfeng silver carp identification primer, identification method and application thereof | |
| CN102134593B (en) | Gender-specific microsatellite marker for Cynoglossus semilaevis and application of same in identification of superfemale Cynoglossus semilaevis | |
| CN111088370B (en) | Sex-specific molecular marker primer for Trachinotus ovatus, identification method and application of sex-specific molecular marker primer | |
| CN109680076B (en) | Molecular marker and method for identifying genetic sex of Chinese softshell turtles | |
| CN112609009B (en) | SNP molecular marker combination related to weight and body size of Guangxi three-yellow chicken based on whole genome sequencing screening and application | |
| KR101804120B1 (en) | Complete sequencing of chloroplast genome and nrDNA of Aloe vera, Aloe saponaria and Aloe Saengjang-derived barcoding marker, DNA primer set for discrimination of origin and species and uses thereof | |
| JP2021061826A (en) | Combination of female scallop-specific molecule markers and application thereof | |
| Abe et al. | Identification of the female-determining region of the W chromosome in Bombyx mori | |
| CN114657264B (en) | Clarias fuscus sex-specific molecular marker primer and application thereof | |
| CN105112417B (en) | A kind of method and specific amplification primer thereof applying plastosome CO I sequence fragment discriminating donkey hide and mixed adulterant | |
| CN110331217B (en) | Microsatellite marker paternity test primer suitable for Nile tilapia, Oreochromis aureus and hybrid thereof, method and application | |
| CN109554483B (en) | Method for rapidly detecting common cattle and tumor cattle by utilizing Y chromosome molecular marker | |
| CN117004701B (en) | Molecular marker for sex identification of apostichopus japonicus and application | |
| CN110564867B (en) | SNP molecular marker of Qinchuan cattle CFL1 gene and detection method thereof | |
| CN111057771B (en) | SNP molecular marker for distinguishing 'Zhongyang No. 1' from common fugu obscurus and application thereof | |
| CN109182539A (en) | A kind of detection method and its application of ox IGF1R gene insertion/deletion | |
| CN110157818B (en) | Molecular marker related to high-yield characteristics of porcine eye muscles and application thereof | |
| CN111996261A (en) | Macrobrachium rosenbergii sex molecular marker primer and application thereof | |
| CN111979336A (en) | Specific primer and method for identifying fugu obscurus, fugu rubripes and hybrid fugu rubripes | |
| CN110541035A (en) | Sinocyclocheilus sinensis DNA barcode sequence and application thereof | |
| CN113862379B (en) | Leiocassis longirostris male sex specific molecular marker, amplification primer thereof and genetic sex identification method | |
| CN111631174B (en) | Breeding method of Cyprinus carpiod | |
| CN102134600B (en) | PCR (Polymerase Chain Reaction) method for sex appraisal of Nipponia nippon | |
| CN103695416A (en) | Mononucleotide polymorphism detection method of Qinchuan cattle CFL2 gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |