CN109182539A - A kind of detection method and its application of ox IGF1R gene insertion/deletion - Google Patents
A kind of detection method and its application of ox IGF1R gene insertion/deletion Download PDFInfo
- Publication number
- CN109182539A CN109182539A CN201811173459.6A CN201811173459A CN109182539A CN 109182539 A CN109182539 A CN 109182539A CN 201811173459 A CN201811173459 A CN 201811173459A CN 109182539 A CN109182539 A CN 109182539A
- Authority
- CN
- China
- Prior art keywords
- deletion
- igf1r gene
- igf1r
- gene
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the detection methods and its application of a kind of ox IGF1R gene insertion/deletion.Using the complete genome DNA to be measured comprising IGF1R gene as template, using the primer pair P1 referring to the design of ox full-length genome as primer, IGF1R gene is expanded by round pcr, agarose gel electrophoresis is carried out again, and identifying IGF1R gene according to electrophoresis result, there are different genotype in the site AC_000178.1:g 8086630-8086657.As a result, it has been found that, there are significant related between the growth traits such as the different type of IGF1R gene 28-bp insertion/deletion and Jin Nanniu Body steep length, bust and weight, the different type of IGF1R gene 28-bp insertion/deletion is prompted to can be used as the DNA marker for improving ox Growth Traits.The present invention is conducive to quickly establish the excellent ox genetic resources group of Growth Traits.
Description
Technical field
The invention belongs to modern biotechnologies and cattle breeding field, are related to the detection of gene insertion/deletion (indel),
In particular to a kind of method for detecting ox IGF1R gene 28-bp insertion/deletion loci gene type.
Background technique
Animal breeding technology mainly includes traditional breeding techniques based on phenotype and phenotypic number and polymorphic for base with DNA
The molecular breeding technology of plinth.As the important component of molecular breeding technology system, molecular marker assisted selection (marker-
As sisted selection, MAS) breeding technique detects the DNA polymorphism of important gene first, then analyze DNA it is polymorphic with
Correlation between inhereditary feature finally carries out character determination further according to the significant relevant DNA marker of inhereditary feature.As existing
For the new technology to arise in Protocols in Molecular Biology development process, MAS breeding technique overcome phenotypic evaluation difficulty, morning
Phase selection carries out harmless Character Evaluation and selection and improves back cross breeding efficiency etc. with superiority.
In MAS breeding technique system, critical function gene, screening important gene hereditary variation site are found, and analyze
The correlation of critical function gene genetic variant sites and growth performance is the premise and key of its application.Insertion/deletion
(indel) be molecular genetic marker one of important way.Indel refers to the insertion or missing of nucleotide fragments on DNA sequence dna
And cause the change of DNA sequence dna, cause the diversity of DNA sequence between species including humans.Insertion or missing
Fragment length may include small CNV between 1-50bp, can preferably be explained using indel analysis genes of individuals group a
The phenotypic difference of body, therefore indel is carried out to the difference of small fragment nucleotide from DNA level and is detected in Animal molecular breeding
It is of great significance in MAS system.
Insertion/deletion (indel) is that the evolution that occurrence frequency is only second to residue replacement in DNA or protein sequence level changes
Become, is roughly divided into following 5 major class: (1) insertion/deletion of single base pair；(2) insertion/deletion of single base；(3) it repeats single
Member is more base-pair insertion/deletions of 2~15 bases；(4) transposons insertion/deletion；(5) insertion/deletion of any DNA sequence
Polymorphism.With the further investigation of comparative genomics, indel is provided largely for theoretical research and genetic breeding application study
Biological information, as the science of heredity identification marking of a new generation, the advantages of having both SNP, is derived from single prominent compared with SNP
Change event is relatively stable.Belong to two polymorphic alleles in structure, allele is all fixed and it is known that can lead to
The amplicon for crossing very little is expanded (< 50bp), improves the success rate of amplification height degradation of dna.As a kind of important something lost
Label is passed, the research of indel focuses on molecular biology and field of biomedicine earliest.It is dispersed throughout the indel of whole gene group
Frequency is only second to SNP, occupies second, wherein about one third is located in known gene region, is located at decision base there are also some
Because of the critical region of function, such as promoter region and exon 1.
Indel is widely present in the genome of various biologies, currently, focusing mostly on the research of indel in the mankind and each
In the genome of kind crops.2006, first man genoid group indel map was created by Mills et al., was had in the map
The site indel of specificity more than 410,000, Mills in 2011 had found in human genome again length from 1bp to
Equal nearly 2,000,000 indel label, most of length do not concentrate within 100bp 10000bp.To the research of indel in livestock and poultry
On then concentrate on chicken, on ruminant research and application it is very few.Schnabel in 2005 et al. combine SSR marker and
Indel label studies control milk production of cow, is successfully made finely positioning.The site indel is by homologous sequence
Column compare analysis and obtain, but biological species known to sequence are limited, are mostly mode species or industrial crops, for non-mode life
For object, lots of genes group sequence is unknown, and leading to indel design of primers and exploitation, there are certain difficulty.
With economic development and continuous improvement of people's living standards, demand of the society to ox product is constantly reinforced, but
Due to the products critical shortage such as beef, milk in recent years, thus ox breeding expert expectation earlier, more preferably, quickly obtain it is yellow
The excellent variety of dairy products.On high yield, high-quality and efficient ox breeding objective, ox breeding expert pays close attention to always growth hair
Fertility shape.Screening and detection and the closely related DNA marker of ox Growth Traits, then carry out first on DNA level
The detection of gene pleiomorphism carries out the association analysis of gene pleiomorphism and Growth Traits, last basis and the significant phase of character
The indel label of pass carries out the selection of character advantage individual.
Insulin-like growth factor I receptor (insulin-like growth factor-I receptor, IGF1R)
It is the effector that insulin-like growth factor (insulin-like growthfactors, IGFs) plays biological effect, it
The half-life period of adjustable IGFs and activity, very necessary to embryonic period, embryonic phase and the postnatal growth of individual, it is in immunological regulation, leaching
Bar generation of cell, the growth of muscle and bone play very important effect.The variation for disclosing IGF1R gene at present will affect
The physiological function of IGF1R results even in being obstructed, generating tumour and some other disease for growth.As influence growth and divide
The research of the important factor of change, IGF1R gene has been reported that in the species such as people, mouse, but the report on ox is less.
Summary of the invention
The purpose of the present invention is to provide the detection methods and its application of a kind of ox IGF1R gene insertion/deletion, thus
Accelerate ox fine-variety breeding speed.
In order to achieve the above objectives, the invention adopts the following technical scheme:
A kind of detection method of ox IGF1R gene insertion/deletion, with ox to be measured (for example, Jin Nanniu) full-length genome
DNA is template, using primer pair P1 as primer, passes through PCR amplification ox IGF1R Gene Partial segment；PCR amplification is obtained again
Segment carries out agarose gel electrophoresis；Ox IGF1R gene 28-bp insertion/deletion is identified according to agarose gel electrophoresis results
Polymorphic site (IGF1R gene reference sequence AC_000178.1:g 8086630-8086657del
The site TGTCCTGGGGCACGTGGTCTCGGCCCTC) genotype；The primer pair P1 are as follows:
Upstream primer: 5 '-CGAAGTGGGACTTGAGGC-3 '；
Downstream primer: 5 '-AGACAACTGGGAGAAGGGAC-3 '.
The response procedures of the PCR amplification are as follows:
1) 95 DEG C of initial denaturation 5min, subsequently into step 2)；
2) one: 95 DEG C of denaturation 30s, 68 DEG C of renaturation 30s, 72 DEG C of extension 30s are recycled；Totally 18 circulations, after recycling for the first time,
Renaturation temperature gradually reduces by 1 DEG C, subsequently into step 3)；
3) two: 95 DEG C of denaturation 30s, 58~60 DEG C of renaturation 30s, 72 DEG C of extension 30s are recycled；Totally 20 circulations, subsequently into
Step 4)；
4) 72 DEG C of extension 10min.
The mass concentration for the Ago-Gel that the agarose gel electrophoresis uses is 2.5%.
In the genotype in the insertion/deletion site, insertion/insertion genotype electrophoresis result is shown as
Mono- band line of 405bp；Insertion/deletion genotypic expression is two band line of 405bp and 377bp；Missing/deletion Genotype is shown as
Mono- band line of 377bp.
A kind of detection kit of ox IGF1R gene insertion/deletion, the kit include above-mentioned yellow for PCR amplification
The primer pair P1 of Partial Fragment containing 28-bp insertion/deletion site in ox IGF1R gene.
The detection method of above-mentioned ox IGF1R gene insertion/deletion is in ox molecular marker assisted selection breeding
Using.
The insertion in the insertion/deletion site/insertion genotype (II) can be used as Jin Nanniu Body steep length, bust and
The DNA marker of weight.
The beneficial effects of the present invention are embodied in:
The present invention is according to the primers of IGF1R gene, respectively using the genomic DNA of 2 kinds of yellow cattle breeds as template,
PCR amplification is carried out, and agarose gel electrophoresis is carried out to PCR product, the insertion of the IGF1R gene of ox/lack is obtained after electrophoresis
Lose polymorphic site (AC_000178.1:g 8086630-8086657del TGTCCTGGGGCACGTGGTCTCGGCCCTC
Point) genotype.Detection and gene are carried out by the genotype in the above-mentioned insertion/deletion site to 2 yellow cattle breeds
Frequency analysis, and it is associated analysis with ox some growth character (for example, body is high, Body steep length, bust, weight etc.), as a result
Show that the site can be as raising ox (for example, Jin Nanniu) Body steep length (P=0.008), bust (P=0.033) and weight
(P=0.007) molecular labeling.In conjunction with the above experimental result, the present invention provides be directed to above-mentioned insertion/deletion site
Detection method, identified again through agarose gel electrophoresis after PCR amplification by the primer of design, can it is simple, quick, low at
Originally, the polymorphism of its insertion/deletion is accurately detected, to provide foundation for ox fine-variety breeding, is conducive to quickly establish life
The excellent ox genetic resources group of long development character accelerates fine-variety breeding speed.
Detailed description of the invention
Fig. 1 is ox IGF1R gene 28-bp insertion/deletion (indel) polymorphic site (AC_000178.1:g
The site 8086630-8086657del TGTCCTGGGGCACGTGGTCTCGGCCCTC) PCR product electrophoresis result；Wherein, M
For Marker I.
Fig. 2 is the ox IGF1R gene 8086630-8086657 PCR product sequencer maps for showing insertion/deletion.
Specific embodiment
The present invention is described in detail with reference to the accompanying drawings and examples, the embodiment be explanation of the invention and
It is not to limit.
The present invention is using PCR amplification method to ox IGF1R gene in AC_000178.1:g 8086630-8086657d
The issuable insertion/deletion of elTGTCCTGGGGCACGTGGTCTCGGCCCTC site mutation is detected, and will
It is associated analysis with growth traits, and the result that the verified insertion/deletion to the site is detected can be used
In ox molecular marker assisted selection breeding, to accelerate ox fine-variety breeding speed.
(1) experimental drug and reagent
1. biochemical reagents and biological reagent: 1. Taq archaeal dna polymerase (being purchased from Fermantas, that is, MBI company)；2. albumen
Enzyme K (being purchased from Huamei Bio-Engrg Co.) is 3.；Marker I (is purchased from TIANGEN Biotech (Beijing) Co., Ltd.).
2. general reagent: general reagent is bought from Huamei Bio-Engrg Co., is import packing product: Tris, EDTA,
NaCl、NaOH、KCl、Na2HPO4、KH2PO4, Tris saturated phenol, chloroform, isoamyl alcohol, dehydrated alcohol, sodium acetate, dodecyl sulphur
Sour sodium (SDS), ethidium bromide (EB), bromophenol blue, dimethyl benzene cyanogen FF, acetic acid, sucrose, boric acid, agarose etc..
3. solution and buffer: all solution and buffer are all made of the preparation of deionization ultrapure water.Autoclave conditions are
15bf/in(1.034×105Pa), 25min.Preparation method refers to " Molecular Cloning:A Laboratory guide " that Sambrook etc. writes.
1) it extracts solution used in tissue sample DNA: other than public solution when extracting genome DNA, also preparing following examination
Agent: 1. 2mol/L NaCl:11.688g NaCl is dissolved in water, is settled to 100mL, high pressure sterilization.2. tissue DNA extracting solution
(100mL): l mol/L Tris-Cl (pH 8.0) l mL, 0.5mol/L EDTA (pH 8.0) 20mL and 2mol/L NaCl
5mL is settled to 100mL.
2) solution used in agarose electrophoretic analysis: 1. 1 × tbe buffer liquid: 10 × TBE 100mL is taken to be settled to 1000mL.
2. sample-loading buffer: the aqueous solution containing 0.25% bromophenol blue, 0.25% dimethylbenzene blueness FF and 40.0% (w/v) sucrose.
(2) design of ox IGF1R gene PCR primer
The reference sequences of ox IGF1R gene are retrieved on NCBI, and can be expanded using the design of Primer Premier 5.0
Increasing includes the ox IGF1R gene intron 2 region site 28-bp indel (AC_000178.1:g 8086630-
The site 8086657del TGTCCTGGGGCACGTGGTCTCGGCCCTC) PCR primer to P1, the following (primer of primer sequence
The design deadline is in November, 2016):
Upstream primer: 5 '-CGAAGTGGGACTTGAGGC-3 '；
Downstream primer: 5 '-AGACAACTGGGAGAAGGGAC-3 '.
Above-mentioned primer pair P1 can expand comprising ox IGF1R gene in AC_000178.1 ox genome amplification:
The different gene matrix of the indel in the site g8086630-8086657del TGTCCTGGGGCACGTGGTCTCGGCCCTC
Section.Theoretically, when the TGTCCTGGGGCACGTGGTCTCGGCCCTC missing between 8086630 and 8086657nt, PCR is produced
Object is a band line of 377bp size after agarose gel electrophoresis detection；Between 8086630 and 8086657nt
When TGTCCTGGGGCACGTGGTCTCGGCCCTC is inserted into, PCR product is 405bp size after agarose gel electrophoresis detection
A band line.
(3) the IGF1R genetic fragment of PCR amplification ox to be measured
1, the acquisition of ox sample
Experiment animal used is that 2 Breeds of Yellow Cattle amount to 303 samples, in which:
1) totally 173 parts of Jin Nanniu (JN) sample, picks up from Yuncheng conservation field.Ox is taken using stochastical sampling mode
The ear tissue sample of individual, sample saves with 70% ethyl alcohol, and ice chest low temperature, which takes back laboratory and is placed on -80 DEG C, to be frozen.
2) totally 130 parts of Xia Nanniu (XN) sample picks up from Miyang County bureau of animal husbandry of Zhumadian prefecture, Henan province city Xia Nanniu breeding field.It adopts
The ear tissue sample of cattle farm individual is taken with stochastical sampling mode, sample is saved with 70% ethyl alcohol, and ice chest low temperature takes back laboratory
- 80 DEG C are placed on to freeze.
The acquisition of 1. ox sample of table
2, the extraction of tissue sample genomic DNA with separate
1) about 10mg ear tissue sample is taken, is put in the centrifuge tube of 1.5mL, is shredded as far as possible with small scissors.
2) 600 μ L tissue DNA extracting solutions, 10%SDS to SDS final concentration of 1% and Proteinase K is added to final concentration of
100 μ g/mL, 55 DEG C of digestion overnight, guarantee that tissue sample is relatively evenly distributed in tissue DNA extracting solution.
3) solution after digestion is cooled to room temperature, isometric Tris saturated phenol is added, covers tightly pipe lid, slowly runs back and forth
Centrifuge tube, at least persistently 10min or more, 12000r/min are centrifuged 15min.
4) supernatant is taken, isometric phenol is added: chloroform (1:1) covers tightly pipe lid, centrifuge tube is slowly overturned back and forth, until
Continue 10min or more less, 12000r/min is centrifuged 15min.
5) supernatant is taken, isometric chloroform is added: isoamyl alcohol (24:1) covers tightly pipe lid, slowly overturns centrifugation back and forth
Pipe, at least persistently 10min or more, 12000r/min are centrifuged 15min.
6) supernatant is taken, the ice-cold dehydrated alcohol of 2 times of volumes and the 3mol/L sodium acetate of 1/10 volume is added, covers tightly pipe
Lid slowly overturns centrifuge tube back and forth, until liquid is limpid, white flock DNA occurs.
7) choose DNA, in the centrifuge tube for putting a 1.5mL into, 500 μ L, 70% ethyl alcohol is added, covers tightly pipe lid, slowly
Centrifuge tube is overturned back and forth, and then 12000r/min is centrifuged 3~5min, carefully outwells ethyl alcohol, pipe is inverted on blotting paper.
8) 500 μ L, 70% ethyl alcohol is added into centrifuge tube again, covers tightly pipe lid, slowly overturns centrifuge tube back and forth, so
12000r/min is centrifuged 3~5min afterwards, carefully outwells ethyl alcohol, pipe is inverted on blotting paper.
9) after to be dried, 60 μ L sterilizing ultrapure water is added, to make it completely dissolved, 4 DEG C are saved overnight, to be detected.
3, agarose gel electrophoresis detects DNA
1) gel electrophoresis trough washery is clean, both ends are sealed with adhesive tape, plug comb.
2) agarose for weighing 2g, is transferred in triangular flask, and 1 × TBE 80mL, which is added, makes its suspension, and microwave ingle heats,
It is taken out for 2 times wait boil, the nucleic acid dye of final concentration of 0.5 μ g/mL is added when it is cooled to non-scald on hand.Then quickly by agar
Sugar juice imports, and gentle agitation prevents bubble.
3) after mixing (about 60 DEG C), immediately by agarose solution to entering in slot.Such as there is bubble, is moved immediately with pipettor
Out.
4) completely after cooled and solidified (about 25~40min), comb is pulled out, both ends adhesive tape is removed, gel is moved into electrophoresis
In slot.
5) 1 × tbe buffer liquid is added into electrophoresis tank, liquid level is made to be higher by 2~5mm of glue surface.
6) 2~4 μ L of DNA sample is taken, is mixed after adding 2 μ L sample-loading buffers, unified loading, and DNA Marker is added in one
Side.
7) 120V electrophoresis 45min.
8) it is observed on uv analyzer, if there is RNA then needs to purify, if there is obvious degradation, phase need to be extracted again
Answer the DNA of sample.
4, the purifying of DNA
1) 10%SDS to SDS final concentration of 0.1% is added in the DNA solution of 500 μ L, Proteinase K to final concentration is added and reaches
To 100 μ g/mL.
2) 55 DEG C of heat preservation 10h or so.
3) isometric phenol: chloroform: isoamyl alcohol (25:24:1) and chloroform extract once respectively；Wherein, using 12000r/
Min is centrifuged 5min split-phase, draws upper strata aqueous phase into another centrifuge tube.
5) 1/10 volume 3mol/L sodium acetate is added and 2 times of volumes ice cold dehydrated alcohols precipitate DNA.
6) liquid is outwelled, 60 μ L sterilizing ultrapure water dissolution is added in airing after 70% ethanol washing, and 4 DEG C to be detected.
5, spectrophotometry DNA
With OD value of the ultraviolet light photometric determination DNA sample at 260nm, 280nm.Calculate DNA content and OD260/OD280
Ratio.Such as OD260/OD280Ratio illustrates then be purified containing more protein or phenol less than 1.6；If ratio is big
In 1.8, then should consider to remove RNA purifying.
DNA concentration (ng/ μ L)=50 × OD260Value × extension rate
After DNA is detected, takes out a certain amount and be diluted to 50ng/ μ L, be stored in -20 DEG C spare (template DNA), remaining
Deposit in -80 DEG C.
6, PCR amplification
PCR reaction system is using mixing sample-adding method, the i.e. quantity of various components and 1 according to needed for each reaction system
The number of the reaction of PCR needed for secondary response, calculates the total amount of various reactive components, is added in 1 1.5mL centrifuge tube, sufficiently
Brief centrifugation after mixing, then be dispensed into each 0.2mL Eppendorf PCR pipe, template DNA, then brief centrifugation is then added
After carry out PCR amplification；PCR reaction system includes 2 × Taq PCR SuperMix (including Taq archaeal dna polymerase, dNTPs and anti-
Buffer is answered, concentration is 2 ×) 5 μ L；0.5 μ L of upstream primer；(upstream and downstream primer concentration is 10pmol/ μ to 0.5 μ L of downstream primer
L)；Genomic DNA (concentration is 50ng/ μ L ox genomic DNA) 1.0 μ L；3 μ L of deionized water；PCR reaction system amounts to 10 μ
L。
7, the program of PCR reaction
Pcr amplification reaction program are as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 68 DEG C of renaturation 30s, 72 DEG C of extension 30s,
18 circulations, wherein renaturation temperature reduces by 1 DEG C in each circulation in rear 17 circulations；95 DEG C of denaturation 30s, 60 DEG C of renaturation 30s,
72 DEG C of extension 30s, after 20 recycle；72 DEG C of extension 10min, 10 DEG C of preservation amplified productions.
(4) the agarose gel electrophoresis analysis of pcr amplification product
1) 2.5% Ago-Gel is made, electrophoresis 45min under 120V voltage after point sample；
2) when the different DNA fragmentation of molecular weight is separated clearly, in 2000 gel imaging system of BIO-RAD Gel Doc
Imaging；
3) according to agarose gel electrophoresis imaging analysis indel polymorphism
With 2000 gel imaging system PHOTOGRAPHIC ANALYSIS of BIO-RAD Gel Doc, the polymorphic of insertion/deletion (indel) is judged
Property.Referring to Fig. 1, Fig. 2, the IGF1R gene of ox genome is in AC_000178.1:g 8086630-8086657delTGTCCT
The agarose gel electrophoresis results of the polymorphism of the insertion/deletion (indel) in the site GGGGCACGTGGTCTCGGCCCTC are as follows: insert
Enter/deletion Genotype (ID) shows as two band line of 405bp and 377bp, insertion/insertion genotype (II) shows as 405bp mono-
Band line, missing/deletion Genotype (DD) show as mono- band line of 377bp.
(5) the frequency statistics analysis in the site ox IGF1R gene indel
1) gene and genotype frequency
Genotype frequency refers to that certain genotype individuals number of a certain character in a group accounts for the ratio of total individual number.Meter
The formula of calculation can be write as:
PTT=NTT/N
Wherein PTTRepresent the TT genotype frequency in a certain site；NTTIndicate the number of individuals in group with TT genotype；N
For the individual total quantity for detecting group.
Gene frequency refers to that a certain gene number is to the relative ratios of its allele sum in a group.The formula of calculating
It can be write as:
PT=(2NTT+NTa1+NTa2+NTa3+NTa4+……+NTan)/2N
Wherein, PTIndicate allele T frequency, NTTIndicate the individual amount in group with TT genotype, NTaiIndicate group
There are Tai genotype individuals quantity, the n mutually different multiple alleles that a1~an is allele T in body.
Different yellow cattle breed IGF1R gene 28-bp insertion/deletion (indel) sites (AC_000178.1:
The site g8086630-8086657del TGTCCTGGGGCACGTGGTCTCGGCCCTC) in genotype frequency and allele
Frequency is as shown in table 2, and population genetic parameters are as shown in table 3.The frequency of the allele " I " of Jin Nanniu, Xia Nanniu is respectively
0.699 and 0.765, the frequency of corresponding allele " D " is 0.301 and 0.235, and the frequency of allele " I " and " D " are big
In 1%, therefore to be stabilized insertion/deletion (indel) type.
2. ox IGF1R gene indel locus gene frequency distribution of table
3. site ox IGF1R gene indel population genetic parameters of table
(6) association analysis of ox IGF1R gene indel locus gene effect
Genotype data: the genotype that agarose gel electrophoresis identifies after PCR amplification.
Creation data: the body measurement traits data such as Jin Nanniu and Xia Nanniu body height, hip cross height, Body steep length, bust, weight.
Relation analysis model: kind difference factor and growth traits correlation are analyzed using SPSS (23.0) software.It is first
Statistical analysis that first will be descriptive to the data obtained, to determine whether there is outlier.Then it according to the characteristic of data, utilizes
The effect of genotype is analyzed in variance analysis, multivariate linear model or t analysis in turn.During data processing, foundation
Influence the difference of the factor of growth and development, it is contemplated that individual effect, the effect of interaction and genotype between gene use
Fixed model carries out correlation analysis.In addition, being accepted or rejected according to physical condition, complete model is as follows:
Yijk=μ+Indelj+eijk,
Wherein: YijkFor character observation value, μ is population mean, IndeljFor the fixed effect of j-th of insertion and deletion type,
eijkFor random error.Otherness between each group of data is tested using LSD Multiple range test, and test result is with Mean ± SE shape
Formula indicates.
The result shows that: the distribution of the above ox IGF1R gene different genotype frequency and gene frequency is to ox
There were significant differences for the influence of a little growth traits (such as Body steep length, bust and weight).It is specific as follows:
Referring to table 4, in the research to 173 Shanxi south cows body, the 28-bp insertion/deletion pair of IGF1R gene
Body steep length (P=0.008), bust (P=0.033) and the weight (P=0.007) of Jin Nanniu has a significant impact (P < 0.05).
And the individual of genotype II is noticeably greater than the individual of genotype DD and ID on Body steep length, bust and weight character, therefore,
The genotype II in the site IGF1R gene 28-bp insertion/deletion (indel) is the molecular labeling of Jin Nanniu growth and development, Ke Yiyong
In the breeding of excellent ox.
Influence of the table 4.IGF1R gene indel polymorphism to Jin Nanniu growth traits
Note: colleague is the different expression significant difference of data institute marking-up parent phase (a, b:P < 0.05) or extremely significant (A, B:P < 0.01).
<110>Xibei Univ. of Agricultural & Forest Science & Technology
<120>a kind of detection method and its application of ox IGF1R gene insertion/deletion
<160> 3
<210> 1
<211> 18
<212> DNA
<213>artificial synthesized
<400> 1
cgaagtggga cttgaggc 18
<210> 2
<211> 18
<212> DNA
<213>artificial synthesized
<400> 2
agacaactgg gagaagggac 20
<210> 3
<211> 28
<212> DNA
<213> AC_000178.1:g 8086630-8086657 del
<400> 3
tgtcctgggg cacgtggtct cggccctc 28
Claims (7)
1. a kind of detection method of ox IGF1R gene insertion/deletion, it is characterised in that: the following steps are included:
Using ox genomic DNA to be measured as template, using primer pair P1 as primer, pass through PCR amplification ox IGF1R Gene Partial piece
Section；Agarose gel electrophoresis is carried out to the segment that PCR amplification obtains again；Ox is identified according to agarose gel electrophoresis results
The genotype in IGF1R gene 28-bp insertion/deletion site；
The primer pair P1 are as follows:
Upstream primer: 5 '-CGAAGTGGGACTTGAGGC-3 '；
Downstream primer: 5 '-AGACAACTGGGAGAAGGGAC-3 '.
2. a kind of detection method of ox IGF1R gene insertion/deletion according to claim 1, it is characterised in that: described
The response procedures of PCR amplification are as follows:
1) 95 DEG C of initial denaturation 5min, subsequently into step 2)；
2) one: 95 DEG C of denaturation 30s, 68 DEG C of renaturation 30s, 72 DEG C of extension 30s are recycled；Totally 18 circulations, after recycling for the first time, renaturation
Temperature gradually reduces by 1 DEG C, subsequently into step 3)；
3) two: 95 DEG C of denaturation 30s, 58~60 DEG C of renaturation 30s, 72 DEG C of extension 30s are recycled；Totally 20 circulations, subsequently into step
4)；
4) 72 DEG C of extension 10min.
3. a kind of detection method of ox IGF1R gene insertion/deletion according to claim 1, it is characterised in that: the fine jade
The mass concentration for the Ago-Gel that sepharose electrophoresis uses is 2.5%.
4. a kind of detection method of ox IGF1R gene insertion/deletion according to claim 1, it is characterised in that: described to insert
Enter/the electrophoresis result of the genotype in deletion polymorphism site are as follows: insertion/insertion genotypic expression is mono- band line of 405bp；It inserts
Enter/deletion Genotype shows as two band line of 405bp and 377bp；Missing/deletion Genotype shows as mono- band line of 377bp.
5. a kind of detection kit of ox IGF1R gene insertion/deletion, which includes being used for PCR amplification ox IGF1R
The primer pair P1, the primer pair P1 of Partial Fragment containing 28-bp insertion/deletion site in gene are as follows:
Upstream primer: 5 '-CGAAGTGGGACTTGAGGC-3 '；
Downstream primer: 5 '-AGACAACTGGGAGAAGGGAC-3 '.
6. a kind of detection method of ox IGF1R gene insertion/deletion as described in claim 1 is assisted in ox molecular labeling
Application in selection and use.
7. application according to claim 6, it is characterised in that: the insertion in the insertion/deletion site/insertion base
Because type can be used as the DNA marker of Jin Nanniu Body steep length, bust and weight.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811173459.6A CN109182539B (en) | 2018-10-09 | 2018-10-09 | Detection method for cattle IGF1R gene insertion/deletion and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811173459.6A CN109182539B (en) | 2018-10-09 | 2018-10-09 | Detection method for cattle IGF1R gene insertion/deletion and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109182539A true CN109182539A (en) | 2019-01-11 |
| CN109182539B CN109182539B (en) | 2023-09-22 |
Family
ID=64947554
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811173459.6A Active CN109182539B (en) | 2018-10-09 | 2018-10-09 | Detection method for cattle IGF1R gene insertion/deletion and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109182539B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112795667A (en) * | 2021-03-22 | 2021-05-14 | 西北农林科技大学 | Detection method for bovine FRAS1 gene insertion/deletion mutation and application thereof |
| CN112941203A (en) * | 2021-03-22 | 2021-06-11 | 西北农林科技大学 | Detection method for cattle ITG beta 5 gene insertion/deletion mutation and application thereof |
| CN116200472A (en) * | 2023-04-04 | 2023-06-02 | 西北农林科技大学 | Application of cattle SCN9A gene InDel marker in early selection of meat quality traits |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008072946A (en) * | 2006-09-21 | 2008-04-03 | National Livestock Breeding Center | Method for diagnosing gene resistant to bovine mastitis |
| CN105671175A (en) * | 2016-03-16 | 2016-06-15 | 西北农林科技大学 | Detection method for cattle SPAG17 gene insertion/deletion and application thereof |
| CN107557439A (en) * | 2017-10-20 | 2018-01-09 | 西北农林科技大学 | A kind of method and its application of detection Shanxi south ox IGF1R gene Cs NV marks |
| CN107828894A (en) * | 2017-11-09 | 2018-03-23 | 华中农业大学 | Molecular labeling and application of the IGF1R genetic fragments as pig immune trait and growth traits |
-
2018
- 2018-10-09 CN CN201811173459.6A patent/CN109182539B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008072946A (en) * | 2006-09-21 | 2008-04-03 | National Livestock Breeding Center | Method for diagnosing gene resistant to bovine mastitis |
| CN105671175A (en) * | 2016-03-16 | 2016-06-15 | 西北农林科技大学 | Detection method for cattle SPAG17 gene insertion/deletion and application thereof |
| CN107557439A (en) * | 2017-10-20 | 2018-01-09 | 西北农林科技大学 | A kind of method and its application of detection Shanxi south ox IGF1R gene Cs NV marks |
| CN107828894A (en) * | 2017-11-09 | 2018-03-23 | 华中农业大学 | Molecular labeling and application of the IGF1R genetic fragments as pig immune trait and growth traits |
Non-Patent Citations (4)
| Title |
|---|
| M.A.EL-MAGD 等: "Novel polymorphisms of the IGF1R gene and their association with average daily gain in Egyptian buffalo (Bubalus bubalis) Author links open overlay panel", 《DOMESTIC ANIMAL ENDOCRINOLOGY》 * |
| ZIMIN,A.V. 等: "NCBI Reference Sequence: AC_000178.1", 《GENBANK》 * |
| 梁春年等: "牦牛IGF-IR基因克隆及其序列分析", 《华北农学报》 * |
| 王丁科等: "胰岛素样生长因子2研究进展", 《动物医学进展》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112795667A (en) * | 2021-03-22 | 2021-05-14 | 西北农林科技大学 | Detection method for bovine FRAS1 gene insertion/deletion mutation and application thereof |
| CN112941203A (en) * | 2021-03-22 | 2021-06-11 | 西北农林科技大学 | Detection method for cattle ITG beta 5 gene insertion/deletion mutation and application thereof |
| CN112795667B (en) * | 2021-03-22 | 2023-05-26 | 西北农林科技大学 | Detection method of cattle FRAS1 gene insertion/deletion mutation and application thereof |
| CN112941203B (en) * | 2021-03-22 | 2023-05-26 | 西北农林科技大学 | Detection method of cattle ITG beta 5 gene insertion/deletion mutation and application thereof |
| CN116200472A (en) * | 2023-04-04 | 2023-06-02 | 西北农林科技大学 | Application of cattle SCN9A gene InDel marker in early selection of meat quality traits |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109182539B (en) | 2023-09-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108728552B (en) | It is a kind of influence duroc eye muscle area character molecular labeling and application | |
| CN106755326B (en) | One kind molecular genetic marker relevant to duck egg-laying deseription and application | |
| CN105671175B (en) | A kind of detection method and its application of ox SPAG17 gene insertion/deletion | |
| CN105624314B (en) | Utilize the method and its application of the small copy number variation of round pcr detection goat TMEM95 gene | |
| CN107022604B (en) | Pig NTF3 promoter region SNP as boar breeding character molecular marker and application | |
| CN107164482B (en) | Detection method for insertion/deletion of goat CSN1S1 gene and application thereof | |
| CN110468218A (en) | A kind of detection method of goat IGF2BP1 gene insertion/deletion label | |
| CN109182539A (en) | A kind of detection method and its application of ox IGF1R gene insertion/deletion | |
| CN109880890A (en) | A kind of detection method and its application of goat HIAT1 gene insertion/deletion | |
| CN106636429B (en) | Four-primer amplification hindered mutation system PCR detection method for single nucleotide polymorphism of cattle ADNCR gene and application thereof | |
| CN109957614A (en) | A kind of detection method and its application of goat CMTM2 gene insertion/deletion | |
| CN103866032B (en) | A kind of method and application thereof detecting goat STAT3 gene mononucleotide polymorphism | |
| CN110468217B (en) | SNP molecular marker related to pH and drip loss traits of pig muscle and application thereof | |
| CN107641657A (en) | A kind of detection method of ox ACVR1 gene insertion/deletions and its application | |
| CN101921848B (en) | Method for detecting single nucleotide polymorphism (SNP) of cattle MGAT2 gene | |
| CN106755371A (en) | Method and its application using PCR RFLP detection sheep PCNP gene mononucleotide polymorphisms | |
| CN103233001A (en) | Qinchuan cattle FoxO1 gene mononucleotide polymorphism molecular marker detection method and application | |
| CN108866202A (en) | The detection method and its application of Chinese Cattle PLAG1 gene 19-bp repetition deletion polymorphism | |
| CN108410997A (en) | One herd boar StAR genes 5-bp repeats detection method and its application of deletion polymorphism | |
| CN108192985A (en) | A kind of detection method of goat CTNNB1 gene insertion/deletions and its application | |
| CN110564867B (en) | SNP molecular marker of Qinchuan cattle CFL1 gene and detection method thereof | |
| CN102816759B (en) | The detection method of Beijing duck STMN1 gene mononucleotide polymorphisms and its molecular labeling | |
| CN103695416B (en) | A kind of method and its application for the SNP for detecting Qinchuan Cattle CFL2 genes | |
| CN105779594A (en) | Pig Oct4 gene insertion/lack detection method and application thereof | |
| CN103320429A (en) | Method for detecting Qinchuan cattle Wnt7a gene single nucleotide polymorphism, and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |