CN109182539B - Detection method for cattle IGF1R gene insertion/deletion and application thereof - Google Patents
Detection method for cattle IGF1R gene insertion/deletion and application thereof Download PDFInfo
- Publication number
- CN109182539B CN109182539B CN201811173459.6A CN201811173459A CN109182539B CN 109182539 B CN109182539 B CN 109182539B CN 201811173459 A CN201811173459 A CN 201811173459A CN 109182539 B CN109182539 B CN 109182539B
- Authority
- CN
- China
- Prior art keywords
- cattle
- deletion
- igf1r
- genotype
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a detection method for insertion/deletion of cattle IGF1R genes and application thereof. The method comprises the steps of using the whole genome DNA to be detected containing IGF1R genes as a template, using a primer pair P1 designed by referring to bovine whole genome as a primer, amplifying the IGF1R genes by a PCR technology, performing agarose gel electrophoresis, and identifying that different genotypes exist in the IGF1R genes at the sites of AC_000178.1:g8086838-8086865 according to electrophoresis results. As a result, the remarkable correlation exists between different types of 28-bp insertion/deletion of IGF1R genes and growth traits such as oblique length, chest circumference, weight and the like of cattle in jin nan, and the fact that different types of 28-bp insertion/deletion of IGF1R genes can be used as DNA markers for improving the growth and development traits of cattle is suggested. The invention is beneficial to quickly establishing the cattle genetic resource population with excellent growth and development characters.
Description
Technical Field
The invention belongs to the field of modern biotechnology and livestock breeding, relates to detection of gene insertion/deletion (indel), and in particular relates to a method for detecting the genotype of a 28-bp insertion/deletion polymorphic locus of a cattle IGF1R gene.
Background
Animal breeding techniques mainly include conventional breeding techniques based on phenotypes and phenotype values and molecular breeding techniques based on DNA polymorphisms. As an important component of a molecular breeding technology system, a molecular marker-assisted selection (marker-as sisted selection, MAS) breeding technology firstly detects DNA polymorphism of important genes, then analyzes correlation between the DNA polymorphism and genetic traits, and finally performs trait selection according to DNA markers obviously related to the genetic traits. As a new technology developed in the development process of modern molecular biology technology, MAS breeding technology has advantages in overcoming the difficulty of phenotype identification, early selection, non-damaging character evaluation and selection, improving backcross breeding efficiency and the like.
In a MAS breeding technology system, searching an important functional gene, screening an important gene genetic variation site, and analyzing the correlation between the important functional gene genetic variation site and the growth performance is the premise and the key of the application. Insertion/deletion (indel) is one of the important ways of molecular genetic marking. indel refers to the insertion or deletion of a nucleotide fragment in a DNA sequence that causes a change in the DNA sequence, resulting in a diversity of chromosomal genomes among species including humans. Insertion or deletion fragments between 1-50bp in length, possibly including micro CNV, can better explain individual phenotypic differences by indel analysis of individual genomes, so indel detection of small fragment nucleotide differences at the DNA level is of great importance in MAS systems for animal molecular breeding.
Insertions/deletions (indels) are evolutionarily altered at the DNA or protein sequence level with a frequency inferior to residue substitutions, and fall broadly into the following 5 major classes: (1) single base pair insertions/deletions; (2) single base insertion/deletion; (3) Multiple base pair insertions/deletions with repeat units of 2-15 bases; (4) transposon insertion/deletion; (5) insertion/deletion polymorphism of any DNA sequence. Along with the intensive research of comparative genomics, indel provides a great amount of biological information for theoretical research and genetic breeding application research, and the indel is used as a new generation genetic identification mark, has the advantages of SNP, and is relatively stable due to single mutation event compared with SNP. Structurally belonging to the polymorphism of the two alleles, the alleles are fixed and known, and can be amplified by a small amplicon (< 50 bp), thus improving the success rate of amplifying highly degraded DNA. As an important genetic marker, the research of indels was first focused on the fields of molecular biology and biomedicine. The indel frequency throughout the genome is next to SNP, with about one third being located within known gene regions, and some being located in critical regions that determine gene function, such as promoter and exon regions.
Indels are widely found in the genomes of various organisms, and research into indels is currently focused on the genomes of humans and various crops. In 2006, a first human genome index map was created by Mills et al, which has more than 41 ten thousand specific index sites, and in 2011 Mills has found nearly 200 ten thousand index markers of varying lengths from 1bp to 10000bp in the human genome, most of which are centered within 100 bp. The research on indels is focused on chickens in livestock and poultry, and has little research and application on ruminants. In 2005 Schnabel et al studied to control milk yield in cows in combination with SSR markers and indel markers, fine localization was successfully performed. The indel locus is obtained through homologous sequence comparison analysis, but the known sequence is limited in biological species, most of model species or cash crops, and for non-model organisms, a large number of genome sequences are unknown, so that a certain difficulty exists in designing and developing the indel primer.
With the continuous improvement of economic development and the living standard of people, the demands of society on cattle products are continuously enhanced, but due to the serious shortage of beef, milk and other products in recent years, cattle breeding experts expect to obtain good varieties of cattle products earlier, better and faster. On the breeding targets of high-yield, high-quality and high-efficiency cattle, cattle breeding experts are always concerned about growth and development traits. Firstly screening and detecting DNA markers closely related to the growth and development traits of cattle on the DNA level, then detecting gene polymorphism, carrying out association analysis of the gene polymorphism and the growth and development traits, and finally selecting individuals with dominant traits according to indel markers obviously related to the traits.
Insulin-like growth factor type I receptor (IGF 1R) is an effector of insulin-like growth factor (insulin-like growthfactors, IGFs) that exerts biological effects, which modulate the half-life and activity of IGFs, and are essential for embryonic and postnatal growth of individuals, and which plays a very important role in immunomodulation, lymphocyte production, muscle and bone growth. It is now revealed that variations in the IGF1R gene affect the physiological function of IGF1R and even can lead to stunted growth, tumor production and other diseases. As an important factor affecting growth and differentiation, studies of IGF1R gene have been reported in human, murine and other species, but less in cattle.
Disclosure of Invention
The invention aims to provide a detection method for the insertion/deletion of a cattle IGF1R gene and application thereof, thereby accelerating the breeding speed of improved cattle seeds.
In order to achieve the above purpose, the invention adopts the following technical scheme:
a detection method of cattle IGF1R gene insertion/deletion uses cattle (such as cattle in jin' nan) whole genome DNA to be detected as a template, uses a primer pair P1 as a primer, and amplifies cattle IGF1R gene partial fragments by PCR; then agarose gel electrophoresis is carried out on the fragments obtained by PCR amplification; identifying the genotype of the 28-bp insertion/deletion polymorphism site (the site of the IGF1R gene reference sequence AC_000178.1:g8086838-8086865del TGTCCTGGGGCACGTGGTCTCGGCCCTC) of the cattle IGF1R gene according to the agarose gel electrophoresis result; the primer pair P1 is as follows:
an upstream primer: 5'-CGAAGTGGGACTTGAGGC-3';
a downstream primer: 5'-AGACAACTGGGAGAAGGGAC-3'.
The PCR amplification reaction program is as follows:
1) Pre-denaturing at 95 ℃ for 5min, and then entering step 2);
2) Cycle one: denaturation at 95℃for 30s, renaturation at 68℃for 30s, extension at 72℃for 30s; 18 cycles are total, after the first cycle, the renaturation temperature is gradually reduced by 1 ℃, and then the step 3) is carried out;
3) And (3) cycle two: denaturation at 95 ℃ for 30s, renaturation at 58-60 ℃ for 30s, extension at 72 ℃ for 30s; 20 cycles total, then go to step 4);
4) Extending at 72℃for 10min.
The mass concentration of agarose gel adopted by agarose gel electrophoresis is 2.5%.
In the genotype of the insertion/deletion polymorphism site, the electrophoresis result of the insertion/insertion genotype shows that 405bp is a stripe; the insertion/deletion genotype is represented by two bands of 405bp and 377 bp; the deletion/deletion genotype appears as a 377bp band.
A kit for detecting insertion/deletion of cattle IGF1R gene comprises the primer pair P1 for PCR amplification of partial fragments containing 28-bp insertion/deletion polymorphic sites in cattle IGF1R gene.
The detection method of the cattle IGF1R gene insertion/deletion is applied to cattle molecular marker-assisted selective breeding.
The insertion/insertion genotype (II) of the insertion/deletion polymorphism site can be used as a DNA marker for the oblique length, the chest circumference and the weight of Jinnan cattle.
The beneficial effects of the invention are as follows:
the invention designs a primer according to the sequence of IGF1R genes, respectively uses genome DNA of 2 cattle varieties as a template, carries out PCR amplification, and carries out agarose gel electrophoresis on PCR products, and the genotype of insertion/deletion polymorphic sites (AC_ 000178.1:g8086838-8086865del TGTCCTGGGGCACGTGG TCTCGGCCCTC sites) of the IGF1R genes of cattle is obtained after electrophoresis. The genotype of the above insertion/deletion polymorphic sites of 2 cattle breeds was detected and subjected to gene frequency analysis, and correlation analysis with cattle partial growth traits (e.g., body height, body length, circumference, body weight, etc.), which revealed that the sites could be used as molecular markers for increasing the body length (p=0.008), circumference (p=0.033) and body weight (p=0.007) of cattle (e.g., jin nan cattle). By combining the experimental results, the invention provides a detection method for the insertion/deletion polymorphism sites, and the designed primers are amplified by PCR and identified by agarose gel electrophoresis, so that the insertion/deletion polymorphism can be simply, rapidly, quickly and accurately detected at low cost, thereby providing a basis for breeding improved varieties of cattle, being beneficial to rapidly establishing genetic resource groups of cattle with excellent growth and development traits and accelerating the breeding speed of improved varieties.
Drawings
FIG. 1 shows the result of electrophoresis of PCR products of 28-bp insertion/deletion (indel) polymorphic site (AC_ 000178.1:g8086838-8086865del TGTCCTGGGGCACGTGGTCTCGGCCCTC site) of cattle IGF1R gene; wherein M is Marker I.
FIG. 2 is a sequence diagram of PCR products showing insertion/deletion at 8086838-8086865 position of IGF1R gene of cattle.
Detailed Description
The invention will now be described in detail with reference to the drawings and examples, which are given by way of illustration and not limitation.
The invention utilizes a PCR amplification method to detect the insertion/deletion polymorphism possibly generated by the mutation of the cattle IGF1R gene at the AC_000178.1:g8086838-8086865del TGTCCTGGGGCACGTGGTCTCGGCCCTC site, and carries out correlation analysis on the insertion/deletion polymorphism and the growth trait, and the result of detecting the insertion/deletion polymorphism at the site can be used for auxiliary selective breeding of cattle molecular markers through verification, thereby accelerating the breeding speed of improved cattle varieties.
Experimental medicine and reagent
1. Biochemical and biological reagents: (1) taq DNA polymerase (available from Fenmantas, MBI Co.); (2) proteinase K (available from Huamei bioengineering company) (3); marker I (purchased from Tiangen Biochemical technologies (Beijing) Co., ltd.).
2. Common reagent: the common reagent is purchased from the Huamei bioengineering company and is an imported packaged product: tris, EDTA, naCl, naOH, KCl, na 2 HPO 4 、KH 2 PO 4 Tris saturated phenol, chloroform, isoamyl alcohol, absolute ethanol, sodium acetate, sodium Dodecyl Sulfonate (SDS), ethidium Bromide (EB), bromophenol blue, dimethyl cyanogen FF, acetic acid, sucrose, boric acid, agarose, etc.
3. Solution and buffer: all solutions and buffers were prepared using deionized ultrapure water. The autoclave conditions were 15bf/in (1.034X 10) 5 Pa), 25min. The preparation method is all referred to the molecular cloning experiment guidelines, which are written by Sambrook et al.
1) Solution for extraction of tissue-like DNA: in addition to the public solutions used in genomic DNA extraction, the following reagents were formulated: (1) 2mol/L NaCl:11.688g of NaCl was dissolved in water, the volume was set to 100mL, and the mixture was autoclaved. (2) Tissue DNA extract (100 mL): l mol/L Tris-Cl (pH 8.0) L mL, 0.5mol/L EDTA (pH 8.0) 20mL, and 2mol/L NaCl 5mL, constant volume to 100mL.
2) Solutions used for agarose electrophoresis analysis (1)1 XTBE buffer: take 10 XTBE 100mL constant volume to 1000mL. (2) Loading buffer solution: an aqueous solution containing 0.25% bromophenol blue, 0.25% xylene cyanoff, and 40.0% (w/v) sucrose.
Design of PCR primer of IGF1R gene of cattle
The reference sequence of bovine IGF1R gene was retrieved at NCBI and a PCR Primer pair P1 capable of amplifying a 28-bp indel site (AC_ 000178.1:g8086838-8086865del TGTCCTGGGGCACGTGGTCTCGGCCCTC site) containing the 2 nd intron region of bovine IGF1R gene was designed using Primer Premier 5.0, the Primer sequences of which were as follows (Primer design completion time was 2016, 11):
an upstream primer: 5'-CGAAGTGGGACTTGAGGC-3';
a downstream primer: 5'-AGACAACTGGGAGAAGGGAC-3'.
The primer pair P1 can amplify different genotype fragments comprising indels of the cattle IGF1R gene at the AC_000178.1:g8086838-8086865del TGTCCTGGGGCACGTGGTCTCGGCCCTC locus. Theoretically, when TGTCCTGGGGCACGTGGTCTC GGCCCTC between 8086838 and 8086865nt is absent, the PCR product is detected by agarose gel electrophoresis followed by a band of 377bp in size; when TGTCCTGGGGCACGTGGTCTCGGCCCTC between 8086838 and 8086865nt was inserted, the PCR product was detected by agarose gel electrophoresis followed by a band of 405bp in size.
(III) PCR amplification of IGF1R Gene fragment of cattle to be tested
1. Collection of cattle samples
The animals used in the experiments were 303 samples of 2 breeds of cattle in total, wherein:
1) A total of 173 samples of jin nan cattle (JN) were collected from the city-care market in the city of the Shanxi province. Adopting a random sampling mode to take an ear tissue sample of an individual in a cattle farm, preserving the sample by using 70% ethanol, taking the sample back to a laboratory at a low temperature, and then placing the sample at-80 ℃ for freezing.
2) A total of 130 parts of summer south cattle (XN) samples were collected from the Shaoyang county livestock agency of the Kunan cattle breeding farm in the Kunan province of Henan province. Adopting a random sampling mode to take an ear tissue sample of an individual in a cattle farm, preserving the sample by using 70% ethanol, taking the sample back to a laboratory at a low temperature, and then placing the sample at-80 ℃ for freezing.
TABLE 1 collection of cattle samples
2. Extraction and isolation of genomic DNA from tissue samples
1) About 10mg of ear tissue sample was taken and placed in a 1.5mL centrifuge tube and minced as much as possible with small scissors.
2) 600. Mu.L of tissue DNA extract, 10% SDS to a final SDS concentration of 1% and proteinase K to a final concentration of 100. Mu.g/mL were added and digested overnight at 55℃to ensure a more uniform distribution of the tissue sample in the tissue DNA extract.
3) Cooling the digested solution to room temperature, adding equal volume of Tris saturated phenol, closing the tube cap, slowly reversing the centrifuge tube back and forth, and centrifuging for at least more than 10min and 12000r/min for 15min.
4) Taking supernatant, adding equal volume of phenol/chloroform (1:1), covering the tube cover, slowly reversing the centrifuge tube, and centrifuging for at least more than 10min and 12000r/min for 15min.
5) Taking supernatant, adding equal volume of chloroform-isoamyl alcohol (24:1), covering the tube cover, slowly reversing the centrifuge tube, and centrifuging for at least more than 10min and 12000r/min for 15min.
6) The supernatant was taken, 2 volumes of ice-cold absolute ethanol and 1/10 volume of 3mol/L sodium acetate were added, the tube lid was closed, and the centrifuge tube was slowly inverted back and forth until the liquid was clear, and white flocculent DNA appeared.
7) The DNA was picked up, placed in a 1.5mL centrifuge tube, 500. Mu.L of 70% ethanol was added, the tube lid was closed, the tube was slowly inverted back and forth, then centrifuged at 12000r/min for 3-5 min, the ethanol was carefully decanted, and the tube was inverted over absorbent paper.
8) 500. Mu.L of 70% ethanol was added to the centrifuge tube again, the tube lid was closed, the tube was slowly inverted back and forth, and then centrifuged at 12000r/min for 3-5 min, the ethanol was carefully decanted, and the tube was inverted over absorbent paper.
9) After drying, 60. Mu.L of sterilized ultrapure water was added, and the mixture was kept at 4℃overnight for complete dissolution, and was ready for detection.
3. Agarose gel electrophoresis for detecting DNA
1) The gel electrophoresis tank is washed, two ends are sealed by adhesive tape paper, and a comb is inserted.
2) 2g of agarose is weighed, transferred into a triangular flask, added with 80mL of 1 XTBE to suspend the agarose, heated by a microwave oven with medium fire, taken out after boiling for 2 times, and added with nucleic acid dye with the final concentration of 0.5 mu g/mL when the agarose is cooled to be not scalding hands. The agarose solution was then introduced rapidly and gently shaken to prevent air bubbles.
3) After mixing (about 60 ℃) the agarose solution was immediately added to the tank. If bubbles appear, the solution is immediately removed by a pipette.
4) After complete cooling and solidification (about 25-40 min), the comb is pulled out, the adhesive tape paper at the two ends is removed, and the gel is moved into an electrophoresis tank.
5) 1 XTBE buffer was added to the electrophoresis tank to raise the liquid level 2-5 mm above the gel surface.
6) Taking 2-4 mu L of DNA sample, adding 2 mu L of loading buffer solution, uniformly mixing, uniformly loading, and adding a DNA Marker on one side.
7) Electrophoresis was performed at 120V for 45min.
8) The RNA is observed on an ultraviolet analyzer, purification is needed if the RNA exists, and DNA of the corresponding sample is needed to be extracted again if the RNA is obviously degraded.
4. Purification of DNA
1) To 500. Mu.L of the DNA solution, 10% SDS was added to a final concentration of 0.1% SDS, and proteinase K was added to a final concentration of 100. Mu.g/mL.
2) Preserving heat for about 10h at 55 ℃.
3) Extracting the same volume of phenol, chloroform, isoamyl alcohol (25:24:1) and chloroform once respectively; wherein, the mixture is centrifuged for 5min at 12000r/min for phase separation, and the upper water phase is sucked into another centrifuge tube.
5) 1/10 volume of 3mol/L sodium acetate and 2 volumes of ice-cold absolute ethanol were added to precipitate DNA.
6) Pouring out the liquid, washing with 70% ethanol, air-drying, adding 60 μl sterilized ultrapure water, dissolving, and detecting at 4deg.C.
5. Spectrophotometry for detecting DNA
The OD of the DNA samples at 260nm and 280nm was measured by an ultraviolet photometer. Calculation of DNA content and OD 260 /OD 280 Is a ratio of (2). Such as OD 260 /OD 280 The ratio is less than 1.6, which indicates that the protein or phenol is contained in a large amount, and the purification is performed; if the ratio is greater than 1.8, removal of RNA purification should be considered.
DNA concentration (ng/. Mu.L) =50×OD 260 Value x dilution factor
After the DNA detection, a certain amount of the DNA was taken out and diluted to 50 ng/. Mu.L, and stored at-20℃for use (template DNA) and the rest at-80 ℃.
6. PCR amplification
The PCR reaction system adopts a mixed sample adding method, namely, the total amount of various reaction components is calculated according to the number of various components required by each reaction system and the number of PCR reactions required by 1 reaction, the reaction components are added into 1 1.5mL centrifuge tubes, are fully and uniformly mixed and then are subjected to instantaneous centrifugation, and are respectively packaged into each 0.2mL Eppendorf PCR tube, template DNA is added, and then the PCR amplification is carried out after the instantaneous centrifugation; the PCR reaction system comprises 2 xTaq PCR Supermix (comprising Taq DNA polymerase, dNTPs and reaction buffer, the concentration is 2 x) 5 muL; 0.5. Mu.L of upstream primer; 0.5. Mu.L of the downstream primer (the concentration of the upstream and downstream primers is 10 pmol/. Mu.L); 1.0. Mu.L of genomic DNA (50 ng/. Mu.L of cattle genomic DNA); deionized water 3 μl; the total of the PCR reaction system was 10. Mu.L.
7. Procedure for PCR reactions
The PCR amplification reaction procedure was: pre-denaturation at 95 ℃ for 5min; denaturation at 95 ℃ for 30s, renaturation at 68 ℃ for 30s, extension at 72 ℃ for 30s,18 cycles, wherein the renaturation temperature in each of the last 17 cycles is reduced by 1 ℃; denaturation at 95℃for 30s, renaturation at 60℃for 30s, extension at 72℃for 30s,20 cycles; extension at 72℃for 10min and preservation of the amplified product at 10 ℃.
Agarose gel electrophoresis analysis of PCR amplified products
1) Preparing 2.5% agarose gel, and electrophoresis under 120V voltage for 45min after sample application;
2) When the DNA fragments with different molecular weights are separated clearly, imaging in a BIO-RAD Gel Doc 2000 Gel imaging system;
3) Analysis of indel polymorphisms based on agarose gel electrophoresis imaging
The polymorphism of insertion/deletion (indel) was judged by photographic analysis using BIO-RAD Gel Doc 2000 Gel imaging system. Referring to FIGS. 1 and 2, agarose gel electrophoresis results of polymorphisms of the IGF1R gene at the insertion/deletion (indel) site of AC_000178.1:g8086838-8086865del TGTCCTGGGGCACGTGGTCTCGGCCCTC of the cattle genome were: the insertion/deletion genotype (ID) appears as two bands of 405bp and 377bp, the insertion/insertion genotype (II) appears as 405bp one band, and the deletion/deletion genotype (DD) appears as 377bp one band.
Frequency statistical analysis of the index locus of the IGF1R Gene of cattle
1) Gene and genotype frequency
Genotype frequency refers to the ratio of the number of individuals of a certain genotype for a trait in a population to the total number of individuals. The formula for the calculation can be written as:
P TT ＝N TT /N
wherein P is TT A TT genotype frequency representing a locus; n (N) TT Representing the number of individuals in the population having TT genotype; n is the total number of individuals in the test population.
Gene frequency refers to the relative ratio of a certain gene to the total number of alleles in a population. The formula for the calculation can be written as:
P T ＝(2N TT +N Ta1 +N Ta2 +N Ta3 +N Ta4 +……+N Tan )/2N
wherein P is T Representing allele T frequencies, N TT Indicating the number of individuals with TT genotype in the population, N Tai The number of individuals having the Tai genotype in the population is represented, and a1 to an are n complex alleles of allele T which are different from each other.
The genotype frequencies and allele frequencies in the 28-bp insertion/deletion (indel) sites (AC-000178.1: g8086838-8086865del TGTCCTGGGGCACGTGGTCTCGGCCCTC sites) of IGF1R genes of different cattle species are shown in Table 2, and the population genetic parameters are shown in Table 3. The frequencies of the alleles 'I' of the cattle in the south of Jinnan and the cattle in the south of summer are 0.699 and 0.765 respectively, the frequencies of the corresponding alleles 'D' are 0.301 and 0.235 respectively, and the frequencies of the alleles 'I' and 'D' are both more than 1%, so that the type of insertion/deletion (indel) exists stably.
TABLE 2 frequency distribution of the index locus genes of the IGF1R gene of cattle
TABLE 3 genetic parameters of cattle IGF1R Gene indel locus population
Correlation analysis of the gene effect of the index site of the IGF1R Gene of cattle
Genotype data: the genotypes identified by agarose gel electrophoresis after PCR amplification.
Production data: and the body size character data of Jinnan cattle and Xianan cattle, such as high body height, high cross part, oblique body length, chest circumference and body weight.
Correlation analysis model: SPSS (23.0) software was used to analyze variety different factors for correlation with growth traits. Statistical analysis of the resulting data is first described to determine if outliers exist. The effect of the genotype is then analyzed using an analysis of variance, a multivariate linear model, or a t-analysis based on the characteristics of the data. In the data processing process, according to the difference of factors influencing the growth and development, the effects of individuals, the interaction among genes and the genotype are considered, and a fixed model is adopted for carrying out correlation analysis. Further, the choice is made according to the actual conditions, and the complete model is as follows:
Y ijk ＝μ+Indel j +e ijk ，
wherein: y is Y ijk As observed values of the properties, μ is the overall mean, indel j A fixing effect for the jth indel type, e ijk Is a random error. The variability between the data sets was tested using LSD multiplex comparison and the test results are expressed in mean+ -SE format.
The results show that: the distribution of different genotype frequencies and allele frequencies of the IGF1R genes of the cattle have obvious differences on the influence of certain growth traits (such as body diagonal length, chest circumference and weight) of the cattle. The method comprises the following steps:
referring to table 4, in the study of 173 jin's cattle herd, the 28-bp insertion/deletion polymorphism of IGF1R gene had a significant effect on all of body bias length (p=0.008), chest circumference (p=0.033) and body weight (p=0.007) of jin's cattle (P < 0.05). And the individuals of the genotype II are obviously larger than those of genotypes DD and ID in terms of body oblique length, chest circumference and body weight, so that the genotype II of the IGF1R gene 28-bp insertion/deletion (indel) site is a molecular marker for growth and development of Jinnan cattle, and can be used for breeding excellent cattle.
TABLE 4 influence of IGF1R Gene indel polymorphism on growth Properties of Innan cattle
Note that: the letter difference marked by the same row of data indicates that the difference is significant (a, B: P < 0.05) or extremely significant (A, B: P < 0.01)
Claims (6)
1. A detection method for the insertion/deletion of cattle IGF1R genes is characterized by comprising the following steps: the method comprises the following steps:
the method comprises the steps of (1) using genomic DNA of cattle to be detected as a template, using a primer pair P1 as a primer, and amplifying partial fragments of IGF1R genes of cattle through PCR; then agarose gel electrophoresis is carried out on the fragments obtained by PCR amplification; identifying the genotype of the 28-bp insertion/deletion polymorphic site of the cattle IGF1R gene according to the agarose gel electrophoresis result; the locus is IGF1R gene reference sequence AC_000178.1:g8086838-8086865del TGTCCTGGGGCACGTGGTCTCGGCCCTC;
the primer pair P1 is as follows:
an upstream primer: 5'-CGAAGTGGGACTTGAGGC-3';
a downstream primer: 5'-AGACAACTGGGAGAAGGGAC-3';
the cattle are Jinnan cattle.
2. The method for detecting insertion/deletion of IGF1R gene in cattle according to claim 1, wherein: the PCR amplification reaction program is as follows:
1) Pre-denaturing at 95 ℃ for 5min, and then entering step 2);
2) Cycle one: denaturation at 95℃for 30s, renaturation at 68℃for 30s, extension at 72℃for 30s; 18 cycles are total, after the first cycle, the renaturation temperature is gradually reduced by 1 ℃, and then the step 3) is carried out;
3) And (3) cycle two: denaturation at 95 ℃ for 30s, renaturation at 58-60 ℃ for 30s, extension at 72 ℃ for 30s; 20 cycles total, then go to step 4);
4) Extending at 72℃for 10min.
3. The method for detecting insertion/deletion of IGF1R gene in cattle according to claim 1, wherein: the mass concentration of agarose gel adopted by agarose gel electrophoresis is 2.5%.
4. The method for detecting insertion/deletion of IGF1R gene in cattle according to claim 1, wherein: the electrophoresis result of the genotype of the insertion/deletion polymorphism site is as follows: the insertion/insertion genotype appears as a 405bp band; the insertion/deletion genotype is represented by two bands of 405bp and 377 bp; the deletion/deletion genotype appears as a 377bp band.
5. A kit for detecting insertion/deletion of a cattle IGF1R gene, the kit comprising a primer pair P1 for PCR amplification of a partial fragment of the cattle IGF1R gene containing a 28-bp insertion/deletion polymorphic site, wherein the primer pair P1 is:
an upstream primer: 5'-CGAAGTGGGACTTGAGGC-3';
a downstream primer: 5'-AGACAACTGGGAGAAGGGAC-3';
the locus is IGF1R gene reference sequence AC_000178.1:g8086838-8086865del TGTCCTGGGGCACGTGGTCTCGGCCCTC;
the cattle are Jinnan cattle.
6. Use of the method for detecting insertion/deletion of IGF1R gene in cattle according to claim 1 in molecular marker assisted selection breeding of cattle, characterized in that: the insertion/insertion genotype of the insertion/deletion polymorphism site can be used as a DNA marker for oblique length, chest circumference and body weight of cattle in jin nan.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811173459.6A CN109182539B (en) | 2018-10-09 | 2018-10-09 | Detection method for cattle IGF1R gene insertion/deletion and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811173459.6A CN109182539B (en) | 2018-10-09 | 2018-10-09 | Detection method for cattle IGF1R gene insertion/deletion and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109182539A CN109182539A (en) | 2019-01-11 |
| CN109182539B true CN109182539B (en) | 2023-09-22 |
Family
ID=64947554
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811173459.6A Active CN109182539B (en) | 2018-10-09 | 2018-10-09 | Detection method for cattle IGF1R gene insertion/deletion and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109182539B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112795667B (en) * | 2021-03-22 | 2023-05-26 | 西北农林科技大学 | Detection method of cattle FRAS1 gene insertion/deletion mutation and application thereof |
| CN112941203B (en) * | 2021-03-22 | 2023-05-26 | 西北农林科技大学 | Detection method of cattle ITG beta 5 gene insertion/deletion mutation and application thereof |
| CN116200472A (en) * | 2023-04-04 | 2023-06-02 | 西北农林科技大学 | Application of cattle SCN9A gene InDel marker in early selection of meat quality traits |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008072946A (en) * | 2006-09-21 | 2008-04-03 | National Livestock Breeding Center | Method for diagnosing gene resistant to bovine mastitis |
| CN105671175A (en) * | 2016-03-16 | 2016-06-15 | 西北农林科技大学 | Detection method for cattle SPAG17 gene insertion/deletion and application thereof |
| CN107557439A (en) * | 2017-10-20 | 2018-01-09 | 西北农林科技大学 | A kind of method and its application of detection Shanxi south ox IGF1R gene Cs NV marks |
| CN107828894A (en) * | 2017-11-09 | 2018-03-23 | 华中农业大学 | Molecular labeling and application of the IGF1R genetic fragments as pig immune trait and growth traits |
-
2018
- 2018-10-09 CN CN201811173459.6A patent/CN109182539B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008072946A (en) * | 2006-09-21 | 2008-04-03 | National Livestock Breeding Center | Method for diagnosing gene resistant to bovine mastitis |
| CN105671175A (en) * | 2016-03-16 | 2016-06-15 | 西北农林科技大学 | Detection method for cattle SPAG17 gene insertion/deletion and application thereof |
| CN107557439A (en) * | 2017-10-20 | 2018-01-09 | 西北农林科技大学 | A kind of method and its application of detection Shanxi south ox IGF1R gene Cs NV marks |
| CN107828894A (en) * | 2017-11-09 | 2018-03-23 | 华中农业大学 | Molecular labeling and application of the IGF1R genetic fragments as pig immune trait and growth traits |
Non-Patent Citations (4)
| Title |
|---|
| NCBI Reference Sequence: AC_000178.1;Zimin,A.V. 等;《GENBANK》;20160126;1-2 * |
| Novel polymorphisms of the IGF1R gene and their association with average daily gain in Egyptian buffalo (Bubalus bubalis) Author links open overlay panel;M.A.El-Magd 等;《Domestic Animal Endocrinology》;20130831;第45卷(第2期);105-110 * |
| 牦牛IGF-IR基因克隆及其序列分析;梁春年等;《华北农学报》;20180828(第04期);43-49 * |
| 胰岛素样生长因子2研究进展;王丁科等;《动物医学进展》;20080720;第29卷(第07期);71-74 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109182539A (en) | 2019-01-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107164482B (en) | Detection method for insertion/deletion of goat CSN1S1 gene and application thereof | |
| CN109880890B (en) | Detection method of goat HIAT1 gene insertion/deletion polymorphism and application thereof | |
| CN110468218B (en) | Detection method of goat IGF2BP1 gene insertion/deletion marker | |
| CN109182539B (en) | Detection method for cattle IGF1R gene insertion/deletion and application thereof | |
| CN109957614B (en) | Method for detecting insertion/deletion polymorphism of CMTM2 gene of goat and application of method | |
| CN107641657B (en) | Method for detecting cattle ACVR1 gene insertion/deletion and application thereof | |
| CN105671175B (en) | A kind of detection method and its application of ox SPAG17 gene insertion/deletion | |
| CN108441566B (en) | Method for detecting insertion/deletion polymorphism of goat ATBF1 gene and application thereof | |
| CN112795667B (en) | Detection method of cattle FRAS1 gene insertion/deletion mutation and application thereof | |
| CN111088369B (en) | Detection method, primer pair and application of sheep RORA gene insertion/deletion polymorphism | |
| CN111154892B (en) | Primer pair, kit, method and application for detecting sheep BMPR1B gene insertion/deletion polymorphism | |
| CN114703293B (en) | Application of InDel marker of cattle CRY1 gene in early selection of reproductive traits | |
| CN110607373A (en) | Method for detecting insertion/deletion polymorphism of goat DNAH1 gene and application thereof | |
| CN112795668B (en) | Application of goat CFAP43 gene insertion/deletion marker in early selection of characters | |
| CN112941202B (en) | Method for detecting cattle SEPT7 gene insertion/deletion mutation and application thereof | |
| CN111154891B (en) | Primer pair, kit, method and application for detecting sheep IGF2BP1 gene insertion/deletion polymorphism | |
| CN111088373B (en) | Sheep PRL gene insertion/deletion polymorphism detection primer pair, kit, method and application | |
| CN110904247B (en) | Detection method and application of InDel marker of goat Sox9 gene | |
| CN111118179B (en) | DNA detection method for detecting chest depth character of Luxi black ram and application thereof | |
| WO2021207992A1 (en) | Dezhou donkey's multi-thoracic vertebral trait-related snp site detection kit and use method thereof | |
| CN111154895B (en) | Sheep GHR gene insertion/deletion polymorphism detection primer pair, kit, method and application | |
| CN111733261B (en) | Detection method of goat AKAP12 gene InDel marker and application thereof | |
| CN106755370B (en) | Method for detecting sheep FTH-1 gene single nucleotide polymorphism by using PCR-RFLP and application thereof | |
| CN117363756A (en) | Detection method of goat C3H1orf226 gene insertion or deletion (InDel) marker and application thereof | |
| CN109628607B (en) | SNP marker related to digestibility of Suhuai pig neutral detergent fiber and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |