CN107828894A - Molecular labeling and application of the IGF1R genetic fragments as pig immune trait and growth traits - Google Patents
Molecular labeling and application of the IGF1R genetic fragments as pig immune trait and growth traits Download PDFInfo
- Publication number
- CN107828894A CN107828894A CN201711099615.4A CN201711099615A CN107828894A CN 107828894 A CN107828894 A CN 107828894A CN 201711099615 A CN201711099615 A CN 201711099615A CN 107828894 A CN107828894 A CN 107828894A
- Authority
- CN
- China
- Prior art keywords
- pig
- primer
- molecular labeling
- igf1r
- growth traits
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to pig molecule mark triage techniques field, and in particular to molecular labeling and application of the IGF1R genetic fragments as pig immune trait and growth traits.Described molecular labeling is obtained by being cloned in pig IGF1R genes.Present invention screening obtains a kind of molecular labeling related to pig immune trait and growth traits, its nucleotide sequence such as SEQ ID NO：Shown in 1, G/A allelic mutation at the base of the 33rd of the sequence be present, the mutation causes Sequenom
Description
Technical field
This discovery belongs to the molecular marker screening technical field of pig, and in particular to IGF1R genetic fragments are as pig immune
The molecular labeling and application of shape and growth traits.
Background technology
Swine disease has become one of key factor of restricting current pig industry sound development, and especially large-scale pig farm is general
And the preventing and treating to epidemic disease is even more the most important thing during pig-breeding.But often due to weak to some Blight control abilities,
Disease detection, diagnosis, prevent and the measure processing such as put out not in time, cause swine disease to take place frequently.The outburst of disease can directly result in life
The death of pig, the rate of animals delivered to the slaughter-house reduce, and then influence the economic benefit of pig-breeding.Largely make to prevent and treat disease simultaneously
Aquaculture cost and medicament residue are added with medicine, the medicine of residual causes a certain degree of destruction to ecological environment.And antibiosis
The abuse of element does not only result in germ and drug resistance occurs, adds the difficulty of plant's disease prevention and cure, and also result in charcuterie
Potential safety hazard be present.Therefore, the control and prevention of disease during pig-breeding, development and the pork food of this industry are directly connected to
Product market.Avoid largely using medicine as far as possible, find disease-resistant new strategy, start with from disease-resistant strain is cultivated, be to improve pig industry
The popular research direction of market.
Study and show that immune and growth has certain relation, negative correlation being therebetween present, (Tang Guoqing etc., pig is disease-resistant to be educated
Kind progress China animal and veterinary, 2002,29 (6):29-32；Yan Yan etc., pig genetic resistance and breeding for disease resistance progress
Pig industry science, 2007,6:58-61.), significant difference (Liu Xiao be present in China and foreign countries' pig kind in the factor for being used to detect immune indexes
Deng, gene (TLR4) extron of pig Toll-like receptor 4 SNP detections and bioinformatic analysis Jiangsu's agriculture journals, 2011,27
(4):782-789；Dong Wenhua etc., pig CD14 gene pleiomorphisms and its genetic effect analysis China poultry to partial immunity index
Herd magazine, 2014,50 (13):1-5.), the growth conditions of body can and be reflected to a certain extent.Therefore screening is with being immunized
The character gene associated with growth traits can and the genetic marker of growth traits immune as detection.
Lot of documents report IGF1R (Insulin like growth factor 1receptor) gene participates in regulation and control machine
The immune and growth of body.IGF-1 1 belongs to insulin-like growth factor family (insulin-like
Growth factor system, IGF families), the Pang that the family is made up of a kind of multi-functional regulation of cell proliferation factor
Extended familys, important regulating and controlling effect (Bajpai etc., Insulin like growth are played to growth of animal, development and metabolism
factors axis and growth disorders.Indian journal of pediatrics,2006,73(1):67-
71.).IGF families in the development of cancer and evolution process in the growing of embryo and fetus, equally play a significant role
(Agrogiannis etc., Insulin-like growth factors in embryonic and fetal growth and
skeletal development.Molecular medicine reports,2014,10(2):579-584；
Motallebnezhad etc., The insulin-like growth factor-I receptor (IGF-IR) in breast
cancer:biology and treatment strategies.Tumor Biology,2016,37(9):11711-
11721.).IGF families include three kinds of parts, four kinds of cell surface receptors and six kinds of insulin-like growth factor binding proteins
(IGF-binding proteins, IGFBPs) and corresponding protease.IGF1R then belongs to one of cell surface receptor (Sun Jing
Man, effects and Mechanism Study .2014. of the IGF1R correlation long-chains non-coding RNA-IRAIN in malignant tumour).Research shows,
IGF1R is a transmembrane glycoprotein with tyrosine kinase activity, is the co-ligand of IGF1 and IGF2 genes, and the two is combined
IGF1R plays anti-apoptotic, promotes the effect such as cell mitogen and activity of conversion (Pollak, Targeting insulin and
insulin-like growth factor signalling in oncology.Current opinion in
pharmacology,2008,8:384-392.).IGF1R is then sent out on regulating cell growth, differentiation, apoptosis and vicious transformation
Wave important regulating and controlling effect (Werner etc., Transcriptional and epigenetic control of IGF1R
gene expression:implications in metabolism and cancer.Growth Hormone&IGF
Research,2014,24(4):112-118.).The expression quantity of other IGF1R genes is proportionate with trunk Lean mass, because
This gene can as growth with carcass trait improvement candidate gene (Deng Study of the
differential transcription in liver of growth hormone receptor(GHR),insulin-
like growth factors(IGF1,IGF2)and insulin-like growth factor receptor(IGF1R)
genes at different postnatal developmental ages in pig breeds.Molecular
biology reports,2012,39(3):3055-3066.).Found in the research to breast cancer, IGF1R signal paths swash
Work can promote the breeding of cancer cell, pure work and transfer, and IGF1R overexpression is supported with breast cancer cell to anticancer therapy
Relevant (Motallebnezhad etc., The insulin-like growth factor-I receptor (IGF-IR) in of drag
breast cancer:biology and treatment strategies.Tumor Biology,2016,37(9):
11711-11721.).The above results show that IGF1R genes play a significant role in immunity of organism, disease and growth course, and
The mutation in the intron sequences site of gene the 20th may influence the performance that animal body is immune and grows.
In the present patent application, applicant analyzes the 20th introne fragment sequence of IGF1R genes, identifies one and pig
The closely related function mutation site of immune character and growth traits, it is the marker assisted selection of pig immune trait and growth traits
Provide new SNP marker.
The content of the invention
The shortcomings that it is an object of the invention to overcome prior art, there is provided IGF1R genes the 20th include sub-piece as pig
The molecular labeling and application of immune character and growth traits.The present invention expands IGF1R genes the 20th by PCR and includes sub-piece,
Utilize SequenomSNP technologies, parting is carried out in pig variety Duroc × painted face in Beijing opera F2 is for colony, will divided
Type result and the immune and growth indexes association analysis of the colony, and then identify that acquisition is related to pig immune trait and growth traits
Molecular labeling.The present invention provides new molecular labeling resource and application for the breeding for disease resistance and breed breeding of pig.
Technical scheme is as described below：
Applicant obtains the introne partial sequence of IGF1R genes the 20th, its sequence such as sequence by the method for gene cloning
Table SEQ ID NO：Described in 1.Its nucleotide sequence is as described below：
CCAGAGCACAAAGTTCCAAGAATGGACCAGCTRGTGGCCCATTGTCACAGAGACTAACGTGCCTTCCCT
TCCACTTGTGTT
R at the 33bp bases of above-mentioned sequence is A or G, and the mutation causes SequenomSNP partings are more
State property.
The genetic fragment can be as detecting the molecular labeling related to pig immune trait and growth traits.
Applicant provide a kind of detection such as sequence table SEQ ID NO：The primer pair of molecular labeling described in 1 (expands
The primer pair of the intron sequences of IGF1R genes the 20th), in the section start (i.e. shown in underscore of the forward and reverse primer of the primer pair
Sequence) respectively include 10bp sequence label.The nucleotide sequence of the primer pair is as follows：
Forward primer：5’-ACGTTGGATGCCAGAGCACAAAGTTCCAAG-3’
Reverse primer：5’-ACGTTGGATGAACACAAGTGGAAGGGAAGG-3’。
Applicant provide a kind of detection such as sequence table SEQ ID NO：Molecular labeling described in 1 is used for Genotyping
Extension primer combines, and the section start (sequence i.e. shown in underscore) of the primer composite sequence respectively includes 4bp sequence label.Should
The nucleotide sequence of primer combination is as follows：
Primer 1：5’-GGAGCTGTGACAATGGGCCAC-3’；
Primer 2：5’-GGAGCTGTGACAATGGGCCACC-3’；
Primer 3：5’-GGAGCTGTGACAATGGGCCACT-3’。
A kind of method for screening pig immune trait and the molecular labeling of growth traits, comprises the following steps：
1. extract pig ear tissue genomic DNA and quality testing is carried out to DNA；
2. according to SNP site sequence information, using the primer-design software Assay design3.1 of Sequenom companies,
Design PCR reactions and single base amplimer；
3. utilize SequenomSNP methods carry out parting detection；
4. the association analysis between genotype and pig immune trait and growth traits is carried out using SAS9.1 softwares.
Molecular labeling of the present invention can be used in the pig immune trait and growth traits marker assisted selection of non-diagnostic purpose.
The molecular labeling that the present invention screens can be used for being immunized to the genotype of pig related gene or with pig for non-diagnostic purpose
In association analysis between character and growth traits, the molecular marker assisted selection for pig immune trait and growth traits provides
One new molecular labeling resource.
Compared with prior art the device have the advantages that：
The present invention can be by using Sequenom in vitroSNP methods detect the genotype of pig, as non-
The immune and growth ability of the evaluation pig of diagnostic purpose, compared with the methods of current PCR-RFLP, ELISA, flow cytometer,
The present invention has outstanding advantages of simple, quick, high sensitivity and specificity are good.
More detailed technical scheme refers to specification《Brief description of the drawings》And《Embodiment》In embodiment.
Brief description of the drawings
Sequence table SEQ ID NO：1 is the intron sequences fragment of IGF1R genes the 20th that the present invention clones, i.e. present invention sieve
The nucleotide sequence of the molecular labeling of choosing.Sequence length is 81bp, and the R at 33 bit bases of the sequence has G/A's
Allelic mutation.
Sequence table SEQ ID NO：2 be the intron sequences fragment of present invention clone IGF1R genes the 20th and molecular labeling
Forward primer sequence.
Sequence table SEQ ID NO：3 be the intron sequences fragment of present invention clone IGF1R genes the 20th and molecular labeling
Reverse primer sequences.
Sequence table SEQ ID NO：4、SEQ ID NO：5 and SEQ ID NO：6 be detection sequence table SEQ ID NO：1
Sequenom The extension primer combined sequence of SNP polymorphisms..
Fig. 1：The general technical schematic flow sheet of the present invention.
Fig. 2：It is the 20th intron sequences of IGF1R genes and the nucleotides sequence of molecular labeling of the present invention that the present invention clones
Row.Brief description of the drawings：A G/A allelic mutations (English alphabet " R " at 33bp in Fig. 2 at 33 bit bases of sequence be present
For mutational site).
Fig. 3：It is the peak figure of the SNP site of the molecular labeling of the present invention.
Embodiment
Embodiment 1：Genotyping detects
(1) the ear tissue DNA using phenol extraction method extraction duroc × Erhualian F2 for colony
1) the ear sample group by Duroc × painted face in Beijing opera F2 for colony's (offer of Guangdong Hua Nongwenshi herdings limited company)
It is woven in liquid nitrogen and grinds, adds isometric 1 × SET (1mL), Proteinase K (10ng/mL) to final concentration 200ug/mL, dodecane
Base sodium sulphate (i.e. SDS, 10%) shakes up to final concentration 0.5%.55 DEG C of water-baths are incubated overnight digestion.
2) postdigestive tissue sample is added into isometric Tris saturated phenols, slowly reverse centrifuge tube 15min, in low temperature cold
Freeze in centrifuge 4 DEG C, 11000rpm centrifugation 10min, careful Aspirate supernatant is transferred in another centrifuge tube, puts on corresponding note
Number.
3) isometric phenol/chloroform/isoamyl alcohol (volume ratio 25 is added：24：1) centrifuge tube 10min, is slowly overturned, in low
4 DEG C in warm centrifuge, 11000rpm centrifugation 10min, carefully draw supernatant, be transferred in another clean centrifuge tube.
4) isometric chloroform/isoamyl alcohol (volume ratio 24 is added：1) centrifuge tube 10min, is slowly overturned, in cryogenic freezing
4 DEG C in centrifuge, 11000rpm centrifugation 10min.
5) in the centrifuge tube for having marked supernatant suction, the precooling absolute ethyl alcohol of 2.5 times of volumes is added, you can to see
To white flock DNA.
6) DNA precipitations are chosen with pipette tips, are placed in the EP pipes equipped with corresponding number, allow ethanol volatilization clean at room temperature,
Add appropriate ultra-pure water (general 300ul or so) dissolving DNA.
7) its concentration and purity are determined on DNA concentration analyzer, and in 1% Ago-Gel, 80 volts of electrophoresis about 2h, purple
The DNA mass of Detection and Extraction under outer lamp.
(2) design of primers
According to SNP site sequence information, using the intron sequences of pig IGF1R genes (ENSSSCG00000004812) the 20th as
Template, using the primer-design software Assay design3.1 of Sequenom companies, design PCR reactions and single base amplification are drawn
Thing.
Pcr amplification primer thing (preceding 10 bases of primer sequence are sequence label, see below the sequence shown in line)：
Forward primer：5’-ACGTTGGATGCCAGAGCACAAAGTTCCAAG-3’
Reverse primer：5’-ACGTTGGATGAACACAAGTGGAAGGGAAGG-3’。
(preceding 4 bases of primer sequence are sequence label to the combination of PCR primer extension primer, see below the sequence shown in line
Row)：
Primer 1：5’-GGAGCTGTGACAATGGGCCAC-3 ' (such as sequence table SEQ ID NO：Sequence pair shown in 4 is answered)；
Primer 2：5’-GGAGCTGTGACAATGGGCCACC-3 ' (such as sequence table SEQ ID NO：Sequence pair shown in 5 is answered)；
Primer 3：5’-GGAGCTGTGACAATGGGCCACT-3 ' (such as sequence table SEQ ID NO：Sequence pair shown in 6 is answered).
(3) PCR is expanded
Reaction system (reagent loss of 384 hole PCR versions+38%), is shown in Table 1.
Table 1PCR reaction systems -1
Amplification condition：94 DEG C of pre-degeneration 900s, (94 DEG C of denaturation 20s, 56 DEG C of annealing 30s, 72 DEG C of extension 60s) 45 are followed
Ring, 72 DEG C of extension 180s, 4 DEG C of terminating reactions.PCR primer is subjected to alkaline phosphatase treatment.
(4) alkaline phosphatase (SAP) digests：
Reaction system (reagent loss of 384 hole PCR plates+38%), is shown in Table 2.
Table 2PCR reaction systems -2
Amplification condition：37 DEG C of 40min, 85 DEG C of 5min, 4 DEG C of terminating reactions, PCR primer is subjected to extension.
(5) extension：
Reaction system (reagent loss of 384 hole PCR plates+38%), is shown in Table 3.
Table 3PCR reaction systems -3
Amplification condition：94 DEG C of pre-degeneration 30s, { 94 DEG C of denaturation 5s, (52 DEG C of annealing 5s, 80 DEG C of extension 5s) 5 circulations } 40
Individual circulation, 72 DEG C of extension 180s, 4 DEG C of terminating reactions.PCR primer is subjected to upper machine testing.
(6) machine testing on：
A reaction product (totally 9 μ L)) is diluted 3 times, according to a conventional method, desalination is carried out using resin.
B) by the sample spot after desalting processing on sample target, spontaneous nucleation.
C machine carries out Mass Spectrometer Method on), and collects data.
According to collection data statistics genotyping testing result.Genotype call results show, are examined in 384 samples
Measure 382 samples, recall rate 99.48%.AA genotype has 96 individuals wherein in 382 individuals, accounts for 25.13%；GG
Genotype has 92 individuals, accounts for 24.08%；GA genotype has 194 individuals, accounts for 50.79%.
Embodiment 2：Application of the IGF1R molecular labelings classifying method in pig immune trait and growth traits association analysis
(1) IGF1R molecular labelings genotyping result and immune character and growth traits association analysis
Detection and analysis experiment swinery used is associated with immune character come from Guangdong Hua Nongwenshi herding stocks for genotype
The F2 of the Duroc that part Co., Ltd cultivates × painted face in Beijing opera hybridization is for colony (for conventional variety).DNA used in Genotyping by
In the F2 generations of Duroc × painted face in Beijing opera hybridization, (in " the F2 generations of Duroc × painted face in Beijing opera hybridization " in following body matter and table, was referred to as
" pig ") extraction of ear sample, the pig that 20,33,35 and 80 ages in days are picked up from the blood of flow cytometer showed is detected for blood routine, wherein 20,
The pig of 33 ages in days is not inoculated with poly IC (PolyI:C), the piglet inoculation poly IC (PolyI of the 35th age in days:C) gathered after 4 hours
Blood sample, also the pig from 35 ages in days is inoculated with poly IC (PolyI to the serum for elisa assay:C) blood sample is gathered after 4 hours.Fortune
Genotype effects and immune indexes and growth with the intron sequences SNP site of fixed model statistical analysis IGF1R genes the 20th
The relation of index.
Mathematical modeling is as follows：Y=X β+e
Wherein：Y is immune character measured value vector；X is fixed effect incidence matrix；β is fixed effect parameter vector, bag
Include genotype effects, male animal effect, dam effect in male animal；E is random residual effect.
Statistical analysis is carried out using SAS9.1, the results are shown in Table 4,5,6.
Influence of the table 4IGF1R gene intron fragment 33G/A polymorphisms different genotypes to 33 age in days pig immune traits
Note：In table 4, P<0.05 is significant difference, P<0.01 is that difference is extremely notable.
Influence of the table 5IGF1R gene intron fragment 33G/A polymorphisms different genotypes to 35 age in days pig immune traits
Note：In table 5, P<0.05 is significant difference, P<0.01 is that difference is extremely notable.
Influence of the table 6IGF1R gene intron fragment 33G/A polymorphisms different genotypes to 80 age in days pig growth traits
Note：In table 6, P<0.05 is significant difference, P<0.01 is that difference is extremely notable.
From table 4-6, GG genotype is in the acidophil percentage (Eop) of 33 ages in days, the acidophil hundred of 35 ages in days
Divide and be all significantly higher than GA or AA genotype (P than (Eop), the character such as immunoglobulin G (IgG), 80 age in days body weight<0.05)；
GG genotype 35 ages in days RDW character significantly less than AA genotype (P<0.05).Therefore G allele pair
The acidophil percentage (Eop) of 33 ages in days, acidophil percentage (Eop), the immunoglobulin G (IgG) and 80 of 35 ages in days
The characters such as the body weight of age in days are favorable allels, and it is favourable to pig immune trait and growth traits selection to select G allele
's.
Leading reference：
1. Tang's National Day etc., pig disease resistant breeding progress China animal and veterinary, 2002,29 (6):29-32.
2. tight swallow etc., pig genetic resistance and breeding for disease resistance progress pig industry science, 2007,6:58-61.
3. Liu Xiao etc., gene (TLR4) extron of pig Toll-like receptor 4 SNP are detected and bioinformatic analysis Jiangsu agricultures
Industry journal, 2011,27 (4):782-789.
4. Dong's Wenhua etc., pig CD14 gene pleiomorphisms and its genetic effect analysis China herding to partial immunity index
Magazine, 2014,50 (13):1-5.
5.Bajpai A,Menon P S N.Insulin like growth factors axis and growth
disorders.Indian journal of pediatrics,2006,73(1):67-71.
6.Agrogiannis G D,Sifakis S,Patsouris E S,et al.Insulin-like growth
factors in embryonic and fetal growth and skeletal development(Review)
.Molecular medicine reports,2014,10(2):579-584.
7.Motallebnezhad M,Aghebati-Maleki L,Jadidi-Niaragh F,et al.The
insulin-like growth factor-I receptor(IGF-IR)in breast cancer:biology and
treatment strategies.Tumor Biology,2016,37(9):11711-11721.
8. effects and Mechanism Study of Sun Jing man's .IGF1R correlation long-chains non-coding RNA-IRAIN in malignant tumour are [rich
Bachelorship paper] Changchun, Jilin University .2014.
9.Pollak M.Targeting insulin and insulin-like growth factor
signalling in oncology.Current opinion in pharmacology.2008,8:384-392.
10.Werner H,Sarfstein R.Transcriptional and epigenetic control of
IGF1R gene expression:implications in metabolism and cancer.Growth Hormone&
IGF Research,2014,24(4):112-118.
11.M,Pareek C S,Urbański P,et al.Study of the differential
transcription in liver of growth hormone receptor(GHR),insulin-like growth
factors(IGF1,IGF2)and insulin-like growth factor receptor(IGF1R)genes at
different postnatal developmental ages in pig breeds.Molecular biology
reports,2012,39(3):3055-3066。
Sequence table
<110>Hua Zhong Agriculture University
<120>Molecular labeling and application of the IGF1R genetic fragments as pig immune trait and growth traits
<141> 2017-11-06
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 81
<212> DNA
<213>Pig (sus scrofa)
<220>
<221> gene
<222> (1)..(81)
<220>
<221> mutation
<222> (33)..(33)
<400> 1
ccagagcaca aagttccaag aatggaccag ctggtggccc attgtcacag agactaacgt 60
gccttccctt ccacttgtgt t 81
<210> 2
<211> 30
<212> DNA
<213>Pig (sus scrofa)
<220>
<221> primer_bind
<222> (1)..(30)
<400> 2
acgttggatg ccagagcaca aagttccaag 30
<210> 3
<211> 30
<212> DNA
<213>Pig (sus scrofa)
<220>
<221> gene
<222> (1)..(30)
<400> 3
acgttggatg aacacaagtg gaagggaagg 30
<210> 4
<211> 21
<212> DNA
<213>Pig (sus scrofa)
<220>
<221> primer_bind
<222> (1)..(21)
<400> 4
ggagctgtga caatgggcca c 21
<210> 5
<211> 22
<212> DNA
<213>Pig (sus scrofa)
<220>
<221> primer_bind
<222> (1)..(22)
<400> 5
ggagctgtga caatgggcca cc 22
<210> 6
<211> 22
<212> DNA
<213>Pig (sus scrofa)
<220>
<221> primer_bind
<222> (1)..(22)
<400> 6
ggagctgtga caatgggcca ct 22
Claims (5)
1. a kind of molecular labeling related to pig immune trait and growth traits, its nucleotide sequence are as follows：
CCAGAGCACAAAGTTCCAAGAATGGACCAGCTRGTGGCCCATTGTCACAGAGACTAACGTGCCTTCCCTTCCA
CTTGTGTT
R at above-mentioned sequence 33bp is G or A, and the mutation causes SequenomSNP parting polymorphisms.
2. a kind of primer pair for detecting molecular labeling as claimed in claim 1, the following institute of nucleotide sequence of the primer pair
Show：
Forward primer：ACGTTGGATGCCAGAGCACAAAGTTCCAAG
Reverse primer：ACGTTGGATGAACACAAGTGGAAGGGAAGG.
3. a kind of test right requires that the primer sequence for Genotyping of 1 molecular labeling combines, it is characterised in that institute
The nucleotide sequence for the primer combination stated is as follows：
Primer 1：GGAGCTGTGACAATGGGCCAC；
Primer 2：GGAGCTGTGACAATGGGCCACC；
Primer 3：GGAGCTGTGACAATGGGCCACT.
4. the related molecular labeling of a kind of and pig immune trait and growth traits described in claim 1 is in pig immune trait and life
Application in long character marker assisted selection.
5. the primer described in claim 3 is combined in the pig immune trait and growth traits marker assisted selection of non-diagnostic purpose
Application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711099615.4A CN107828894B (en) | 2017-11-09 | 2017-11-09 | IGF1R gene fragment as molecular marker of pig immune trait and growth trait and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711099615.4A CN107828894B (en) | 2017-11-09 | 2017-11-09 | IGF1R gene fragment as molecular marker of pig immune trait and growth trait and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107828894A true CN107828894A (en) | 2018-03-23 |
| CN107828894B CN107828894B (en) | 2021-06-08 |
Family
ID=61655009
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711099615.4A Active CN107828894B (en) | 2017-11-09 | 2017-11-09 | IGF1R gene fragment as molecular marker of pig immune trait and growth trait and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107828894B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108277286A (en) * | 2018-04-04 | 2018-07-13 | 云南农业大学 | Pig IGF1R gene molecule markers and its primer special |
| CN109182539A (en) * | 2018-10-09 | 2019-01-11 | 西北农林科技大学 | A kind of detection method and its application of ox IGF1R gene insertion/deletion |
| CN110273011A (en) * | 2019-07-24 | 2019-09-24 | 华中农业大学 | A kind of InDel molecular labeling relevant to the long character of pig body |
| CN111876490A (en) * | 2020-07-03 | 2020-11-03 | 扬州大学 | Linkage molecular marker for improving growth speed of pigs, detection method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20100120447A (en) * | 2009-05-06 | 2010-11-16 | 대한민국(농촌진흥청장) | Dna marker associated with body weight of pigs at birth and weaning, and method for discriminating heavy pigs early using this |
| CN105018483A (en) * | 2015-07-27 | 2015-11-04 | 华中农业大学 | DOCK2 gene fragment used as molecular marker for detecting immune character of pig and application of DOCK2 gene fragment |
-
2017
- 2017-11-09 CN CN201711099615.4A patent/CN107828894B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20100120447A (en) * | 2009-05-06 | 2010-11-16 | 대한민국(농촌진흥청장) | Dna marker associated with body weight of pigs at birth and weaning, and method for discriminating heavy pigs early using this |
| CN105018483A (en) * | 2015-07-27 | 2015-11-04 | 华中农业大学 | DOCK2 gene fragment used as molecular marker for detecting immune character of pig and application of DOCK2 gene fragment |
Non-Patent Citations (2)
| Title |
|---|
| M. J. UDDIN等: "Mapping Quantitative Trait Loci for Innate Immune Response in the Pig", 《INTERNATIONAL JOURNAL OF IMMUNOGENETICS》 * |
| 吴慧: "猪IGF1R、RasGRP1及InsR基因候选功能突变位点效应研究", 《万方学位论文》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108277286A (en) * | 2018-04-04 | 2018-07-13 | 云南农业大学 | Pig IGF1R gene molecule markers and its primer special |
| CN108277286B (en) * | 2018-04-04 | 2021-11-26 | 云南农业大学 | Pig IGF1R gene molecular marker and special primer thereof |
| CN109182539A (en) * | 2018-10-09 | 2019-01-11 | 西北农林科技大学 | A kind of detection method and its application of ox IGF1R gene insertion/deletion |
| CN109182539B (en) * | 2018-10-09 | 2023-09-22 | 西北农林科技大学 | Detection method for cattle IGF1R gene insertion/deletion and application thereof |
| CN110273011A (en) * | 2019-07-24 | 2019-09-24 | 华中农业大学 | A kind of InDel molecular labeling relevant to the long character of pig body |
| CN111876490A (en) * | 2020-07-03 | 2020-11-03 | 扬州大学 | Linkage molecular marker for improving growth speed of pigs, detection method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107828894B (en) | 2021-06-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107828894A (en) | Molecular labeling and application of the IGF1R genetic fragments as pig immune trait and growth traits | |
| CN109694916B (en) | Molecular marker related to sheep feed conversion rate and application thereof | |
| CN105506086B (en) | The relevant SNP marker of chicken fertilization duration character and its application | |
| CN105018483B (en) | Molecular labeling and application of the DOCK2 genetic fragments as pig immune trait | |
| AU2005244673B2 (en) | Leptin promoter polymorphisms and uses thereof | |
| CN107267618B (en) | Genetic marker related to fineness of sheep wool and application thereof | |
| CN114182026A (en) | Molecular marker related to Hu sheep feed conversion rate and application thereof | |
| CN113846171A (en) | Molecular marker for identifying chicken feed utilization rate character based on PIK3R1 gene and identification method and application thereof | |
| CN112941198B (en) | SNP marker for detecting pig eye muscle area and application thereof | |
| CN105861657B (en) | One kind CNV segment relevant to mastitis for milk cows resistance and its application | |
| CN110157818B (en) | Molecular marker related to high-yield characteristics of porcine eye muscles and application thereof | |
| CN110229914B (en) | SNP molecular marker influencing diameter of pig muscle fiber and application thereof | |
| CN110885889B (en) | Method for identifying pig backfat thickness based on rs81469622 locus genotype and application | |
| CN101418298B (en) | MuRF2 gene fragment cloning and application related to hog carcass characters as molecular marker | |
| CN107674878A (en) | Molecular labeling and application of the CPE genetic fragments as pig immune trait | |
| CN113249492A (en) | SNP marker for evaluating pig eye muscle area and application method thereof | |
| CN102776184B (en) | Genetic marker using pig CKM (creatine kinase muscle) 5' flanking promoter region SNP (single nucleotide polymorphism) as pig carcass traits and application | |
| CN115044682A (en) | Molecular marker related to growth traits of Hu sheep, detection method and application thereof | |
| CN107653326A (en) | Molecular labeling and application of the PAPPA2 upstream region of gene fragment as pig immune trait | |
| CN114736972A (en) | Reagent for evaluating growth-related traits of eleutheronema tetradactylum | |
| CN109554489B (en) | Molecular marker related to sheep feed conversion rate and application thereof | |
| CN109609655B (en) | Molecular marker of OSTN gene as swine immune trait and application thereof | |
| CN102260734A (en) | Method for rapidly detecting goat Six6 gene single nucleotide polymorphism and application thereof | |
| CN109609503B (en) | Molecular marker of INVS gene as pig immune trait and application thereof | |
| CN114717336B (en) | Molecular marker related to sheep viscera weight and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |