CN112852651A - Method for increasing yield of hydrocortisone produced by saccharomyces cerevisiae biotransformation - Google Patents

Abstract

The invention discloses a method for increasing the yield of hydrocortisone produced by saccharomyces cerevisiae biotransformation. The recombinant bacterium provided by the invention is prepared by the method comprising the following steps: improving the activity of SRP14 protein in the saccharomyces cerevisiae on the chassis or the expression quantity of the coding gene thereof to obtain recombinant bacteria; the saccharomyces cerevisiae with the chassis is a saccharomyces cerevisiae for expressing a protein coding gene of a hydrocortisone synthesis system; the coding gene of the protein related to the hydrocortisone synthesis system comprises a CYP5311B2 protein coding gene and an AoCPR protein coding gene. Experiments prove that the SRP14 protein can effectively improve the expression of a key enzyme CYP5311B2 protein in the synthesis of the hydrocortisone of saccharomyces cerevisiae, so that the synthetic capacity of the hydrocortisone of the strain can be effectively improved. SRP14 is proved to be an effective target for improving the synthetic ability of the hydrocortisone of the saccharomyces cerevisiae, which also contributes to improving the industrialization promotion of the biocatalytic synthesis of the hydrocortisone of the saccharomyces cerevisiae.

Description

Method for increasing yield of hydrocortisone produced by saccharomyces cerevisiae biotransformation

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a method for increasing the yield of hydrocortisone produced by saccharomyces cerevisiae biotransformation.

Background

In nature, a large class of compounds represented by cholesterol and related derivatives of cholesterol analogs exist, the compounds all use cyclopentane multi-hydrogen phenanthrene as a parent nucleus and have different physiological activities due to carrying different side chain modification groups. There are nearly 300 types of steroids found in nature and are widely known as: steroid drugs such as cholesterol, phytosterol, androstenedione, hydrocortisone, etc. With the success of steroid drugs in the fields of disease treatment, metabolic regulation and the like, the market demand of steroid drugs is increasingly strong, the development momentum is good, the growth is kept stable throughout the year, and the squat is the second largest drug market position (Fernandez-Cabezon, Galan et al.2018).

Hydrocortisone (HC) has a chemical name of 11beta, 17 alpha, 21-trihydroxy pregn-4-ene-3, 20-dione, is an adrenoglucocorticoid drug, and plays an important role in hormone drugs, and the structural formula of the Hydrocortisone is shown in figure 1. HC can affect glycometabolism, and has antiviral, antiinflammatory, antiallergic and antishock effects. The traditional Chinese medicine composition is mainly used for treating diseases caused by adrenal insufficiency, congenital adrenal cortex function hyperplasia and other symptoms, also can be used for treating inflammatory and allergic diseases such as bronchial asthma, rheumatoid arthritis, gout, rheumatic fever and the like, and also can be used for treating severe infection, antishock and the like.

The existing HC synthesis methods are mainly divided into three types: the most widely used methods are the total chemical synthesis, the semi-synthesis and the total biosynthesis, the semi-synthesis (Donova and Egorova 2012). The semi-synthesis method refers to a method combining chemical synthesis and biotransformation, and is characterized in that the C11 beta hydroxylase of steroids. The current C11 β hydroxylase mainly has three sources: absidia coerulea, curvularia lunata, mammals and the like. For example, the CYP5311B2 protein derived from Absidia coerulea is a C11 beta hydroxylase, and the protein is the CYP450 protein for catalyzing beta hydroxylation at the C11 position of a steroid compound to synthesize an important steroid drug, namely hydrocortisone. However, C11 β hydroxylase from different sources has some inevitable disadvantages such as: low catalytic activity, weak stereoselectivity, weak spatial selectivity, etc. (Donova 2017). Therefore, it is of great significance to propose a corresponding optimization strategy for the problems of the C11 beta hydroxylase at present.

The protein expression process mainly comprises the following steps: transcription and translation of proteins, correct folding of proteins, post-translational modification, and degradation of proteins (Young and Robinson 2014). The expression of heterologous proteins in the saccharomyces cerevisiae can be effectively improved by regulating and controlling the protein expression process, the catalytic activity of the heterologous proteins is improved, and the biosynthesis of a target product is helped. The biosynthesis process of the saccharomyces cerevisiae natural product generally involves the participation of heterologous CYP450 proteins, and the activity of a series of heterologous CYP450 proteins also becomes a bottleneck problem in the synthesis process of the natural product, so that the key target point influencing the expression level of the natural product is found by rationally analyzing the protein expression process, and the method has important significance for improving the activity of the saccharomyces cerevisiae heterologous CYP450 proteins and improving the synthesis capacity of saccharomyces cerevisiae natural compounds.

Disclosure of Invention

An object of the present invention is to provide a recombinant bacterium.

The recombinant bacterium provided by the invention is prepared by the method comprising the following steps: improving the activity of SRP14 protein in the saccharomyces cerevisiae on the chassis or the expression quantity of the coding gene thereof to obtain recombinant bacteria;

the saccharomyces cerevisiae with the chassis is a saccharomyces cerevisiae for expressing a protein coding gene of a hydrocortisone synthesis system;

the coding gene of the protein related to the hydrocortisone synthesis system comprises a CYP5311B2 protein coding gene and an AoCPR protein coding gene.

The SRP14 protein is derived from Saccharomyces cerevisiae; the CYP5311B2 protein and AoCPR protein are both derived from Absidia coerulea.

In the recombinant strain, the improvement of the activity of the SRP14 protein in the saccharomyces cerevisiae chassis or the expression quantity of the encoding gene thereof is to introduce the SRP14 protein encoding gene or an expression cassette containing the encoding gene into the saccharomyces cerevisiae chassis.

In the recombinant bacteria, the SRP14 protein coding gene or an expression cassette containing the coding gene is introduced in a plasmid form. In embodiments of the invention, the expression cassette containing the gene encoding the SRP14 protein includes the TEF1 promoter, the SRP14 gene, and the CYC1 terminator; the plasmid is SRP14 gene overexpression plasmid pRS313-Trp-SRP14, and specifically is a plasmid obtained by inserting SRP14 gene shown in 21 st to 461 th sites of a sequence 1 in a sequence table into a TEF1 promoter and a CYC1 terminator of a pRS313-Trp vector.

In the recombinant strain, the saccharomyces cerevisiae on the chassis is prepared according to the following method: and integrating the DNA molecule containing the CYP5311B2 protein coding gene and the DNA molecule containing the AoCPR protein coding gene into the genome of the host saccharomyces cerevisiae to obtain the recombinant strain.

In the recombinant strain, the DNA molecule containing the CYP5311B2 protein coding gene is integrated at the rDNA locus of the host saccharomyces cerevisiae genome;

the integration of the DNA molecule containing the AoCPR protein coding gene is at the Gal7 locus in the host s.cerevisiae genome.

Host Saccharomyces cerevisiae in this example is Saccharomyces cerevisiae strain HC201 (also known as HC 005).

The DNA molecule containing CYP5311B2 protein coding gene consists of an upstream homology arm (sequence 8), pTDH3-CYP5311B2-eGFP-tTPI1 (sequence 5) and a downstream homology arm (sequence 9).

The DNA molecule containing the AoCPR protein coding gene consists of an upstream homology arm, a marker (SEQ ID NO: 6), an Pgk promoter (SEQ ID NO: 10, positions 1-750), an AoCPR gene (SEQ ID NO: 10, positions 751-2803), an ADH1 terminator (SEQ ID NO: 10, positions 2804-2962) and a downstream homology arm (SEQ ID NO: 7).

It is still another object of the present invention to provide a method for producing the recombinant bacterium of the first object.

The method provided by the invention comprises the following steps: prepared by the method according to the first object; obtaining the recombinant strain.

The application of the recombinant bacterium in at least one of the following is also within the protection scope of the invention:

1) producing hydrocortisone;

2) the yield of hydrocortisone is improved;

3) preparing a product for producing hydrocortisone;

4) preparing a product for improving the yield of the hydrocortisone.

Or, the application of SRP14 protein in improving the hydrocortisone synthesis capacity of saccharomyces cerevisiae is also within the protection scope of the invention;

or, the application of the SRP14 protein in improving the synthetic capacity of the hydrocortisone of the saccharomyces cerevisiae via improving the expression quantity of the CYP5311B2 protein coding gene in the hydrocortisone synthetic system in the saccharomyces cerevisiae is also within the protection scope of the invention;

the saccharomyces cerevisiae with the chassis is a saccharomyces cerevisiae for expressing a protein coding gene of a hydrocortisone synthesis system.

The invention also provides the following method:

the invention provides a method for producing hydrocortisone, which comprises the following steps: catalyzing a substrate 17 alpha-hydroxypregna-4-ene-3, 20-diketone-21-acetate (Cortexolone-21-acetate, RSA) by using the recombinant bacteria of the first purpose to obtain hydrocortisone.

Or, the invention provides a method for improving the capability of saccharomyces cerevisiae to produce hydrocortisone, which comprises the following steps A) or B):

A) the method comprises the steps of improving the expression quantity of CYP5311B2 coding genes in a hydrocortisone synthesis system in saccharomyces cerevisiae via SRP14 protein, so as to improve the synthetic capacity of the hydrocortisone of the strain;

B) the method comprises the steps of improving the expression of CYP5311B2 protein in a hydrocortisone synthesis system in saccharomyces cerevisiae via SRP14 protein, so as to improve the synthetic capacity of the hydrocortisone of the strain;

the saccharomyces cerevisiae with the chassis is a saccharomyces cerevisiae for expressing a protein coding gene of a hydrocortisone synthesis system.

The various methods include the steps of:

1) preparing the recombinant bacterium of the first purpose;

2) the recombinant bacterium is used for catalyzing a substrate RSA to improve the capability of producing hydrocortisone by saccharomyces cerevisiae.

Experiments prove that the SRP14 protein can effectively improve the expression of a key enzyme CYP5311B2 protein in the synthesis of the hydrocortisone of saccharomyces cerevisiae, so that the synthetic capacity of the hydrocortisone of the strain can be effectively improved. SRP14 is proved to be an effective target for improving the synthetic ability of the hydrocortisone of the saccharomyces cerevisiae, which also contributes to improving the industrialization promotion of the biocatalytic synthesis of the hydrocortisone of the saccharomyces cerevisiae.

Drawings

FIG. 1 is the structural formula of hydrocortisone.

FIG. 2 shows functional verification of screening model.

FIG. 3 shows that SRP14 gene can improve the synthetic ability of hydrocortisone of strains.

FIG. 4 shows the results of liquid chromatography HPLC and standard curve.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The primers in the following examples are shown in Table 1:

TABLE 1 plasmid primers for construction of SRP14 Gene expression

Primer name	Sequence (5 '-3')
		TEF1-SRP14-up	ATCTAAGTTTTAATTACAAAATGGCAAATACTGGCTGT
SRP14-down-CYC1	CGGCCCTCTAGGATCAGCGGTCAGTTTTTCTTCGCTACCTTG
		313-TEF-OL	TTTGTAATTAAAACTTAGATTAGATTGCTATGC
313-CYC1-OL	CCGCTGATCCTAGAGGGC

Example 1 construction of Saccharomyces cerevisiae SRP14 Gene overexpression plasmid

1. PCR amplification of target

The target gene is amplified BY using a primer TEF1-SRP14-up/SRP14-down-CYC1 (shown in Table 1) BY using a Saccharomyces cerevisiae BY4742 genome as a template.

The amplification system is TAKARA

10. mu.l of HS DNA polymerase, 10. mu.l of Dntp mix 4. mu.l each, 1. mu.l of primers (see Table 1), 0.5. mu.l of cDNA, template, 0.5. mu.l of PrimerSTAR HS polymerase (2.5U/. mu.L), and distilled water were added to a total volume of 50. mu.l.

The above amplification conditions were 98 ℃ for 2 minutes (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 56 ℃ for 15 seconds, and extension at 72 ℃ for 2 minutes (30 cycles); extension at 72 ℃ for 8 min (1 cycle).

The resulting amplification product was designated TEF1-SRP14-CYC1 (SEQ ID NO: 1, which fragment contains the TEF1 promoter-homologous region (SEQ ID NO: 1, 1-20), the CYC1 terminator-homologous region (SEQ ID NO: 1, position 462,481) and the SRP14 gene sequence (SEQ ID NO: 1, position 21-461)). And purifying the obtained PCR amplification product by using a PCR product purification kit of Shanghai biological engineering Co., Ltd, and obtaining a purified product for later use.

The sequence of the SRP14 gene (wild type) is shown in 21 st to 461 th positions of the sequence 1, and the coded protein is named as SRP14 protein.

2. PCR amplification of expression vectors

The general expression vector pRS313-Trp of Saccharomyces cerevisiae is used as a template, and a target expression vector is amplified by using a primer 313-TEF-OL/313-CYC1-OL (shown in a table 1). The amplification system is the same as in step 1. Amplification conditions were 98 ℃ pre-denaturation for 2 min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 56 ℃ for 15 seconds, and extension at 72 ℃ for 6 minutes (30 cycles); extension at 72 ℃ for 8 min (1 cycle). The resulting amplification product was designated pRS313-Trp-vector (SEQ ID NO: 2, which contains the TEF1 promoter, CYC1 terminator and pRS313 vector backbone, nucleotides 1-270 of SEQ ID NO: CYC1 terminator, nucleotides 271-5391 of SEQ ID NO: 2, and nucleotides 5392-5812 of SEQ ID NO: 2, which is the TEF1 promoter). And (3) recovering and purifying the obtained PCR amplification product by using a PCR glue recovery kit of Shanghai biological engineering Co.

3. Construction of target expression plasmid

Adding a connecting system into a seamless cloning kit of Biyuntan company, a gene fragment TEF1-SRP14-CYC1 obtained in the step 1 and a vector fragment pRS313-Trp-vector obtained in the step 2: mu.L of 2 Xquick ligation Buffer (NEB), 0.5. mu.L of Quick ligation Buffer (NEB, 400,000 covalent end units/ml), 10. mu.L of distilled water was added, the reaction was carried out at 25 ℃ for 20min to obtain a ligation product, the ligation product was transferred into Trans1-T1 competent cells and subjected to ice-bath for 30 min, heat-shock at 42 ℃ for 30 sec, and immediately placed on ice for 2 min. Adding 800 mu l of LB culture medium, incubating at 250rpm and 37 ℃ for 1 hour, coating the bacterial liquid on an LB plate containing ampicillin, culturing overnight, carrying out PCR screening on 5 positive single colonies, carrying out liquid culture on positive clones, extracting positive clone plasmids, and carrying out sequencing verification, wherein sequencing results show that a target fragment is inserted into the vector pRS313-Trp to obtain the plasmid pRS313-Trp-SRP 14. The plasmid extraction kit of Aisijin company is used to extract the target plasmid for later use.

SRP14 gene overexpression plasmid pRS313-Trp-SRP14 is a plasmid obtained by inserting SRP14 gene shown in the 21 st to 461 th positions of the sequence 1 in the sequence table between TEF1 promoter and CYC1 terminator of pRS313-Trp vector (sequence 2).

Example 2 establishment of a model for screening expression levels of Saccharomyces cerevisiae C11 beta hydroxylase (CYP5311B2) with hydrocortisone as a target product

1. Fusion of CYP5311B2 protein and eGFP protein

Firstly, fusion of CYP5311B2 protein and eGFP protein is realized in an overlap connection mode, firstly, an existing cloning vector M4-CYP5311B2 in a laboratory is used as a template, and primers Xp-M-pEASY-TDH3-F and CYP5311B2-OL-eGFP (see table 2) are used for amplification (the method is the same as the step 1 of the example 1), and the obtained fragment is named as CYP5311B2-eGFP-OL-1 (sequence 3, wherein the fragment comprises a TDH3 promoter (1 st to 800 th site of the sequence 3), a CYP5311B2 gene (801 nd 2483 th site of the sequence 3) and an eGFP homologous region (2484 nd 2504 of the sequence 3));

secondly, amplifying by using M4-eGFP plasmid which is already available in a laboratory as a template and using a primer eGFP-OL-CYP5311B2 and a primer Xp-M-pEASY-CYC1-R (see a table 2) (the method is the same as the step 1 of the example 1), and obtaining a fragment which is named as CYP5311B2-eGFP-OL-2 (a sequence 4, wherein the fragment comprises CYP5311B2 homologous regions (the sequence 4 is from the 1 st to 25), an eGFP gene (the sequence 4 is from the 26 th to 739) and a CYC1 terminator (the sequence 4 is from the 740 th to 1017));

third, the fragments obtained in the previous two steps were used as templates and amplified using primers Xp-M-pEASY-TDH3-F and Xp-M-pEASY-CYC1-R (see Table 2) (the same procedure as in step 1 of example 1), and the obtained fragments were named pTDH3-CYP5311B2-eGFP-tTPI1 (SEQ ID NO: 5, which contains TDH3 promoter (SEQ ID NO: 5, 1-800), CYC1 terminator (SEQ ID NO: 5, 3219-3496) and CYP5311B2-eGFP fusion fragment (SEQ ID NO: 5, 801-3218)).

And performing gel recovery treatment on the target fragment obtained by amplification for later use. Thus, the coding gene of the CYP5311B2 protein fused with eGFP was obtained, and the expression of CYP5311B2 was characterized by fluorescence intensity.

Table 2 shows the fusion primers of CYP5311B2 protein and eGFP protein

Primer name	Sequence (5 '-3')
		Xp-M-pEASY-TDH3-F	ATCTAAGTTTTAATTACAAAATGGCAAATACTGGCTGT
Xp-M-pEASY-CYC1-R	CGGCCCTCTAGGATCAGCGGTCAGTTTTTCTTCGCTACCTTG
		CYP5311B2-OL-eGFP	TTTTCTTGGAACAATTTTGAATC
eGFP-OL-CYP5311B2	TAGATTCAAAATTGTTCCAAGAAAAAGTAAAGGAGAAGAACTTTTC
		AoCPR-up-F	ATGGATCTCCCTACAGCAAC
AoCPR-down-R	CTATGCCCACACGTCTTCCA
		CYP5311B2-up-F	ATGCCATTGGCTGCTTTTAA
eGFP-down-R	CTATTTGTATAGTTCATCCAT

2. Construction of Chassis Strain HC401

1) Strain HC400

Saccharomyces cerevisiae HC201 strain (also known as HC005, described in Chen, J.Fan, F.et al.identification of Absidia stereo 11 beta-hydration system and its application in engineering Saccharomyces cerevisiae for one-step biological transformation to product hydrocortisone. Metal Eng.2019, 57,31-42.) available in the laboratory was cultured in a selective medium (formulation: Yeast screening Medium SD-Ura-His-Leu-Trp (Beijing Pankyo technology Co., Ltd.), 2% glucose, 0.005% His, 0.01% Leu, 0.01% Ura (each number indicates g/100mL)) to obtain a culture solution. 1mL (OD. about.0.6-1.0) was dispensed into 1.5mL EP tubes, centrifuged at 4 ℃ at 10000g for 1min, the supernatant was discarded, the precipitate was washed with sterile water (4 ℃), centrifuged under the same conditions, and the supernatant was discarded. The cells were incubated at 25 ℃ for 20min with 1mL of a treatment solution (10mM LiAc; 10mM DTT; 0.6M sorbitol; 10mM Tris-HCl (pH7.5) added thereto, and the treatment solution was used. After centrifugation, the supernatant was discarded, 1mL of 1M sorbitol (0.22 μ M aqueous membrane filtration sterilization) was added to the cells for resuspension, and the cells were centrifuged to discard the supernatant (resuspended twice with 1M sorbitol) to a final volume of about 90 μ L.

Respectively adding a recombination fragment pPgk-Ac-CPR-ADH1t (sequence 10; the fragment comprises a pgk promoter, an AoCPR gene and an ADH1 terminator), a homologous arm marker fragment Gal7S-URA3-up (sequence 6; the homologous arm fragment comprises a 400bp homologous region at the upstream of a Gal7 site, a URA3marker gene and a Pgk promoter 400bp homologous region) and a Gal7S-URA3-down (sequence 7; the homologous arm fragment comprises a 200bp homologous region of an ADH1 terminator and a 300bp homologous region at the downstream of a Gal7 site), realizing that the AoCPR and the gene fragment are integrated in the Gal7 site of Saccharomyces cerevisiae HC201, uniformly mixing, transferring the mixture to an electric transfer cup, 2.7kv electric shock for 5.7ms, adding 1mL of 1 sorbitol 1M, 1h at 30 ℃, and selecting a solid screening culture medium (yeast selection: His-Ura-Leu-selection medium), 2% glucose, 0.005% his, 0.01% Leu, 1.5% agar; each percentage number represents g/100 mL). The conditions of the screening culture are as follows: culturing at 30 deg.C for 36 hr or more.

PCR identification was carried out using the primers AoCPR-up-F and AoCPR-down-R, and a positive clone with a band size of 2052bp was designated as strain HC 400.

The strain HC400 is a recombinant strain obtained by integrating a DNA molecule containing an AoCPR protein coding gene into a Gal7 locus in a saccharomyces cerevisiae HC201 genome.

The DNA molecule containing the AoCPR protein coding gene consists of an upstream homology arm, a marker (SEQ ID NO: 6), an Pgk promoter (SEQ ID NO: 10, positions 1-750), an AoCPR gene (SEQ ID NO: 10, positions 751-2803), an ADH1 terminator (SEQ ID NO: 10, positions 2804-2962) and a downstream homology arm (SEQ ID NO: 7).

2) Strain HC401

The strain HC401 is a recombinant strain obtained by integrating DNA molecules containing CYP5311B2-eGFP into rDNA sites of Saccharomyces cerevisiae HC 400.

The DNA molecule containing CYP5311B2-eGFP consists of an upstream homology arm (SEQ ID NO: 8), pTDH3-CYP5311B2-eGFP-tTPI1 (SEQ ID NO: 5) and a downstream homology arm (SEQ ID NO: 9).

The method comprises the following specific steps:

the method is the same as the step 1): pTDH3-CYP5311B2-eGFP-tTPI1 (sequence 5), rDNA-Leu2-up (sequence 8; the homologous arm fragment comprises 400bp homologous region at the upstream of rDNA site, Leu2marker gene and 400bp homologous region of TDH3 promoter) and rDNA-Leu2-down (sequence 9; the homologous arm fragment comprises 200bp homologous region of CYC1 terminator and 300bp homologous region at the downstream of rDNA site) are transferred into HC400 by electric shock, so that 8 correct positive clones are obtained and named as strain HC401 (1-8).

PCR identification was performed using primers CYP5311B2-up-F and eGFP-down-R, and a positive clone with a band size of 2418bp was designated strain HC401 (1-8).

The 8 strains had different copies of the CYP5311B2-eGFP gene on the chromosome, and therefore showed different fluorescence intensities and differences in the production of hydrocortisone.

2. Basic validation of screening model function

The 9 strains HC400 and HC401(1-8) were subjected to the fluorometric experiment: HC400 and HC401(1-8) in total 9 Saccharomyces cerevisiae strains were activated in the corresponding solid selection medium (formulation: solid Yeast selection Medium SD-Ura-His-Leu-Trp, 2% glucose, 1.5% agar; each percentage indicates g/100mL), and the corresponding liquid selection medium (formulation: liquid Yeast selection Medium SD-Ura-His-Leu-Trp, 2% glucose; each percentage number representing g/100mL) was prepared and then the initial OD was followed (30 ℃, 250rpm, 12h)_600nmThe culture was continued by transfer (30 ℃, 250rpm, 12 hours) at 0.1, followed by fluorescence measurement under the conditions of 488nm for excitation light, 518nm for absorption light and OD measurement under the conditions of 600nm for wavelength.

The results are shown in FIG. 2, 1-8 are HC401(1-8), respectively; the fluorescence intensity of 8 strains of bacteria is different, the fluorescence intensity accords with experimental expectation, the availability of the screening model is verified, and the model can be used for screening subsequent related targets for improving protein expression. In the research, strain No. 4 of HC401(1-10) strains is selected as a chassis strain for subsequent screening, and is named as HC 401-4.

Example 3 improvement of Synthesis of hydrocortisone by Strain with related functional targets

A saccharomyces cerevisiae strain HC401-4 is taken as a chassis strain, a control empty plasmid pRS313-Trp and the plasmid pRS313-Trp-SRP14 constructed in the example 1 are respectively transferred into the saccharomyces cerevisiae strain HC401-4 (the transfer method is the same as the example 2), correct positive clones are obtained, and the obtained strains are respectively named as strains HC402 and HC 403.

The strains HC401-4, HC402 and HC403 were subjected to fluorescence measurement and catalytic fermentation to synthesize hydrocortisone, and the fluorescence measurement method was the same as that in example 2.

And (3) flask fermentation catalysis: HC401-4, HC402 and HC403 Saccharomyces cerevisiae strains were activated in a solid selection medium (formulation: solid yeast selection medium SD-Ura-His-Leu-Trp, 2% glucose, 1.5% agar; each percentage number indicates g/100mL), seed solutions (30 ℃, 250rpm, 16h) were prepared in respective liquid selection media (formulation: liquid yeast selection medium SD-Ura-His-Leu-Trp, 2% glucose; each percentage number indicates g/100mL), inoculated in 1mL amounts respectively into 3 500mL flasks containing 100mL of the respective liquid selection medium, shake-cultured at 30 ℃, 250rpm for 2 days, 5000rpm, yeast cells were collected, and PBS buffer (formulation: potassium dihydrogen phosphate (KH2PO4):0.24g, disodium hydrogen phosphate (Na2HPO 4): 1.44g, sodium chloride (NaCl 8 g), potassium chloride (KCl): 0.2g, adding about 800mL of deionized water, fully stirring and dissolving, then adding concentrated hydrochloric acid to adjust the pH value to 7.4, finally fixing the volume to 1L), washing, finally suspending in a 250mL triangular flask containing 30mL of PBS, adding a substrate RSA (purchased from a source leafy organism) with the final concentration of 850mg/L, carrying out catalytic reaction, and carrying out shaking culture at 30 ℃ and 250rpm for 1 day to obtain a catalytic reaction solution.

And (3) product extraction: and (3) performing full-catalytic liquid extraction, namely putting 5mL of catalytic reaction liquid into a separating funnel, adding an equal volume of an extracting agent (methanol: chloroform: 1:9, volume ratio), taking 4mL of lower-layer organic phase, putting the lower-layer organic phase into a 10mL centrifuge tube, drying, performing redissolution by using 1mL of methanol solution, centrifuging, taking supernatant, and filtering the supernatant through a 0.22-micron organic filter membrane into a liquid bottle for HPLC detection. Analyzing the product by an Agilent 1260 High Performance Liquid Chromatography (HPLC), and detecting the method: column shimadzu inertsustatin 250mm 4.6mm 5um (cantonese, guangzhou, greenbrier biology ltd), mobile phase methanol: water 6:4(v/v), flow rate 0.8mL/min, column temperature 25 ℃, detection wavelength 254 nm.

The standard hydrocortisone was purchased from a source leafy organism.

FIG. 4A is the result of liquid chromatography HPLC, the upper graph is the standard substance with retention time of 10.5min, the lower graph is HC401-4, and the retention time close to 10.5min is the target product hydrocortisone. The HPLC results of HC402 and HC403 are similar to HC401-4, and the retention time of approximately 10.5min is selected as the target product hydrocortisone.

FIG. 4B shows a standard preparation;

the yield of hydrocortisone (mg/L.D, which represents the mass of hydrocortisone in the catalytic reaction solution per day) was obtained from the standard curve, and the results are shown in FIG. 3, compared with the control strain HC402, the synthesis capacity and fluorescence intensity of hydrocortisone of the strain HC403 which overexpresses SRP14 gene were improved by 25% compared with the control strain. The result shows that the SRP14 protein can effectively improve the expression of a key enzyme CYP5311B2 protein in the synthesis of the hydrocortisone of saccharomyces cerevisiae, thereby effectively improving the synthetic capacity of the hydrocortisone of the strain. SRP14 is proved to be an effective target for improving the synthetic ability of the hydrocortisone of the saccharomyces cerevisiae, which also contributes to improving the industrialization promotion of the biocatalytic synthesis of the hydrocortisone of the saccharomyces cerevisiae.

SEQUENCE LISTING

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> method for increasing yield of hydrocortisone produced by saccharomyces cerevisiae biotransformation

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 481

<212> DNA

<213> Artificial sequence

<400> 1

atctaagttt taattacaaa atggcaaata ctggctgttt atcaccaggt gcatttttat 60

caaaggttcc agaatttttc cagactgcga atgaaaaaca tataactgtg cgtctaacgg 120

ccaaaagact catagaacac gatcctgtgg aagggaatct tgaatttgat tctaccaacc 180

atcctgacta tgatgtatct aaaaaggctt ctgaaatttc agttagctca agatctgaca 240

gagaataccc actattaatc agaatgtctt atggctcgca tgacaagaaa acaaaatgct 300

caacagtggt aaaagcaagt gagttagatc aattttggca agagtattca tctgtattta 360

aggggggcat gcagaatttg atcaagaaga agaaaaagaa gagtaagaac ggtaccatca 420

gtaagacagg aaagaaaaac aaggtagcga agaaaaactg accgctgatc ctagagggcc 480

g 481

<210> 2

<211> 5812

<212> DNA

<213> Artificial sequence

<400> 2

ccgctgatcc tagagggccg catcatgtaa ttagttatgt cacgcttaca ttcacgccct 60

ccccccacat ccgctctaac cgaaaaggaa ggagttagac aacctgaagt ctaggtccct 120

atttattttt ttatagttat gttagtatta agaacgttat ttatatttca aatttttctt 180

ttttttctgt acagacgcgt gtacgcatgt aacattatac tgaaaacctt gcttgagaag 240

gttttgggac gctcgaaggc tttaatttgc aagctgcggc cctgcattaa tgaatcggcc 300

aacgcgcaaa ttgtaaacgt taatattttg ttaaaattcg cgttaaattt ttgttaaatc 360

agctcatttt ttaaccaata ggccgaaatc ggcaaaatcc cttataaatc aaaagaatag 420

accgagatag ggttgagtgt tgttccagtt tggaacaaga gtccactatt aaagaacgtg 480

gactccaacg tcaaagggcg aaaaaccgtc tatcagggcg atggcccact acgtgaacca 540

tcaccctaat caagtttttt ggggtcgagg tgccgtaaag cactaaatcg gaaccctaaa 600

gggagccccc gatttagagc ttgacgggga aagccggcga acgtggcgag aaaggaaggg 660

aagaaagcga aaggagcggg cgctagggcg ctggcaagtg tagcggtcac gctgcgcgta 720

accaccacac ccgccgcgct taatgcgccg ctacagggcg cgtcgcgcca ttcgccattc 780

aggctgcgca actgttggga agggcgatcg gtgcgggcct cttcgctatt acgccagctg 840

gcgaaggggg gatgtgctgc aaggcgatta agttgggtaa cgccagggtt ttcccagtca 900

cgacgttgta aaacgacggc cagtgaattg taatacgact cactataggg cgaattggag 960

ctccaccgcg gtggcggccg ctctagaact agtggatccc ccgggctgca ggaattcgat 1020

atcaagctta tcgataccgt cgacctcgag ggggggcccg gtacccagct tttgttccct 1080

ttagtgaggg ttaattccga gcttggcgta atcatggtca tagctgtttc ctgtgtgaaa 1140

ttgttatccg ctcacaattc cacacaacat aggagccgga agcataaagt gtaaagcctg 1200

gggtgcctaa tgagtgaggt aactcacatt aattgcgttg cgctcactgc ccgctttcca 1260

gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc caacgcgcgg ggagaggcgg 1320

tttgcgtatt gggcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg 1380

gctgcggcga gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg 1440

ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa 1500

ggccgcgttg ctggcgtttt tccataggct cggcccccct gacgagcatc acaaaaatcg 1560

acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgttcccccc 1620

tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc 1680

ctttctccct tcgggaagcg tggcgctttc tcaatgctca cgctgtaggt atctcagttc 1740

ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg 1800

ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc 1860

actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga 1920

gttcttgaag tggtggccta actacggcta cactagaagg acagtatttg gtatctgcgc 1980

tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 2040

caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg 2100

atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc 2160

acgttaaggg attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa 2220

ttaaaaatga agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta 2280

ccaatgctta atcagtgagg cacctatctc agcgatctgt ctatttcgtt catccatagt 2340

tgcctgactc cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag 2400

tgctgcaatg ataccgcgtg atccacgctc accggctcca gatttatcag caataaacca 2460

gccagccgga agggccgagc gcagaagtgg tcctgcaact ttatccgcct ccatccagtc 2520

tattaattgt tgccgggaag ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt 2580

tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag 2640

ctccggttcc caacgatcaa ggcgagttac atgatccccc atgttgtgca aaaaagcggt 2700

tagctccttc ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt tatcactcat 2760

ggttatggca gcactgcata attctcttac tgtcatgcca tccgtaagat gcttttctgt 2820

gactggtgag tactcaacca agtcattctg agaatagtgt atgcggcgac cgagttgctc 2880

ttgcccggcg tcaatacggg ataataccgc gccacatagc agaactttaa aagtgctcat 2940

cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag 3000

ttcgatgtaa cccactcgtg cacccaactg atcttcagca tcttttactt tcaccagcgt 3060

ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg 3120

gaaatgttga atactcatac tcttcctttt tcaatattat tgaagcattt atcagggtta 3180

ttgtctcatg agcggataca tatttgaatg tatttagaaa aataaacaaa taggggttcc 3240

gcgcacattt ccccgaaaag tgccacctgg gtccttttca tcacgtgcta taaaaataat 3300

tataatttaa attttttaat ataaatatat aaattaaaaa tagaaagtaa aaaaagaaat 3360

taaagaaaaa atagtttttg ttttccgaag atgtaaaaga ctctaggggg atcgccaaca 3420

aatactacct tttatcttgc tcttcctgct ctcaggtatt aatgccgaat tgtttcatct 3480

tgtctgtgta gaagaccaca cacgaaaatc ctgtgatttt acattttact tatcgttaat 3540

cgaatgtata tctatttaat ctgcttttct tgtctaataa atatatatgt aaagtacgct 3600

ttttgttgaa attttttaaa cctttgttta tttttttttc ttcattccgt aactcttcta 3660

ccttctttat ttactttcta aaatccaaat acaaaacata aaaataaata aacacagagt 3720

aaattcccaa attattccat cattaaaaga tacgaggcgc gtgtaagtta caggcaagcg 3780

atccgtccta agaaaccatt attatcatga cattaaccta taaaaatagg cgtatcacga 3840

ggccctttcg tctcgcgcgt ttcggtgatg acggtgaaaa cctctgacac atgcagctcc 3900

cggagacggt cacagcttgt ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg 3960

cgtcagcggg tgttggcggg tgtcggggct ggcttaacta tgcggcatca gagcagattg 4020

tactgagagt gcaccataat tccgttttaa gagcttggtg agcgctagga gtcactgcca 4080

ggtatcgttt gaacacggca ttagtcaggg aagtcataac acagtccttt cccgcaattt 4140

tctttttcta ttactcttgg cctcctctat ttcttagcat ttttgacgaa atttgctatt 4200

ttgttagagt cttttacacc atttgtctcc acacctccgc ttacatcaac accaataacg 4260

ccatttaatc taagcgcatc accaacattt tctggcgtca gtccaccagc taacataaaa 4320

tgtaagcttt cggggctctc ttgccttcca acccagtcag aaatcgagtt ccaatccaaa 4380

agttcacctg tcccacctgc ttctgaatca aacaagggaa taaacgaatg aggtttctgt 4440

gaagctgcac tgagtagtat gttgcagtct tttggaaata cgagtctttt aataactggc 4500

aaaccgagga actcttggta ttcttgccac gactcatctc catgcagttg gacgatatca 4560

atgccgtaat cattgaccag agccaaaaca tcctccttag gttgattacg aaacacgcca 4620

accaagtatt tcggagtgcc tgaactattt ttatatgctt ttacaagact tgaaattttc 4680

cttgcaataa ccgggtcaat tgttctcttt ctattgggca cacatataat acccagcaag 4740

tcagcatcgg aatctagagc acattctgcg gcctctgtgc tctgcaagcc gcaaactttc 4800

accaatggac cagaactacc tgtgaaatta ataacagaca tactccaagc tgcctttgtg 4860

tgcttaatca cgtatactca cgtgctcaat agtcaccaat gccctccctc ttggccctct 4920

ccttttcttt tttcgaccga attaattctt aatcggcaaa aaaagaaaag ctccggatca 4980

agattgtacg taaggtgaca agctattttt caataaagaa tatcttccac tactgccatc 5040

tggcgtcata actgcaaagt acacatatat tacgatgctg ttctattaaa tgcttcctat 5100

attatatata tagtaatgtc gttgacaccg attatttaaa gctgcagcat acgatatata 5160

tacatgtgta tatatgtata cctatgaatg tcagtaagta tgtatacgaa cagtatgata 5220

ctgaagatga caaggtaatg catcattcta tacgtgtcat tctgaacgag gcgcgctttc 5280

cttttttctt tttgcttttt cttttttttt ctcttgaact cgacggatca tatgcggtgt 5340

gaaataccgc acagatgcgt aaggagaaaa taccgcatca ggagtgatcc cccacacacc 5400

atagcttcaa aatgtttcta ctcctttttt actcttccag attttctcgg actccgcgca 5460

tcgccgtacc acttcaaaac acccaagcac agcatactaa atttcccctc tttcttcctc 5520

tagggtgtcg ttaattaccc gtactaaagg tttggaaaag aaaaaagaga ccgcctcgtt 5580

tctttttctt cgtcgaaaaa ggcaataaaa atttttatca cgtttctttt tcttgaaaat 5640

tttttttttt gatttttttc tctttcgatg acctcccatt gatatttaag ttaataaacg 5700

gtcttcaatt tctcaagttt cagtttcatt tttcttgttc tattacaact ttttttactt 5760

cttgctcatt agaaagaaag catagcaatc taatctaagt tttaattaca aa 5812

<210> 3

<211> 2504

<212> DNA

<213> Artificial sequence

<400> 3

atactagcgt tgaatgttag cgtcaacaac aagaagttta atgacgcgga ggccaaggca 60

aaaagattcc ttgattacgt aagggagtta gaatcatttt gaataaaaaa cacgcttttt 120

cagttcgagt ttatcattat caatactgcc atttcaaaga atacgtaaat aattaatagt 180

agtgattttc ctaactttat ttagtcaaaa aattagcctt ttaattctgc tgtaacccgt 240

acatgcccaa aatagggggc gggttacaca gaatatataa catcgtaggt gtctgggtga 300

acagtttatt cctggcatcc actaaatata atggagcccg ctttttaagc tggcatccag 360

aaaaaaaaag aatcccagca ccaaaatatt gttttcttca ccaaccatca gttcataggt 420

ccattctctt agcgcaacta cagagaacag gggcacaaac aggcaaaaaa cgggcacaac 480

ctcaatggag tgatgcaacc tgcctggagt aaatgatgac acaaggcaat tgacccacgc 540

atgtatctat ctcattttct tacaccttct attaccttct gctctctctg atttggaaaa 600

agctgaaaaa aaaggttgaa accagttccc tgaaattatt cccctacttg actaataagt 660

atataaagac ggtaggtatt gattgtaatt ctgtaaatct atttcttaaa cttcttaaat 720

tctactttta tagttagtct tttttttagt tttaaaacac caagaactta gtttcgaata 780

aacacacata aacaaacaaa atgccattgg ctgcttttaa atacgttatc gataagggtg 840

ctaaagtttc tttgttttta tttttgtact ctttatcatt gtcttttatt actacaacta 900

atatgttgac agaatacatc catcatttca tcaacaactt tgatcaaaag aaaactatgg 960

atcaattgca aactatggtt tcttcaaagg agggtatgat tggtttagct acagctgcag 1020

ttttgatgtc aggtgctgca gtttacaagt ctactagaat cgaaagaggt tgtccacaag 1080

ttccaaacca atcatacttc atgggttcta ctaaagaata cagaaacaac ccagctgctt 1140

ttattgaaaa gtgggaaaag gaattgggtc cagtttacgg tgcttactta ttcggtcaat 1200

acacaactgt tgtttcaggt ccacaagtta gagaagtttt cttgaacgat gatttcgatt 1260

tcatcgcagg tatcagaaga gatttcgata caaatttgtt atctaatggt ggtgacttga 1320

gagatttgcc agttcataag ttcgctggtt ctattaagaa aaatttgtct ccaaagttgc 1380

cattctacac ttcaagagtt attgaacatt tgaagatcgg tttgaaggaa ttctgtggtg 1440

ttgttccaga tgagggtaaa gaattcgatc atgtttaccc attggttcaa catatggttg 1500

ctaaagcatc agcttctgtt tttgttggtc cagaattagc taaaaatgaa caattgatcg 1560

attcttttaa aaatatggtt ttagaagttg gttctgaatt ggctccaaag ccatatttgg 1620

aatttttccc aaatttgatg agattgagaa tgtggttcat cggtaaaaca tctcaaaagg 1680

ttaagagaca tagagatcaa ttgagagctg cattggcacc acaagttgaa tacagattga 1740

aggctatgaa ggaaaacgat tcaaactggg atagaccaaa cgatttcttg caagatatct 1800

tggaatctgg tgacattcca gcacatgttg atgttacaga tcattgttgt gattggatga 1860

ctcaaatcat cttcgctgca ttgcatacaa cttcagaaaa tggtactttg tctttctaca 1920

gattgttgga taacccaaag gttttggaag atttgttgga agaacaaaat caagttttag 1980

aagatgctgg ttacgattct tcagttggtc cagaagtttt tacaagagaa atcttgaata 2040

agttcgttaa gatggattca gttattagag aaacttctag attgagaaac gattacattg 2100

gtttaccaca taagaacatc tcttcaaaga caatcacttt gtcaggtggt gcaatgatta 2160

gaccaggaga aagagcatac gttaacgctt actctaacca tagagatggt acaatccaaa 2220

aggttactga taatttgaaa tcattcgaac catacagatt cgttaaccaa gatagaaatt 2280

ctacaaaaat tggtgaagat ttcattttct ttggtatggg taaacatgca tgtccaggta 2340

gatggttcgc tatccaagaa attaaaacta tcatcgcaat gatgattaga tcatatcaat 2400

tatctgcttt gggtccagtt acatttccaa ctgatgatta ctctagaatt ccaatgggta 2460

gattcaaaat tgttccaaga aaaagtaaag gagaagaact tttc 2504

<210> 4

<211> 1017

<212> DNA

<213> Artificial sequence

<400> 4

tagattcaaa attgttccaa gaaaaagtaa aggagaagaa cttttcactg gagttgtccc 60

aattcttgtt gaattagatg gtgatgttaa tgggcacaaa ttttctgtca gtggagaggg 120

tgaaggtgat gcaacatacg gaaaacttac ccttaaattt atttgcacta ctggaaaact 180

acctgttcca tggccaacac ttgtcactac tttctcttat ggtgttcaat gcttttcaag 240

atacccagat catatgaaac ggcatgactt tttcaagagt gccatgcccg aaggttatgt 300

acaggaaaga actatatttt tcaaagatga cgggaactac aagacacgtg ctgaagtcaa 360

gtttgaaggt gatacccttg ttaatagaat cgagttaaaa ggtattgatt ttaaagaaga 420

tggaaacatt cttggacaca aattggaata caactataac tcacacaatg tatacatcat 480

ggcagacaaa caaaagaatg gaatcaaagt taacttcaaa attagacaca acattgaaga 540

tggaagcgtt caactagcag accattatca acaaaatact ccaattggcg atggccctgt 600

ccttttacca gacaaccatt acctgtccac acaatctgcc ctttcgaaag atcccaacga 660

aaagagagac cacatggtcc ttcttgagtt tgtaacagct gctgggatta cacatggcat 720

ggatgaacta tacaaatagg gcgcgccccg ctgatcctag agggccgcat catgtaatta 780

gttatgtcac gcttacattc acgccctccc cccacatccg ctctaaccga aaaggaagga 840

gttagacaac ctgaagtcta ggtccctatt tattttttta tagttatgtt agtattaaga 900

acgttattta tatttcaaat ttttcttttt tttctgtaca gacgcgtgta cgcatgtaac 960

attatactga aaaccttgct tgagaaggtt ttgggacgct cgaaggcttt aatttgc 1017

<210> 5

<211> 3496

<212> DNA

<213> Artificial sequence

<400> 5

atactagcgt tgaatgttag cgtcaacaac aagaagttta atgacgcgga ggccaaggca 60

aaaagattcc ttgattacgt aagggagtta gaatcatttt gaataaaaaa cacgcttttt 120

cagttcgagt ttatcattat caatactgcc atttcaaaga atacgtaaat aattaatagt 180

agtgattttc ctaactttat ttagtcaaaa aattagcctt ttaattctgc tgtaacccgt 240

acatgcccaa aatagggggc gggttacaca gaatatataa catcgtaggt gtctgggtga 300

acagtttatt cctggcatcc actaaatata atggagcccg ctttttaagc tggcatccag 360

aaaaaaaaag aatcccagca ccaaaatatt gttttcttca ccaaccatca gttcataggt 420

ccattctctt agcgcaacta cagagaacag gggcacaaac aggcaaaaaa cgggcacaac 480

ctcaatggag tgatgcaacc tgcctggagt aaatgatgac acaaggcaat tgacccacgc 540

atgtatctat ctcattttct tacaccttct attaccttct gctctctctg atttggaaaa 600

agctgaaaaa aaaggttgaa accagttccc tgaaattatt cccctacttg actaataagt 660

atataaagac ggtaggtatt gattgtaatt ctgtaaatct atttcttaaa cttcttaaat 720

tctactttta tagttagtct tttttttagt tttaaaacac caagaactta gtttcgaata 780

aacacacata aacaaacaaa atgccattgg ctgcttttaa atacgttatc gataagggtg 840

ctaaagtttc tttgttttta tttttgtact ctttatcatt gtcttttatt actacaacta 900

atatgttgac agaatacatc catcatttca tcaacaactt tgatcaaaag aaaactatgg 960

atcaattgca aactatggtt tcttcaaagg agggtatgat tggtttagct acagctgcag 1020

ttttgatgtc aggtgctgca gtttacaagt ctactagaat cgaaagaggt tgtccacaag 1080

ttccaaacca atcatacttc atgggttcta ctaaagaata cagaaacaac ccagctgctt 1140

ttattgaaaa gtgggaaaag gaattgggtc cagtttacgg tgcttactta ttcggtcaat 1200

acacaactgt tgtttcaggt ccacaagtta gagaagtttt cttgaacgat gatttcgatt 1260

tcatcgcagg tatcagaaga gatttcgata caaatttgtt atctaatggt ggtgacttga 1320

gagatttgcc agttcataag ttcgctggtt ctattaagaa aaatttgtct ccaaagttgc 1380

cattctacac ttcaagagtt attgaacatt tgaagatcgg tttgaaggaa ttctgtggtg 1440

ttgttccaga tgagggtaaa gaattcgatc atgtttaccc attggttcaa catatggttg 1500

ctaaagcatc agcttctgtt tttgttggtc cagaattagc taaaaatgaa caattgatcg 1560

attcttttaa aaatatggtt ttagaagttg gttctgaatt ggctccaaag ccatatttgg 1620

aatttttccc aaatttgatg agattgagaa tgtggttcat cggtaaaaca tctcaaaagg 1680

ttaagagaca tagagatcaa ttgagagctg cattggcacc acaagttgaa tacagattga 1740

aggctatgaa ggaaaacgat tcaaactggg atagaccaaa cgatttcttg caagatatct 1800

tggaatctgg tgacattcca gcacatgttg atgttacaga tcattgttgt gattggatga 1860

ctcaaatcat cttcgctgca ttgcatacaa cttcagaaaa tggtactttg tctttctaca 1920

gattgttgga taacccaaag gttttggaag atttgttgga agaacaaaat caagttttag 1980

aagatgctgg ttacgattct tcagttggtc cagaagtttt tacaagagaa atcttgaata 2040

agttcgttaa gatggattca gttattagag aaacttctag attgagaaac gattacattg 2100

gtttaccaca taagaacatc tcttcaaaga caatcacttt gtcaggtggt gcaatgatta 2160

gaccaggaga aagagcatac gttaacgctt actctaacca tagagatggt acaatccaaa 2220

aggttactga taatttgaaa tcattcgaac catacagatt cgttaaccaa gatagaaatt 2280

ctacaaaaat tggtgaagat ttcattttct ttggtatggg taaacatgca tgtccaggta 2340

gatggttcgc tatccaagaa attaaaacta tcatcgcaat gatgattaga tcatatcaat 2400

tatctgcttt gggtccagtt acatttccaa ctgatgatta ctctagaatt ccaatgggta 2460

gattcaaaat tgttccaaga aaaagtaaag gagaagaact tttcagtaaa ggagaagaac 2520

ttttcactgg agttgtccca attcttgttg aattagatgg tgatgttaat gggcacaaat 2580

tttctgtcag tggagagggt gaaggtgatg caacatacgg aaaacttacc cttaaattta 2640

tttgcactac tggaaaacta cctgttccat ggccaacact tgtcactact ttctcttatg 2700

gtgttcaatg cttttcaaga tacccagatc atatgaaacg gcatgacttt ttcaagagtg 2760

ccatgcccga aggttatgta caggaaagaa ctatattttt caaagatgac gggaactaca 2820

agacacgtgc tgaagtcaag tttgaaggtg atacccttgt taatagaatc gagttaaaag 2880

gtattgattt taaagaagat ggaaacattc ttggacacaa attggaatac aactataact 2940

cacacaatgt atacatcatg gcagacaaac aaaagaatgg aatcaaagtt aacttcaaaa 3000

ttagacacaa cattgaagat ggaagcgttc aactagcaga ccattatcaa caaaatactc 3060

caattggcga tggccctgtc cttttaccag acaaccatta cctgtccaca caatctgccc 3120

tttcgaaaga tcccaacgaa aagagagacc acatggtcct tcttgagttt gtaacagctg 3180

ctgggattac acatggcatg gatgaactat acaaataggg cgcgccccgc tgatcctaga 3240

gggccgcatc atgtaattag ttatgtcacg cttacattca cgccctcccc ccacatccgc 3300

tctaaccgaa aaggaaggag ttagacaacc tgaagtctag gtccctattt atttttttat 3360

agttatgtta gtattaagaa cgttatttat atttcaaatt tttctttttt ttctgtacag 3420

acgcgtgtac gcatgtaaca ttatactgaa aaccttgctt gagaaggttt tgggacgctc 3480

gaaggcttta atttgc 3496

<210> 6

<211> 1604

<212> DNA

<213> Artificial sequence

<400> 6

ggaaaagttg taaatattat tggtagtatt cgtttggtaa agtagagggg gtaatttttc 60

ccctttattt tgttcataca ttcttaaatt gctttgcctc tccttttgga aagctatact 120

tcggagcact gttgagcgaa ggctcattag atatattttc tgtcattttc cttaacccaa 180

aaataaggga aagggtccaa aaagcgctcg gacaactgtt gaccgtgatc cgaaggactg 240

gctatacagt gttcacaaaa tagccaagct gaaaataatg tgtagctatg ttcagttagt 300

ttggctagca aagatataaa agcaggtcgg aaatatttat gggcattatt atgcagagca 360

tcaacatgat aaaaaaaaac agttgaatat tccctcaaaa atgtcgaaag ctacatataa 420

ggaacgtgct gctactcatc ctagtcctgt tgctgccaag ctatttaata tcatgcacga 480

aaagcaaaca aacttgtgtg cttcattgga tgttcgtacc accaaggaat tactggagtt 540

agttgaagca ttaggtccca aaatttgttt actaaaaaca catgtggata tcttgactga 600

tttttccatg gagggcacag ttaagccgct aaaggcatta tccgccaagt acaatttttt 660

actcttcgaa gacagaaaat ttgctgacat tggtaataca gtcaaattgc agtactctgc 720

gggtgtatac agaatagcag aatgggcaga cattacgaat gcacacggtg tggtgggccc 780

aggtattgtt agcggtttga agcaggcggc agaagaagta acaaaggaac ctagaggcct 840

tttgatgtta gcagaattgt catgcaaggg ctccctatct actggagaat atactaaggg 900

tactgttgac attgcgaaga gcgacaaaga ttttgttatc ggctttattg ctcaaagaga 960

catgggtgga agagatgaag gttacgattg gttgattatg acacccggtg tgggtttaga 1020

tgacaaggga gacgcattgg gtcaacagta tagaaccgtg gatgatgtgg tctctacagg 1080

atctgacatt attattgttg gaagaggact atttgcaaag ggaagggatg ctaaggtaga 1140

gggtgaacgt tacagaaaag caggctggga agcatatttg agaagatgcg gccagcaaaa 1200

ctaaacgcac agatattata acatctgcac aataggcatt tgcaagaatt actcgtgagt 1260

aaggaaagag tgaggaacta tcgcatacct gcatttaaag atgccgattt gggcgcgaat 1320

cctttatttt ggcttcaccc tcatactatt atcagggcca gaaaaaggaa gtgtttccct 1380

ccttcttgaa ttgatgttac cctcataaag cacgtggcct cttatcgaga aagaaattac 1440

cgtcgctcgt gatttgtttg caaaaagaac aaaactgaaa aaacccagac acgctcgact 1500

tcctgtcttc ctattgattg cagcttccaa tttcgtcaca caacaaggtc ctagcgacgg 1560

ctcacaggtt ttgtaacaag caatcgaagg ttctggaatg gcgg 1604

<210> 7

<211> 534

<212> DNA

<213> Artificial sequence

<400> 7

agttataaaa aaaataagtg tatacaaatt ttaaagtgac tcttaggttt taaaacgaaa 60

attcttattc ttgagtaact ctttcctgta ggtcaggttg ctttctcagg tatagcatga 120

ggtcgctctt attgaccaca cctctaccgg catgccgaaa agaaagtgga atattcattc 180

atatcatatt ttttctatta actgcctggt ttcttttaaa ttttttattg gttgtcgact 240

tgaacggagt gacaatatat atatatatat atttaataat gacatcatta tctgtaaatc 300

tgattcttaa tgctattcta gttatgtaag agtggtcctt tccataaaaa aaaaaaaaaa 360

gaaaaaagaa ttttaggaat acaatgcagc ttgtaagtaa aatctggaat attcatatcg 420

ccacaacttc ttatgcttat aaaagcacta atgcctggcg aagaggcccg caccgatcgc 480

ccttcccaac agttgcgcag cctgaatgga cgacgttgta aaacgacggc cagt 534

<210> 8

<211> 2081

<212> DNA

<213> Artificial sequence

<400> 8

tcctctaatc aggttccacc aaacagatac cccggtgttt cacggaatgg tacgtttgat 60

atcgctgatt tgagaggagg ttacacttga agaatcacag tcttgcgacc ggctattcaa 120

caaggcattc ccccaagttt gaattctttg aaatagattg ctattagcta gtaatccacc 180

aaatccttcg ctgctcacca atggaatcgc aagatgccca cgatgagact gttcaggtta 240

aacgcaaaag aaacacactc tgggaatttc ttcccaaatt gtatctctca atacgcatca 300

acccatgtca attaaacacg ctgtatagag actaggcaga tctgacgatc acctagcgac 360

tctctccacc gtttgacgag gccatttaca aaaacataac gaacgacaag cctactcgaa 420

ttcgtttcca aactcttttc gaacttgtct tcaactgctt tcgcatgaag tacctcccaa 480

ctacttttcc tcacacttgt actccatgac taaacccccc ctcccattac aaactaaaat 540

cttactttta ttttcttttg ccctctctgt cgctctgcct taactacgta tttctcgccg 600

agaaaaactt caatttaagc tattctccaa aaatcttagc gtatattttt tttccaaagt 660

gacaggtgcc ccgggtaacc cagttcatgt ctgcccctaa gaagatcgtc gttttgccag 720

gtgaccacgt tggtcaagaa atcacagccg aagccattaa ggttcttaaa gctatttctg 780

atgttcgttc caatgtcaag ttcgatttcg aaaatcattt aattggtggt gctgctatcg 840

atgctacagg tgttccactt ccagatgagg cgctggaagc ctccaagaag gctgatgccg 900

ttttgttagg tgctgtgggt ggtcctaaat ggggtaccgg tagtgttaga cctgaacaag 960

gtttactaaa aatccgtaaa gaacttcaat tgtacgccaa cttaagacca tgtaactttg 1020

catccgactc tcttttagac ttatctccaa tcaagccaca atttgctaaa ggtactgact 1080

tcgttgttgt cagagaatta gtgggaggta tttactttgg taagagaaag gaagacgatg 1140

gtgatggtgt cgcttgggat agtgaacaat acaccgttcc agaagtgcaa agaatcacaa 1200

gaatggccgc tttcatggcc ctacaacatg agccaccatt gcctatttgg tccttggata 1260

aagctaatgt tttggcctct tcaagattat ggagaaaaac tgtggaggaa accatcaaga 1320

acgaattccc tacattgaag gttcaacatc aattgattga ttctgccgcc atgatcctag 1380

ttaagaaccc aacccaccta aatggtatta taatcaccag caacatgttt ggtgatatca 1440

tctccgatga agcctccgtt atcccaggtt ccttgggttt gttgccatct gcgtccttgg 1500

cctctttgcc agacaagaac accgcatttg gtttgtacga accatgccac ggttctgctc 1560

cagatttgcc aaagaataag gtcaacccta tcgccactat cttgtctgct gcaatgatgt 1620

tgaaattgtc attgaacttg cctgaagaag gtaaggccat tgaagatgca gttaaaaagg 1680

ttttggatgc aggtatcaga actggtgatt taggtggttc caacagtacc accgaagtcg 1740

gtgatgctgt cgccgaagaa gttaagaaaa tccttgctta aatactagcg ttgaatgtta 1800

gcgtcaacaa caagaagttt aatgacgcgg aggccaaggc aaaaagattc cttgattacg 1860

taagggagtt agaatcattt tgaataaaaa acacgctttt tcagttcgag tttatcatta 1920

tcaatactgc catttcaaag aatacgtaaa taattaatag tagtgatttt cctaacttta 1980

tttagtcaaa aaattagcct tttaattctg ctgtaacccg tacatgccca aaataggggg 2040

cgggttacac agaatatata acatcgtagg tgtctgggtg a 2081

<210> 9

<211> 705

<212> DNA

<213> Artificial sequence

<400> 9

agtctaggtc cctatttatt tttttatagt tatgttagta ttaagaacgt tatttatatt 60

tcaaattttt cttttttttc tgtacagacg cgtgtacgca tgtaacatta tactgaaaac 120

cttgcttgag aaggttttgg gacgctcgaa ggctttaatt tgcaagctgc ggccctgcat 180

taatgaatcg gccaacgcgc ctcactattt tttactgcgg aagcggaagc ggaaaatacg 240

gaaacgcgcg ggaacataca aaacatacaa aatatacctt tctcacacaa gaaatatatg 300

ctacttgcaa aatatcatac caaaaaactt ttcacaaccg aaaccaaaac caacggatat 360

catacattac actaccacca ttcaaacttt actactatcc tcccttcagt ttcccttttt 420

ctgccttttt cggtgacgga aatacgcttc agagacccta aagggaaatc catgccataa 480

caggaaagta acatcccaat gcggactata ccaccccacc acactcctac caataacggt 540

aactattcta tgttttctta ctcctatgtc tattcatctt tcatctgact acctaatact 600

atgcaaaaat gtaaaatcat cacacaaaac ataaacaatc aaaatcagcc atttccgcac 660

cttttcctct gtccactttc aaccgtccct ccaaatgtaa aatgg 705

<210> 10

<211> 2960

<212> DNA

<213> Artificial sequence

<400> 10

acgcacagat attataacat ctgcacaata ggcatttgca agaattactc gtgagtaagg 60

aaagagtgag gaactatcgc atacctgcat ttaaagatgc cgatttgggc gcgaatcctt 120

tattttggct tcaccctcat actattatca gggccagaaa aaggaagtgt ttccctcctt 180

cttgaattga tgttaccctc ataaagcacg tggcctctta tcgagaaaga aattaccgtc 240

gctcgtgatt tgtttgcaaa aagaacaaaa ctgaaaaaac ccagacacgc tcgacttcct 300

gtcttcctat tgattgcagc ttccaatttc gtcacacaac aaggtcctag cgacggctca 360

caggttttgt aacaagcaat cgaaggttct ggaatggcgg gaaagggttt agtaccacat 420

gctatgatgc ccactgtgat ctccagagca aagttcgttc gatcgtactg ttactctctc 480

tctttcaaac agaattgtcc gaatcgtgtg acaacaacag cctgttctca cacactcttt 540

tcttctaacc aagggggtgg tttagtttag tagaacctcg tgaaacttac atttacatat 600

atataaactt gcataaattg gtcaatgcaa gaaatacata tttggtcttt tctaattcgt 660

agtttttcaa gttcttagat gctttctttt tctctttttt acagatcatc aaggaagtaa 720

ttatctactt tttacaacaa atataaaaca atggatctcc ctacagcaac tgatatcaat 780

gaaaaaccca aattgtccaa ggaagaacaa gatccacgca atttcgtaaa gttaatgaac 840

gatcagaatc gaaatgaatt gatcatcttt tatggttctc aaactggtac tggtgaagac 900

tatgcgcaac gcttgggaaa ggaatgcaag aagcgattca acatacaacc aatggtggcc 960

gatctagaaa actatgatct tggctatttg gatacactcc ccaaggaaac gattgccgtg 1020

tttgttatct ctacttatgg tgaaggcgac cctacggata gtgcagtcaa cttttgggaa 1080

ctcttgaaca aggatgtacc taccttctct aaaggttgcg cggtggaacg acctcttaaa 1140

gatttacgct actttgtctt tgggcttggc aatcgaacgt atgaatactt taatggagca 1200

gctattggag tggataaaca acttactcag cttggtgcaa cacgattggg cgaagtagga 1260

atgggggatg atgataactc tttggaagac gattttattc aatggcaaga tcaagtatgg 1320

cctttattag cggatgcttt agcgacaagc acggatacag tggatgaaca agcacaagca 1380

caacatgcgt acaaggtgat gatgggccaa gaaaaggaag atgaatcatt ttactatatg 1440

ggtgagcttg gcgatactca gcttacaaca tggagtgcga agcgacctta ccctgcacct 1500

gtcaagattc atgacctcac acctgcttct cgtgatcaac gtcattgctt acacctggat 1560

gtggacttgt ccaacagcaa catctcttat actactggcg atcatctcgg tatttggcct 1620

acgaacaacg aagacgaagt gtttttggta tctagtcttt ttggttggaa tgacgcttat 1680

ctggatcaag taatcaatgt tgttcccaca gattccacca acaaacctcc attcccccag 1740

cctaccacct tacggtctgc tcttcgtcat tacttggata ttgctcaact tccttctcga 1800

tctactcttg atttactgct tccttcttgc tcaaacgaca gcctaaagtc tttcttacag 1860

aacttggtca acgataaaga tgaacacaag cgggtggtat tggatcaagt tcgtaacctg 1920

ggccagcttc tctcttttgc tttggaaact attggatcca cgactactga tggtgctttg 1980

aaggatatac ccgtggaagt tgtattggaa tgctactctc ggcttcaacc tcgttattac 2040

tctatatcat catcatccag cgaatcagca actacagtta gtgcgaccgc tgtcactttg 2100

aaatacaacc caactcctga tcgaactgta tatggcgtga acaccaatta cctttgggcg 2160

atccatcaat caatgtcatc gactccatca tcggatgtgc caaagtatgt agtggatggg 2220

ccgcgtcaac aatatctgat caccaaggaa gccaacagcg actcgattaa aatcaagatt 2280

cctgtacata ttcgcaaatc caccttccgt ctacctcctt catcaagcac tcctgtcatt 2340

atggttggtc ctggtactgg tgttgctcct ttccgtggat ttgtacgtga acgtgtctac 2400

caaaagcaag tcttgggcga agatgttggt gctactgtcc tcttctttgg ctgccgacga 2460

tccaccgaag actatcttta tgctgacgaa tggccaagat tattcaagtc cctgggaaat 2520

ggtccttcta gaatcatcac cgccttctct agagaatctg aagaaaagaa ggtctacgta 2580

cagcaacgac tagccgaaca tggacaggaa atgtgggact tgttggcaaa tcaaggggct 2640

tacttttatg tctgtggtga tgcaaagtat atggcgaagg atgtgcaaca aaccgtgatc 2700

gacatggcaa agtcttttgg tggtcttggc gataacgaag ctactacctt tattcaagaa 2760

ttacggaaat ccaatcgata tgtggaagac gtgtgggcat agagttataa aaaaaataag 2820

tgtatacaaa ttttaaagtg actcttaggt tttaaaacga aaattcttat tcttgagtaa 2880

ctctttcctg taggtcaggt tgctttctca ggtatagcat gaggtcgctc ttattgacca 2940

cacctctacc ggcatgccga 2960

Claims (10)

1. The recombinant strain is prepared according to a method comprising the following steps: improving the activity of SRP14 protein in the saccharomyces cerevisiae on the chassis or the expression quantity of the coding gene thereof to obtain recombinant bacteria;

the saccharomyces cerevisiae with the chassis is a saccharomyces cerevisiae for expressing a protein coding gene of a hydrocortisone synthesis system;

the coding gene of the protein related to the hydrocortisone synthesis system comprises a CYP5311B2 protein coding gene and an AoCPR protein coding gene.

2. The recombinant bacterium according to claim 1, wherein: the method for improving the activity of the SRP14 protein in the saccharomyces cerevisiae chassis or the expression quantity of the encoding gene thereof is to introduce the SRP14 protein encoding gene or an expression cassette containing the encoding gene into the saccharomyces cerevisiae chassis.

3. The recombinant bacterium according to claim 2, wherein: the SRP14 protein coding gene or the expression cassette containing the coding gene is introduced in a plasmid form.

4. The recombinant bacterium according to any one of claims 1 to 3, wherein: the saccharomyces cerevisiae with the base plate is prepared by the following method: and integrating the DNA molecule containing the CYP5311B2 protein coding gene and the DNA molecule containing the AoCPR protein coding gene into the genome of the host saccharomyces cerevisiae to obtain the recombinant strain.

5. The recombinant bacterium according to claim 4, wherein:

the DNA molecule containing CYP5311B2 protein coding gene is integrated at rDNA locus of host saccharomyces cerevisiae genome;

the DNA molecule containing the AoCPR protein coding gene is integrated at the Gal7 locus of the host Saccharomyces cerevisiae genome.

6. A method for producing the recombinant bacterium according to any one of claims 1 to 5, comprising the steps of: is prepared by a process according to any one of claims 1 to 5; obtaining the recombinant strain.

7. Use of the recombinant bacterium of any one of claims 1-5 in at least one of:

1) producing hydrocortisone;

2) the yield of hydrocortisone is improved;

3) preparing a product for producing hydrocortisone;

4) preparing a product for improving the yield of hydrocortisone;

or, the SRP14 protein is applied to improving the hydrocortisone synthesis capacity of saccharomyces cerevisiae;

or, the SRP14 protein is applied to improving the synthetic capacity of hydrocortisone of saccharomyces cerevisiae via improving the expression quantity of the CYP5311B2 protein coding gene in a hydrocortisone synthetic system of saccharomyces cerevisiae;

the saccharomyces cerevisiae with the chassis is a saccharomyces cerevisiae for expressing a protein coding gene of a hydrocortisone synthesis system.

8. A method of producing hydrocortisone comprising the steps of: obtaining hydrocortisone by catalyzing a substrate RSA with the recombinant bacterium as described in any one of claims 1-5.

9. A method for improving the capability of saccharomyces cerevisiae to produce hydrocortisone comprises the following steps A) or B):

A) the method comprises the steps of improving the expression quantity of CYP5311B2 coding genes in a hydrocortisone synthesis system in saccharomyces cerevisiae via SRP14 protein, so as to improve the synthetic capacity of the hydrocortisone of the strain;

B) the method comprises the steps of improving the expression of CYP5311B2 protein in a hydrocortisone synthesis system in saccharomyces cerevisiae via SRP14 protein, so as to improve the synthetic capacity of the hydrocortisone of the strain;

the saccharomyces cerevisiae with the chassis is a saccharomyces cerevisiae for expressing a protein coding gene of a hydrocortisone synthesis system.

10. The method of claim 9, wherein:

the various methods include the steps of:

1) preparing the recombinant bacterium of any one of claims 1-5;

2) the recombinant bacterium is used for catalyzing a substrate RSA to improve the capability of producing hydrocortisone by saccharomyces cerevisiae.

Images