CN114231566B - R26-e (CN 362-1) carrier and preparation method thereof - Google Patents

Abstract

The invention relates to an R26-e (CN 362-1) vector, which comprises a 5 'homology arm of a Rosa26 site, a PTight promoter, a urokinase type plasminogen activator gene, a first ployA, an albumin promoter Alb promoter, a tetracycline transactivator, a second ployA and a 3' homology arm of the Rosa26 site, and the connection sequence of the elements is shown in figure 5. The invention connects the target fragment in the original slow virus plasmid CN362 to the Rosa26-Ins carrier by PCR and information technology to construct the targeting plasmid. The targeting plasmid contained a 3.3kb 5' -homology arm; 3.3kb 3' -homology arm, can realize fusion and stable inheritance of sequences at two ends of the Rosa26 locus chromosome.

Description

R26-e (CN 362-1) carrier and preparation method thereof

Technical Field

The invention belongs to the technical field of biological gene engineering, and relates to a recombinant vector of R26-e (CN 362-1) and a preparation method thereof.

Background

Viral hepatitis is one of the major problems endangering public health worldwide, and has strong infectivity and high mortality. In particular, the prevalence of viral hepatitis caused by five hepadnaviruses, hepatitis A Virus (HAV), hepatitis B Virus (HBV), hepatitis C Virus (HCV), hepatitis D Virus (HDV) and Hepatitis E Virus (HEV), presents a locally sudden increase. At present, although vaccines for preventing hepatitis A and B viruses and some methods for treating hepatitis B and C viruses are available, viral infection is not completely controlled. This is due to the directionality of these pathogens to the owner, severely limiting their research.

Although the study of chimpanzees has been the only means to decipher the pathogenic mechanisms of pathogens and to verify vaccine efficacy and antiviral drug screening; but their low rate of chronic infection and lack of liver fibrosis, high cost, small queue size, etc. and ethical considerations limit their use. Inexpensive small animal models such as mice are the most suitable option for these studies. Some components in mice differ from humans, in particular their immune system. The mouse model carrying human liver cells with good combined function is a model urgently needed for hepatitis virus research. Such a double-system reconstituted humanized mouse can be reconstituted by co-injecting human cd34+ Hematopoietic Stem Cells (HSCs) and adult hepatocytes into an immunodeficient mouse while also improving liver chimerism. Recent studies have shown that: the co-transplantation is beneficial to reconstructing the human immune system in the chimeric liver, and the human immune cells including Kupffer cells, DC cells and NK cells are closely co-located with the human liver cells; human hepatocytes produce IL-3, IL-15, GM-CSF, M-CSF, MCP-1, CXCL-1 and CXCL-10, which are important for migration, development, differentiation of human immune cells and have no cross-reactivity with mice. This human immune system with reconstitution in the liver is very suitable for the study of viral hepatitis pathogenesis.

Alternative humanized mouse construction modes now include: plasminogen activator (uPA+/+) mouse mode, fumarylacetoacetic acid hydrolase (Fah-/-) mouse mode, TK-NOG transgenic mouse mode, and AFC8 mode. Albumin-plasminogen activator (Alb-uPA) transgenic mice were first used to construct a humanized mouse model for hepatitis virus infection studies, where uPA expression in hepatocytes can cause hepatocyte damage, allowing selective expansion of mice or human hepatocytes after transplantation to achieve growth advantage, but limiting its widespread use due to uncontrolled liver damage. Double chimeric mice (AFC 8-Hu HSC/Hep) established in AFC8 mode, which support HCV infection in the liver and generate human T cell responses to HCV; HCV infection causes liver inflammation, and activation of astrocytes induces expression of human fibroblast genes and liver fibrosis after transformation into chronic inflammation. However, the model is extremely complicated to operate, the death rate of mice is high, and no further report is seen.

The lentiviral plasmid with biological function is successfully constructed for the first time in the earlier stage of the subject group; effective control of Alb-uPA gene expression at the cellular level is achieved. Although these studies have been carried out, experimental data are mainly derived from in vitro cell culture models, whether they can be used in animal models or not yet further validated. We have tried to randomly inject the gene plasmid of interest into fertilized eggs of mice by means of prokaryotic injection; the sequence of the target genes and the regulatory genes in the lentiviral plasmid is optimized again, and then the target genes and the regulatory genes are injected into fertilized eggs of mice in a prokaryotic injection mode. Mice either do not express or random expression is uncontrolled and more passable, and do not achieve good results.

The invention creates a new chimeric mouse model which can realize human liver substitution and has no mouse immune component in the deep research, so as to lay the foundation for the deep research of infectious disease pathogenesis of viral hepatitis and hepadnavirus infection and antiviral drug development.

Disclosure of Invention

In view of the above, the present invention aims to provide a recombinant vector of R26-e (CN 362-1) and a construction method thereof.

In order to achieve the above purpose, the present invention provides the following technical solutions:

1. An R26-e (CN 362-1) vector comprising a 5 'homology arm of the Rosa26 site, PTight promoter, urokinase type plasminogen activator gene, ployA1, albumin promoter Alb promoter, tetracycline transactivator, ployA2 and 3' homology arm of the Rosa26 site, the sequence of the above elements being as shown in FIG. 5.

Further, the tetracycline trans-acting factor is M2rtTA.

Further, the nucleotide sequence of PTight promoter is shown in 4685 to 5008 positions of SEQ ID No. 15.

Further, the nucleotide sequence of urokinase type plasminogen activator gene is shown in 5021 to 6322 of SEQ ID No. 15.

Further, the nucleotide sequence of the albumin promoter is shown in 6712..9054 of SEQ ID No. 15.

2. A preparation method of an R26-e (CN 362-1) carrier comprises the following specific steps:

a. PCR amplification is carried out by taking a plasmid of a bgh polyA element as a template to obtain a target fragment polyA1, and the target fragment polyA1 is recombined into a carrier CN362 to obtain a CN362-polyA1 carrier;

b. then, the plasmid of the bgh polyA element is used as a template for PCR amplification to obtain a target fragment polyA2, and the target fragment polyA2 is recombined into a carrier CN362-polyA 1to obtain a CN362-polyA2 carrier;

c. The target fragment CN362-polyA2 is obtained by PCR amplification by taking a CN362-polyA2 vector as a template, and is recombined into a vector Rosa26-Ins, and a R26-e (CN 362) -1 vector.

Further, the vector CN362 plasmid map is shown in fig. 1.

Further, in step a, the primer pair sequences used for PCR amplification are shown as SEQ ID No.1 and SEQ ID No. 2.

Further, in step b, the primer pair sequences used for PCR amplification are shown as SEQ ID No.3 and SEQ ID No. 4.

Further, in step c, the primer pair sequences used for PCR amplification are shown as SEQ ID No.5 and SEQ ID No. 6.

Further, the restriction enzymes used in the recombination were NotI, kpnI, xhoI, respectively.

The invention has the beneficial effects that: the invention connects a target fragment pTight-UPA-bgh ploya-ALB Promoter-Tet-on-WPRE-included-bgh ploya in an original lentiviral plasmid CN362 to a Rosa26-Ins vector through the PCR and information technology, and constructs a targeting plasmid for a mouse with a Rosa26 locus knockin by using the CRISPR/Cas9 technology. The targeting plasmid contained a 3.3kb 5' -homology arm; 3.3kb 3' -homology arm, can realize fusion and stable inheritance of sequences at two ends of the Rosa26 locus chromosome. The invention also discloses a part of methods for preparing the ROSA26 gene mutation and the uPA expression animal rich in tet-on regulation ALB promoter restriction expression by utilizing the targeting plasmid, and the uPA gene can be successfully knocked in at a fixed point on the ROSA26 locus. The CRISPR/Cas9 system is adopted to be injected into fertilized eggs of NOD/SCID mice through microinjection, a mouse model for limiting the expression of uPA in livers is successfully constructed, a humanized liver mouse model can be further constructed by utilizing the mouse model for limiting the expression of uPA to cause liver injury, and a foundation is laid for deep research on infectious disease pathogenesis of viral hepatitis and hepadnavirus infection and antiviral drug development by using the humanized liver mouse model.

Drawings

In order to make the objects, technical solutions and advantageous effects of the present invention more clear, the present invention provides the following drawings for description:

FIG. 1 is a plasmid map of vector CN 362.

FIG. 2 shows the resulting CN362-polyA1 plasmid map after recombination.

FIG. 3 shows the resulting CN362-polyA2 plasmid map after recombination.

FIG. 4 is a Rosa26-Ins plasmid map.

FIG. 5 is a map of the Rosa26-Ins-CN362-Ins plasmid obtained after recombination.

FIG. 6 shows a 1% agarose gel electrophoresis of fragments of interest polyA1 and polyA2 obtained by PCR amplification.

FIG. 7 is a PCR electrophoresis diagram of the CN362-polyA2 target fragment.

FIG. 8 is an electrophoretogram showing the results of NotI cleavage of the CN362 plasmid.

FIG. 9 is an electrophoresis chart of the result of KpnI cleavage of the CN362-polyA1 plasmid.

FIG. 10 is an electrophoretogram of the results of XhoI cleavage of the Rosa26-Ins plasmid.

FIG. 11 shows the results of uPA expression detection.

FIG. 12 shows the results of ALT expression assay.

FIG. 13 shows the results of ALb expression test.

FIG. 14 is a schematic representation of the F0 generation mouse identification strategy.

FIG. 15 shows the results of PCR identification electrophoresis of 5 '-and 3' -homology arms of F1 mice.

FIG. 16 shows the results of in vitro transcribed gRNA and Cas9 electrophoresis.

Fig. 17 is a photograph of untreated mouse liver HE staining after induction of doxycycline.

Fig. 18 is a photograph of untreated mouse liver HE staining after induction of doxycycline.

FIG. 19 is a graph of HE staining of mouse liver sections after transplantation of human hepatocytes.

FIG. 20 is a graph of HE staining of mouse liver sections after transplantation of human hepatocytes.

Detailed Description

Preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings. The experimental methods for which specific conditions are not specified in the examples are generally conducted under conventional conditions or under conditions recommended by the manufacturer.

Example 1

Reagent: restriction endonucleases NotI, xhoI, kpnI were purchased from Takara company; cloning recombination reagent In-FusionR HD Cloning Kit User Manual available from Takara; PCR-related reagents were purchased from Takara corporation; conventional chemical reagents were purchased mainly from Sigma; the universal Rosa site vector Rosa26-Ins was derived from Shanghai, mode biotechnology, inc; the CN362 plasmid was maintained in this unit (first affiliated nosocomial infections at army university), and was the JGY-PLV vector in application number 201210102188.1. Glue recovery KitQIAquick glue recovery kit was purchased from Shanghai Yubo biotechnology Co. Primer: synthesized from the division of biological engineering (Shanghai).

1. The target fragment polyA1 is obtained by PCR amplification by using a plasmid containing a bgh polyA element as a template and pairing CN36-NotI-PA-F and CN36-NotI-PA-R primers; the target fragment polyA2 was obtained by PCR amplification using a plasmid containing a bgh polyA element as a template and the pair of CN36-KpnI-PA-F and CN36-KpnI-PA-R primers, the primer tables being shown in Table 1.

TABLE 1 primer list

Primer name (number)	Sequence(s)	Sequence number
			CN36-NotI-PA-F(I)	tccaccggtgcggccctagagctcgctgatcagcc	SEQ ID No.1
CN36-NotI-PA-R(II)	gaagctagagcggcctccccagcatgcctgctatt	SEQ ID No.2
			CN36-KpnI-PA-F(III)	ccagtcacacctcagctagagctcgctgatcagcc	SEQ ID No.3
CN36-KpnI-PA-R(IV)	tcattggtcttaaagctcgagtccccagcatgcctgctatt	SEQ ID No.4
			Rosa26-CN362-P-F	ggggctgtccctcgaattacagggacagcagagatccagtttggttagta	SEQ ID No.5
Rosa26-CN362-P-R	gaggatggggctcgagtggctaagatctacagctgccttgtaagt	SEQ ID No.6

2. Recombinant vector construction method

DNA recombination method is referred to In-FusionR HD Cloning Kit instructions, vector CN362 plasmid was cut by NotI cleavage to generate cohesive ends, the target fragment polyA1 was amplified by PCR, and the fragment was amplified by In-FusionR The resulting fragment of interest was recombined with the digested vector by HD Cloning Kit enzyme. A schematic diagram of the lentiviral vector CN362 plasmid is shown in FIG. 1. Through In-FusionR The HD Cloning Kit enzyme recombines the target fragment and the digested vector, and a CN362-polyA1 plasmid map is obtained after recombination and is shown in figure 2. NotI cleavage System (50. Mu.l) used in vector recombination: mu.l of 10 XH Buffer, 3.0. Mu.l of NotI, 15. Mu.l of CN362 (about 200 ng/ul), 27. Mu.l of ddH ₂ O. The reaction conditions of the PCR reaction system (20μl)：ddH₂O 11.4μl;5×PrimeStar GXL PCR Buffer 4μl,2.5mMdNTP 2μl,Primer I(10pmol/μl)0.4μl,Primer II(10pmol/μl)0.4μl,PrimeStar GXL DNA Polymerase(TaKaRa,Code No：R050A)0.8μl,ES cell genomic DNA 1μl.PCR are shown in Table 2. The results of NotI cleavage of the CN362 plasmid are shown in FIG. 8.

After preparation according to NotI cleavage system, the mixture was digested in a water bath at 37℃for 2.5 hours, 5ul of 10X Loading Buffer was added thereto, and 1% agarose gel electrophoresis was performed.

And (5) measuring the concentration after gel block purification, and using a QIAquick gel recovery kit. Preparation before experiment: 120ml of absolute ethyl alcohol is added into Buffer PE, and the mixture is uniformly mixed, and then marked. The conversion volume of 100mg gel block is about 100ul, the volume of the added sol Buffer QG is about 3 times of the volume of the gel block, the color of the system is observed after dissolution, the color is a pH indicator, the system is normal in a proper range, and the dosage of the sol is adjusted if the pH is not consistent. Shaking uniformly after sol in a 56 ℃ water bath, passing through a recovery column sleeved with a collecting pipe, short centrifuging, discarding liquid in the collecting pipe, passing the rest sol liquid system through the column according to the step, washing once by using 700ul Buffer PE added with absolute ethyl alcohol before, discarding the liquid in the collecting pipe, performing air centrifugation at 13000rpm for 1min, placing the collecting column into a new EP pipe after centrifugation, adding eluent (water) above a filter membrane in the column according to the required quantity, centrifuging at 13000rpm for 1min, discarding the recovery column, measuring the concentration of the liquid in the EP pipe, and completing the recovery of the gel.

Table 2 PCR reaction conditions:

Step#	Temp(℃)	Time	Note
				1	98	5min	-
2	98	20sec	-
				3	50-70	20sec	-
4	68	30sec	repeat steps 2-4for 35cycles
				5	68	5min	-
6	12	-	hold

In-FusionR In-fusion system (10 ul) In HD Cloning Kit User Manual: notI cleavage CN362 plasmid (20 ng/ul), poly A1 (200 ng/ul) 0.4ul,5 XIn-Fusion 2ul, ddH ₂ O3.6 ul. Mixing the above systems, placing into a PCR instrument, reacting at 50deg.C for 15min, and directly converting the product.

Example 2

Then cutting the constructed carrier CN362-polyA1 plasmid by KpnI enzyme cutting to generate a sticky end, amplifying by PCR to obtain a target fragment polyA2, and passing through In-FusionR The resulting fragment of interest was recombined with the digested vector by HD Cloning Kit enzyme. The recombinant CN362-polyA2 plasmid map is shown in FIG. 3. KpnI cleavage System (50. Mu.l) used in vector recombination: 10 XL Buffer 5. Mu.l, kpnI 3.0. Mu.l, CN362-polyA1 plasmid (about 200 ng/ul) 15. Mu.l, ddH ₂ O27. Mu.l. The reaction conditions of the PCR reaction system (20μl)：ddH₂O 11.4μl;5×PrimeStar GXL PCR Buffer 4μl,2.5mMdNTP 2μl,Primer III(10pmol/μl)0.4μl,Primer IV(10pmol/μl)0.4μl,PrimeStar GXL DNA Polymerase(TaKaRa,Code No：R050A)0.8μl,ES cell genomic DNA 1μl.PCR are as shown in Table 2 of example 1. After the system was prepared as shown in the table, the mixture was digested in a water bath at 37℃for 2.5 hours, and 5ul of 10X Loading Buffer was added thereto to carry out 1% agarose gel electrophoresis. Concentration was measured after gel purification: the method is the same as above and will not be described again. The 1% agarose gel electrophoresis of the target fragments polyA1 and polyA2 obtained by PCR amplification is shown in FIG. 6, and the data provided by the reagent manufacturers are referenced: 0.5ug/lane,8cm length gel,1 XTAE, 7V/cm,45min, and the like, and can be adjusted according to actual operations. The result of PCR electrophoresis of the CN362-polyA2 target fragment is shown in FIG. 7. The result of KpnI cleavage of the CN362-polyA1 plasmid is shown in FIG. 9.

In-FusionR In-fusion system (10 ul) In HD Cloning Kit User Manual: kpnI cleaves 3.2ul of CN362 plasmid (25 ng/ul), 0.4ul of poly A2 (200 ng/ul), 5 XIn-Fusion 2ul, ddH ₂ O4.4 ul. Mixing the above systems, placing into a PCR instrument, reacting at 50deg.C for 15min, and directly converting the product.

Example 3

The vector Rosa26-Ins plasmid was cut by XhoI cleavage to generate cohesive ends, the Rosa26-CN362-P-F primer and the Rosa26-CN362-P-R primer were paired, the constructed plasmid CN362-polyA2 was used as template for PCR amplification to give the desired fragment CN362-polyA2, and the fragment was amplified by In-FusionR The resulting fragment of interest was recombined with the digested vector by HD Cloning Kit enzyme. The Rosa26-Ins plasmid map is shown in FIG. 4. XhoI cleavage System (50. Mu.l) used in vector recombination: mu.l of 10 XH Buffer, 3.0. Mu.l of XhoI, 15. Mu.l of Rosa26-Ins (about 200 ng/ul), 27. Mu.l of ddH ₂ O. The reaction conditions of the PCR reaction system (20μl)：ddH₂O 11.4μl;5×PrimeStar GXL PCR Buffer 4μl,2.5mMdNTP2μl,Rosa26-CN362-P-F(10pmol/μl)0.4μl,Rosa26-CN362-P-R(10pmol/μl)0.4μl,PrimeStar GXL DNA Polymerase(TaKaRa,Code No：R050A)0.8μl,ES cell genomic DNA 1μl.PCR are as shown in Table 2 of example 1. The plasmid map of Rosa26-Ins-CN362-Ins (R26-e (CN 362) -1) obtained after recombination is shown in FIG. 5. The results of XhoI digestion of the Rosa26-Ins plasmid are shown in FIG. 10. The plasmid sequence is shown as SEQ ID No.15, wherein Location/Qualifiers：90..3389/note＝"5arm";3390..3410/note＝"nRosa-test-r2";3417..4620/note＝"Ins";4625..4684/note＝"60";4685..5008/vntifkey＝"21"/label＝pTight;5021..6322/vntifkey＝"21"/label＝UPA;6473..6704/note＝"bghploya";6712..9054/vntifkey＝"21";/label＝ALB\Promoter9058..9804/vntifkey＝"21"/label＝Tet-on;9973..10801/vntifkey＝"21"/label＝WPRE-included;11041..11041/note＝"KpnI-R";11035..11040/note＝"XhoI";11065..11084/note＝"1";10803..11034/note＝"bghploya";11089..12292/note＝"Ins";12299..15598/note＝"3arm";14086..15123/note＝"exon2";20359..21219/note＝"Amp".

After the system was prepared as shown in the table, the mixture was digested in a water bath at 37℃for 2.5 hours, and 5ul of 10X Loading Buffer was added thereto to carry out 1% agarose gel electrophoresis. Concentration was measured after gel purification: the method is the same as above and will not be described again.

In-FusionR In-fusion system (10 ul) In HD Cloning Kit User Manual: xhoI digested Rosa26-Ins plasmid (25 ng/ul) 3.2ul, CN362-polyA2 (100 ng/ul) 0.8ul,5 XIn-Fusion 2ul, ddH ₂ O4 ul. Mixing the above systems, placing into a PCR instrument, reacting at 50deg.C for 15min, and directly converting the product.

Example 4

And (3) plasmid purification: the correctly sequenced clone was inoculated with 400ml of LB, the plasmid was extracted using NucleoBond Xtra Midi Plus EF kit, dissolved in nucleic-FREE WATER, stored at-30℃and the NucleoBond Xtra Midi Plus EF kit large-extraction plasmid was prepared as follows:

Preparation before experiment: the Rnase of the brown bottle was added to Buffer RES EF and stored at 4℃with a mark.

(1) Filling 400ml of bacterial liquid into 8 tubes, filling into 50ml of centrifuge tubes, centrifuging at 4800rpm at 4 ℃ for 10min, and discarding clean supernatant; (2) Adding 4ml of prepared RES EF solution into each tube, blowing by a 1ml pipetting gun until a uniform system without blocks is achieved, combining each 4 tubes of solution into one tube, and finally adding two tubes, wherein each tube is 16ml; (3) Adding 16ml Buffer Lys EF (blue) into each tube, timely covering the cap, slowly reversing and shaking for about 4-5 times, standing, and timing, wherein the time is not longer than 5 minutes from the time of pouring Lys EF solution to the time of adding solution NEU EF; (4) When the reaction was close to 5 minutes, the lid was carefully opened, 16ml of NEU EF solution was added to each tube, slowly inverted until the system became white and flocculent throughout, and left on ice for 15 minutes while the kit was being filled withXtra MIDI FILTER put in/>Xtra Midi Columns placing in a rack, adding a proper amount of (topped up) EQUEF solution into the column, and wetting the middle cotton core; (5) Taking out the solution on ice after EQU is dripped (the cotton core is not dried), shaking uniformly, pouring into a column, sampling once in a certain time interval, and not drying the cotton core; (6) After dripping, adding 5ml of FIL EF solution into the column, uniformly dripping at the position where the cotton core is exposed upwards during liquid adding, and not directly adding the middle of the cotton core, and dripping the cotton core after drying; (7) 35ml of ENDO EF solution is added into the column, and 15ml of WASH EF solution is added after dripping; (8) Adding 5ml of ELU EF into each tube for eluting after dripping, blowing the solution with a gun after dripping, repeatedly blowing for about 10 times, and split charging into 6 tubes, about 830ul/EP tube; (9) 0.7 volumes of isopropanol was added to each EP tube, about 583 ul/tube, and centrifuged at 12800rpm for 15 minutes at 4℃after shaking; (10) After centrifugation, white petal-shaped substances at the bottom of the EP tube are seen as plasmids, after carefully (slightly slippery plasmids) the supernatant is discarded, 1ml of 75% ethanol is added into each tube for washing, and the mixture is centrifuged at 13000rpm for 5min at normal temperature; (11) Centrifuging, removing supernatant, covering the cover, centrifuging for 20 seconds, taking out smoothly and carefully, and not reversing violent collision, opening the cover, sucking residual liquid at the bottom of the tube with a gun as much as possible, and taking out plasmids into the gun head; (12) And (3) airing at room temperature for 2min, adding 20ul of nucleic-FREE WATER into each tube, putting into a 56 ℃ oven for dissolving for 10 min, taking out, merging into one tube by using a filter core gun head, absorbing 2ul of quantitative, and pumping plasmids greatly.

Example 5

Based on the previous study, CN362 (JGY-PLV) lentiviral vector was constructed in a humanized mouse mode by different methods for hepatitis virus infection study, but none of them achieved successful effect. For example, the method of randomly injecting the target gene plasmid into fertilized eggs of mice by a prokaryotic injection mode is tried; the sequence of the target genes and the regulatory genes in the lentiviral plasmid is optimized again, and then the target genes and the regulatory genes are injected into fertilized eggs of mice in a prokaryotic injection mode. Mice either do not express or random expression is uncontrolled and more passable, and do not achieve good results. The present invention is limited in space and is not limited to the description of the present invention.

Finally, the CRISPR/Cas9 technology is adopted, CN362 is inserted into the Rosa26 site in a fixed point manner by homologous recombination, and the structure is an Insulator-pTight-UPA-polyA-alb Insulator-M2 rtTA-polyA-Insulator. Targeting vectors were constructed by the In-Fusion cloning method as described previously, and contained a 3.3kb 5 'homology arm, pTight-UPA-polyA1-Alb promoter-M2rtTA-polyA2 and a 3.3kb 3' homology arm. Finally, successfully constructing a mouse liver injury model by using the CN362 lentiviral vector, and further constructing a humanized mouse model for hepatitis virus infection research.

Knockin site: gt (ROSA) 26Sor (ENSMUSG 00000086429)

Linking of genes at MGI website: http:// www.informatics.jax.org/marker/MGI 104735

Knocki mode: CN362 was inserted into the Rosa26 site at the site, and the structure was an Insulator-pTight-UPA-polyA1-Alb Insulator-M2 rtTA-polyA2-Insulator.

1. Designing guideRNA (gRNA) target sequences aiming at target site genome, and carrying out in vitro transcription on the target sequences according to the sequences to obtain gRNA aiming at the gene; GGGGACACACTAAGGGAGCT (SEQ ID No.7, sequence 5 '-3')

(1) In vitro synthesis of gRNA: the gRNA scaffold was cloned into pmd-T vector (TakaRa; cat#D102A) (anti-Amp). The following primer pairs were used for PCR amplification of double-stranded DNA for specific gRNA synthesis (Transgen; cat#AS 211). The preparation process of the specific gRNA comprises the following steps:

A. the primer sequences used to prepare the gRNA were as follows:

Primer01：5’-gctaatacgactcactatagggggacacactaagggagctgttttagagctagaaatagcaag-3’(SEQ ID No.8)

Primer02:5’-aaaagcaccgactcggtgcc-3’(SEQ ID No.9)

Primer01 and Primer02, 13000rpm, centrifugation for 1min. After completion, 75. Mu.L of ddH ₂ O was added to the Primer01 tube, 256. Mu.L of ddH ₂ O was added to the Primer02 tube, and the mixture was allowed to stand at room temperature.

The mixture (150. Mu.L) was prepared in PCR tubes as follows:

PrimeSTAR MAX 75μL，Primer01 3μL，Primer02 3μL，vector 3μL，ddH2O 66μL。

Max DNA Polymerase accession number: R045A

Six tubes were packed in a 150. Mu.l system, 25. Mu.L each, and PCR was performed in a PCR apparatus as follows:

After denaturation at 98℃for 2min, cycles of 98℃for 10s,55℃for 15s,72℃for 5s,34 and finally 72℃for 20s, were completed.

D. Subjecting the product to agarose gel electrophoresis, 1% agarose gel, 200V running for 10min

E. Tapping, recovered using QIAquick Gel Extraction Kit (QIAGEN CAT: no. 28706).

After gel extraction, gRNA was synthesized using T7 RNA polymerase (NEB; cat#M0251S). The gRNA was then digested with DNase I (NEB; cat#M0303S) for 30min and purified with TRIzol (Sigma; T9424) to a final volume of 5-10. Mu.l.

F. usingT7Transcription Kit (thermo, cat# AM 1334) was transcribed.

G. Purification was performed using MEGACLEAR ^TM Transcription Clean-Up kit (thermo, cat# AM 1908). Stored at-80 ℃.

(2) Cas9 mRNA preparation procedure:

The full length humanized cas9cDNAs were cloned into the pXT7 vector (anti-Amp) and linearized with XbaI (NEB; cat#R0145T). The cap-shaped Cas9mRNA was synthesized using MMESSAGE MMACHINE MRNA transcriptional synthesis kit (Ambion; cat#am 1344). Cas9mRNA was then purified using the RNeasy mini kit (QIAGEN; cat # 74106). Specific Cas9mRNA preparation procedure:

A. 10 μg of plasmid pX-T7 (Cas 9) was linearized with XbaI. The total system was 100. Mu.l, and 5. Mu.l of enzyme was added thereto for 2 hours at 37 ℃. Adding 10 μl ammonium acetate, mixing, adding 200 μl absolute ethanol, mixing, and centrifuging at 13000rpm for 5min; the supernatant was discarded, centrifuged at 13000rpm for 1min, the residual solution was blotted off, and 20. Mu.l of nuclease-free water (DEPC) was added. In vitro mRNA transcription (Ambion MMESSAGE MMACHINE kit comprising 10. Mu.L 2 XNTP/ampoule, 2. Mu.L 10 Xreaction buffer, 1. Mu.g linear template DNA; 2. Mu.L enzyme in 20. Mu.L nuclease free purified water.)

Rna purification (QIAGEN RNEASY small kit): 4 volumes of ethanol (96-100%) were added to the RPE buffer as working solution.

A) Samples were conditioned to 100 μl with water without ribonuclease. Add 350. Mu.l of buffer RLT and mix well.

B) To the diluted RNA 250. Mu.l ethanol (96-100%) was added and mixed well by pipette without centrifugation, and immediately the sample (700. Mu.l) was transferred to RNeasy mini spin column placed in a 2ml collection tube (provided), capped and centrifuged for 15s at > 8000 g. The draft tube is discarded.

C) To the RNeasy spin column was added 500. Mu.l of buffered RPE. And (5) covering the cover. Centrifuging for 15s under the condition of more than or equal to 8000g to clean the membrane. The draft tube is discarded.

D) To the RNeasy spin column was added 500. Mu.l of buffered RPE. And (5) covering the cover. The membrane was washed by centrifugation at > 8000g for 2 min.

E) Optionally: the RNeasy spin column was placed in a new 2ml collection tube (attached). The lid was closed and centrifuged at full speed for 1 min.

F) The RNeasy spin column was placed in a new 1.5ml collection tube (provided). 30-50. Mu.l RNase-free water was directly added to the spin-column membrane. The lid was closed and centrifuged at 8000 Xg or more for 1 minute to elute RNA.

G) If the expected RNA yield is greater than 30. Mu.g, repeating step f using an additional 30-50. Mu.l of RNase-free water; or the eluate from step f (if high RNA concentrations are required) is used and the collection tube from step f is reused. Stored at-80 ℃. The in vitro transcribed gRNA, cas9 electrophoresis results are shown in figure 16.

2. Constructing a donor DNA recombinant plasmid R26-e (CN 362) -1 for target fragment recombination; (for specific operations, see examples 1-4)

3. Injecting fertilized eggs into the gRNA transcribed in vitro and the constructed donor DNA recombinant plasmid and cas9mRNA (fertilized eggs of C57BL/6J mice) to obtain F0 generation C57BL/6J mice;

Microinjection of fertilized eggs: c57BL/6J males and superovulation C57BL/6J females (Shanghai model biosciences Co., ltd.) were selected as donors for the prokaryotic embryo. Female mice with 6-8 weeks of sexual maturity are selected, PMSG and hCG of 10IU are respectively injected at intervals of 48 hours, and the mice with thrombus are put into a cage together with male mice, and oviduct perfusion is adopted to collect procaryotic embryos. A mixture of donor vector (donor vector,20 ng/. Mu.l), sgRNA (2 ng/. Mu.l) and cas9mRNA (5 ng/. Mu.l) was then injected into NOD/SCID fertilized eggs by means of prokaryotic injection. The fertilized eggs are injected into oviducts of pseudopregnant ICR female mice to obtain living animals. All mice developed normally and were healthy. Mice were housed in individually ventilated cages, and food and water were available ad libitum in a specific pathogen-free facility with light/dark cycling for 12 hours. All animal experiments were conducted according to guidelines of the Shanghai model biological center animal Care and use Committee.

Cas9 mRNA, gRNA and donor vector were microinjected into fertilized eggs of NOD/SCID mice to obtain F0 generation mice. Through long fragment PCR identification, 2F 0 generation mice with correct homologous recombination are obtained in total; f0 mice were mated with NOD-SCID mice to obtain 3 positive F1 mice. Sequencing gave the sequence information upstream and downstream of the knock-in site as shown in SEQ ID No. 14.

4. Carrying out genotype identification on the obtained F0 generation mice by a PCR and sequencing method;

1) Homologous recombination positive mouse PCR identification protocol, F0 generation mouse identification strategy schematic is shown in FIG. 14:

The 5' homology arm recombination positive genome should amplify 3.4kb and 6.8kb fragments, and the negative genome should amplify 6.8kb fragments; the 3' homology arm recombination positive genome should amplify a 3.9kb fragment, and the negative genome has no product.

2) PCR identification method of 5' homology arm recombination positive F0 generation mice:

PCR reaction system (50 μl): ddH ₂ O31 μl, PRIMESTAR GXL PCR BUFFER μl,2.5mM dNTP

4μl,Forward Primer(20pmol/μl)1μl,Reverse Primer(20pmol/μl)1μl,PrimeStar GXL DNA Polymerase*2μl,genomic DNA 1μl.

Table 3 PCR primer information:

Table 4 PCR reaction conditions:

Step#	Temp℃	Time	Note
				1	98	5min	-
2	98	10sec	-
				3	68	15sec	-
4	68	5min	repeat steps 2-4for 34cycles
				5	68	5min	-
6	12	-	hold

breeding F0 generation mice and NOD/scid mice to obtain positive F1 generation heterozygote mice;

1) F1 generation mice acquisition and genotyping

NOD/SCID mice are intermediate transition mice (basal mice) for constructing R26-e (CN 362) IL2rg KO mice, which have the characteristic of introducing Prkdc-knock-out SCID on the basis of a non-obese diabetic mouse (NOD) background strain, and then hybridizing with NSG mice to obtain mutation of IL2rg genes so as to lay a foundation for human cell transplantation and construction of double chimeric mice. The F0 generation positive mice are mated with wild NOD-SCID mice, and the F1 generation mice are obtained by breeding.

2) F1 generation mouse 5 '-and 3' -homology arm PCR identification

PCR identification strategy and method the results of the electrophoresis of the 5 '-and 3' -homology arm PCR identification of F1 mice are shown in FIG. 15, wherein the lane numbers are as follows: f1 generation mice were numbered; m:1kb DNA ladder. The PCR identified positive mice as: 5,9, 12; the sequencing results prove that the samples are positive. (M: 1kb DNA ladder,thermo,SM0311)

Example 6

Positive F1 mice after 6-10 generations incubation, mouse related detection results:

1. mouse doxycycline-induced uPA expression assay:

The result of uPA expression detection is shown in FIG. 11, wherein the left graph shows the ng/L/OD value of a standard curve, and the right graph shows the uPA expression value of sample serum; serum was diluted 20-fold, uPA mean: 118.58.+ -. 16.49ng/ml (M.+ -. SD).

2. After induction of doxycycline in mice, transaminase expression:

the transaminase expression detection result is shown in FIG. 12, wherein the left graph shows the standard curve IU/L/OD value, and the right graph shows the sample serum ALT expression value; serum was diluted 20-fold, ALT mean: 26.94+ -1.49 (IU/ml) (M+ -SD).

3. After the double primordial cells of the mice are transplanted, the Alb detection result is shown in FIG. 13, wherein the left graph is a standard curve ng/ml/OD value, and the right graph is a sample serum Alb expression value; serum was diluted 20-fold, mean: 218.19.+ -. 121.067ng/ml (M.+ -. SD) ng/ml, up to 480ng/ml.

Fig. 17 and 18 are images of untreated mice liver HE staining after induction of doxycycline. As shown, the liver tissue of the mice is acutely liver-depleted, locally necrotized, tissue dissolved and shed; the nuclei of the liver solidify and the vacuoles of the cells become. Fully explaining the success of the invention in constructing humanized mouse models.

4. Mouse liver section HE staining:

As shown in fig. 19: after transplantation of human hepatocytes, the mouse liver sections were HE stained, from which it was seen that there were two cells of different origin in the liver tissue, which were all quite different in number, size, distribution and HE staining. AChart x 20; B. c diagram x 50; d plot x 100.

After the transplantation of human hepatocytes, the damaged mouse liver tissue was repaired, as shown in fig. 20, and fig. A, B shows that the heterogeneous human hepatocytes in HE staining are filled in the mouse liver tissue, and the liver tissue was repaired in terms of tissue structure. FIG. A, B X100. FIG. C, D shows anti-human CK18 mAb staining, and the surface of hepatocytes has a clear orange-yellow staining, which is positive staining. Graph c×50; graph D x 100.

The mouse mode of limiting the liver injury caused by the uPA expression can be used for further constructing a humanized liver mouse model and deeply researching infectious disease pathogenesis of viral hepatitis and hepadnavirus infection by using the humanized liver mouse model, thereby providing a reliable animal model for developing antiviral drugs.

Finally, it is noted that the above-mentioned preferred embodiments are only intended to illustrate rather than limit the invention, and that, although the invention has been described in detail by means of the above-mentioned preferred embodiments, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention as defined by the appended claims.

Sequence listing

<110> First affiliated Hospital of the university of the force army of the Chinese people's liberation army

<120> An R26-e (CN 362-1) carrier and process for preparing the same

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 35

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 1

tccaccggtg cggccctaga gctcgctgat cagcc 35

<210> 2

<211> 35

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 2

gaagctagag cggcctcccc agcatgcctg ctatt 35

<210> 3

<211> 35

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 3

ccagtcacac ctcagctaga gctcgctgat cagcc 35

<210> 4

<211> 41

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 4

tcattggtct taaagctcga gtccccagca tgcctgctat t 41

<210> 5

<211> 50

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 5

ggggctgtcc ctcgaattac agggacagca gagatccagt ttggttagta 50

<210> 6

<211> 45

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 6

gaggatgggg ctcgagtggc taagatctac agctgccttg taagt 45

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 7

ggggacacac taagggagct 20

<210> 8

<211> 63

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 8

gctaatacga ctcactatag ggggacacac taagggagct gttttagagc tagaaatagc 60

aag 63

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 9

aaaagcaccg actcggtgcc 20

<210> 10

<211> 17

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 10

gccgggcctc gtcgtct 17

<210> 11

<211> 21

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 11

tttttggggg tgatggtggt c 21

<210> 12

<211> 21

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 12

acccaggccg ttctatgatt c 21

<210> 13

<211> 21

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 13

agttcttcct gcctgccttc t 21

<210> 14

<211> 344

<212> DNA/RNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 14

actgtgaata taaaaatgat agcttttcct gagggutggt ctcactatgt atctctgcct 60

gatctgcaac aagatatgta gactaaagtt ctgcctgctt ttgtctcctg aatactaagg 120

ttaaaatgta gtaatacttt tggaacttgg utgtgutatt cttttatagg ggacacacta 180

agggagcttg ggtgatagtt ggtaaaatgt gtttcaagtg atgaaaactt gaattattat 240

caccgcaacc tactttttaa aaaaaaaagc gutgcctgtt agagcatgct taagggatcc 300

ctaggacttg ctgagcacac aagagtagtt acttgggutg ctcc 344

<210> 15

<211> 21426

<212> DNA/RNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 15

gaattctcat gtttgacagc ttatcatcga taagctgcgg ccgcaaaggc cgcggtcgac 60

aagctgggga cacactaagg gagcttgggg ccagcggggg cggcgaggag gcgctcccag 120

gttccggccc tcccctcggc cccgcgccgc agagtctggc cgcgcgcccc tgcgcaacgt 180

ggcaggaagc gcgcgctggg ggcggggacg ggcagtaggg ctgagcggct gcggggcggg 240

tgcaagcacg tttccgactt gagttgcctc aagaggggcg tgctgagcca gacctccatc 300

gcgcactccg gggagtggag ggaaggagcg agggctcagt tgggctgttt tggaggcagg 360

aagcacttgc tctcccaaag tcgctctgag ttgttatcag taagggagct gcagtggagt 420

aggcggggag aaggccgcac ccttctccgg aggggggagg ggagtgttgc aatacctttc 480

tgggagttct ctgctgcctc ctggcttctg aggaccgccc tgggcctggg agaatccctt 540

ccccctcttc cctcgtgatc tgcaactcca gtctttctag aagatgggcg ggagtcttct 600

gggcaggctt aaaggctaac ctggtgtgtg ggcgttgtcc tgcaggggaa ttgaacaggt 660

gtaaaattgg agggacaaga cttcccacag attttcggtt ttgtcgggaa gttttttaat 720

aggggcaaat aaggaaaatg ggaggatagg tagtcatctg gggttttatg cagcaaaact 780

acaggttatt attgcttgtg atccgcctcg gagtattttc catcgaggta gattaaagac 840

atgctcaccc gagttttata ctctcctgct tgagatcctt actacagtat gaaattacag 900

tgtcgcgagt tagactatgt aagcagaatt ttaatcattt ttaaagagcc cagtacttca 960

tatccatttc tcccgctcct tctgcagcct tatcaaaagg tattttagaa cactcatttt 1020

agccccattt tcatttatta tactggctta tccaacccct agacagagca ttggcatttt 1080

ccctttcctg atcttagaag tctgatgact catgaaacca gacagattag ttacatacac 1140

cacaaatcga ggctgtagct ggggcctcaa cactgcagtt cttttataac tccttagtac 1200

actttttgtt gatcctttgc cttgatcctt aattttcagt gtctatcacc tctcccgtca 1260

ggtggtgttc cacatttggg cctattctca gtccagggag ttttacaaca atagatgtat 1320

tgagaatcca acctaaagct taactttcca ctcccatgaa tgcctctctc ctttttctcc 1380

atttataaac tgagctatta accattaatg gtttccaggt ggatgtctcc tcccccaata 1440

ttacctgatg tatcttacat attgccaggc tgatatttta agacattaaa aggtatattt 1500

cattattgag ccacatggta ttgattactg cttactaaaa ttttgtcatt gtacacatct 1560

gtaaaaggtg gttccttttg gaatgcaaag ttcaggtgtt tgttgtcttt cctgacctaa 1620

ggtcttgtga gcttgtattt tttctattta agcagtgctt tctcttggac tggcttgact 1680

catggcattc tacacgttat tgctggtcta aatgtgattt tgccaagctt cttcaggacc 1740

tataattttg cttgacttgt agccaaacac aagtaaaatg attaagcaac aaatgtattt 1800

gtgaagcttg gtttttaggt tgttgtgttg tgtgtgcttg tgctctataa taatactatc 1860

caggggctgg agaggtggct cggagttcaa gagcacagac tgctcttcca gaagtcctga 1920

gttcaattcc cagcaaccac atggtggctc acaaccatct gtaatgggat ctgatgccct 1980

cttctggtgt gtctgaagac cacaagtgta ttcacattaa ataaataaat cctccttctt 2040

cttctttttt ttttttttaa agagaatact gtctccagta gaatttactg aagtaatgaa 2100

atactttgtg tttgttccaa tatggtagcc aataatcaaa ttactcttta agcactggaa 2160

atgttaccaa ggaactaatt tttatttgaa gtgtaactgt ggacagagga gccataactg 2220

cagacttgtg ggatacagaa gaccaatgca gactttaatg tcttttctct tacactaagc 2280

aataaagaaa taaaaattga acttctagta tcctatttgt ttaaactgct agctttactt 2340

aacttttgtg cttcatctat acaaagctga aagctaagtc tgcagccatt actaaacatg 2400

aaagcaagta atgataattt tggatttcaa aaatgtaggg ccagagttta gccagccagt 2460

ggtggtgctt gcctttatgc ctttaatccc agcactctgg aggcagagac aggcagatct 2520

ctgagtttga gcccagcctg gtctacacat caagttctat ctaggatagc caggaataca 2580

cacagaaacc ctgttgggga ggggggctct gagatttcat aaaattataa ttgaagcatt 2640

ccctaatgag ccactatgga tgtggctaaa tccgtctacc tttctgatga gatttgggta 2700

ttattttttc tgtctctgct gttggttggg tcttttgaca ctgtgggctt tctttaaagc 2760

ctccttcctg ccatgtggtc tcttgtttgc tactaacttc ccatggctta aatggcatgg 2820

ctttttgcct tctaagggca gctgctgaga tttgcagcct gatttccagg gtggggttgg 2880

gaaatctttc aaacactaaa attgtccttt aatttttttt ttaaaaaatg ggttatataa 2940

taaacctcat aaaatagtta tgaggagtga ggtggactaa tattaaatga gtccctcccc 3000

tataaaagag ctattaaggc tttttgtctt atacttaact ttttttttaa atgtggtatc 3060

tttagaacca agggtcttag agttttagta tacagaaact gttgcatcgc ttaatcagat 3120

tttctagttt caaatccaga gaatccaaat tcttcacagc caaagtcaaa ttaagaattt 3180

ctgactttta atgttaattt gcttactgtg aatataaaaa tgatagcttt tcctgaggca 3240

gggtctcact atgtatctct gcctgatctg caacaagata tgtagactaa agttctgcct 3300

gcttttgtct cctgaatact aaggttaaaa tgtagtaata cttttggaac ttgcaggtca 3360

gattctttta taggggacac actaagggag accaccatca cccccaaaaa ctcgacgccc 3420

catcctcact gactccgtcc tggagttgga tgagagataa tggccttacg ttgtgccagg 3480

ggagggtcgg gctggattta gcaagattta ccttctccaa agagcggtgc tgcagtggca 3540

cagctgccca cggaggtggg ggggtcaccg tccctggagg tgatgaagaa ctgtggggat 3600

gtggcactga gggacatggc cagtgggcac ggtgggtggg ttggggttgg tcttggggat 3660

cttggagggc ttttccagcc ttcatgattt gacgattgta tgaacatcta catggcaatt 3720

ctccagctgc ctgtcccagt cctactgacc cagctgtatc tctccaggca agctcttcca 3780

ccccttctgc ttgcatccag acaccatcaa acatgcaggc tcagacacag ggaccagcag 3840

tgtctgtggc ctttttgtgc tcctctccat gctgggtttt aacttgctct ttgtccttct 3900

atcctatctt cttatcctta aggctgttct gaacgctgtg acttggagag tgtcccagag 3960

ccctcaacac ctgcatgtcc cacgtccatg ctgtcctgca cttccttatc cccaagatct 4020

gcctctccgt gatgcactga attggcaaac atgtgtcacc ccagaccaac aatgtcacag 4080

caaactcccc cttgatagga caagggggaa tggctttaca ctgagacagg ggaggtttgg 4140

gttggatatg aggaggcagt ttttccccca gagggtggtg acgcactgaa caggttgccc 4200

aaggaggctg tggatgcccc atccctgcag gcattcaagg ccaggctgga tgtggctctg 4260

ggcagcctgg gctgctggtt gatgaccctg cacatagcag ggggttggat ctggatgagc 4320

actgtgctcc tttgcaaccc aggccgttct atgattctgt cattctaaat ctctctttca 4380

gcctaaagct ttttccccgt atccccccag gtgtctgcag gctcaaagag cagcgagaag 4440

cgttcagagg aaagcgatcc cgtgccacct tccccgtgcc cgggctgtcc ccgcacgctg 4500

ccggctcggg gatgcggggg gagcgccgga ccggagcgga gccccgggcg gctcgctgct 4560

gccccctagc gggggaggga cgtaattaca tccctggggg ctttgggggg gggctgtccc 4620

tcgaattaca gggacagcag agatccagtt tggttagtac cgggcccatc cgaattcgga 4680

atcctcgagt ttactcccta tcagtgatag agaacgtatg tcgagtttac tccctatcag 4740

tgatagagaa cgatgtcgag tttactccct atcagtgata gagaacgtat gtcgagttta 4800

ctccctatca gtgatagaga acgtatgtcg agtttactcc ctatcagtga tagagaacgt 4860

atgtcgagtt tatccctatc agtgatagag aacgtatgtc gagtttactc cctatcagtg 4920

atagagaacg tatgtcgagg taggcgtgta cggtgggagg cctatataag cagagctcgt 4980

ttagtgaacc gtcagatcgc ctggagaagg atccgccacc atgaaagtct ggctggcgag 5040

cctgttcctc tgcgccttgg tggtgaaaaa ctctgaaggt ggcagtgtac ttggagctcc 5100

tgatgaatca aactgtggct gtcagaacgg aggtgtatgc gtgtcctaca agtacttctc 5160

cagaattcgc cgatgcagct gcccaaggaa attccagggg gagcactgtg agatagatgc 5220

atcaaaaacc tgctatcatg gaaatggtga ctcttaccga ggaaaggcca acactgatac 5280

caaaggtcgg ccctgcctgg cctggaatgc gcctgctgtc cttcagaaac cctacaatgc 5340

ccacagacct gatgctatta gcctaggcct ggggaaacac aattactgca ggaaccctga 5400

caaccagaag cgaccctggt gctatgtgca gattggccta aggcagtttg tccaagaatg 5460

catggtgcat gactgctctc ttagcaaaaa gccttcttcg tctgtagacc aacaaggctt 5520

ccagtgtggc cagaaggctc taaggccccg ctttaagatt gttgggggag aattcactga 5580

ggtggagaac cagccctggt tcgcagccat ctaccagaag aacaagggag gaagtcctcc 5640

ctcctttaaa tgtggtggga gtctcatcag tccttgctgg gtggccagtg ccgcacactg 5700

cttcattcaa ctcccaaaga aggaaaacta cgttgtctac ctgggtcagt cgaaggagag 5760

ctcctataat cctggagaga tgaagtttga ggtggagcag ctcatcttgc acgaatacta 5820

cagggaagac agcctggcct accataatga tattgccttg ctgaagatac gtaccagcac 5880

gggccaatgt gcacagccat ccaggtccat acagaccatc tgcctgcccc caaggtttac 5940

tgatgctccg tttggttcag actgtgagat cactggcttt ggaaaagagt ctgaaagtga 6000

ctatctctat ccaaagaacc tgaaaatgtc cgtcgtaaag cttgtttctc atgaacagtg 6060

tatgcagccc cactactatg gctctgaaat taattataaa atgctgtgtg ctgcggaccc 6120

agagtggaaa acagattcct gcaagggcga ttctggagga ccgcttatct gtaacatcga 6180

aggccgccca actctgagtg ggattgtgag ctggggccga ggatgtgcag agaaaaacaa 6240

gcccggtgtc tacacgaggg tctcacactt cctggactgg attcaatccc acattggaga 6300

agagaaaggt ctggccttct gatctagatc gcgaacgcgt gaattctacc gggtagggga 6360

ggcgcttttc ccaaggcagt ctggagcatg cgctttagca gccccgctgg gcacttggcg 6420

ctacacaagt ggcctctggc ctcgcacaca ttccacatcc accggtgcgg ccctagagct 6480

cgctgatcag cctcgactgt gccttctagt tgccagccat ctgttgtttg cccctccccc 6540

gtgccttcct tgaccctgga aggtgccact cccactgtcc tttcctaata aaatgaggaa 6600

attgcatcgc attgtctgag taggtgtcat tctattctgg ggggtggggt ggggcaggac 6660

agcaaggggg aggattggga agacaatagc aggcatgctg gggaggccgc tctagcttcc 6720

ttagcatgac gttccacttt tttctaaggt ggagcttact tctttgattt gatcttttgt 6780

gaaacttttg gaaattaccc atcttcctaa gcttctgctt ctctcagttt tctgcttgct 6840

cattccactt ttccagctga ccctgccccc taccaacatt gctccacaag cacaaattca 6900

tccagagaaa ataaattcta agttttatag ttgtttggat cgcataggta gctaaagagg 6960

tggcaaccca cacatcctta ggcatgagct tgattttttt tgatttagaa ccttcccctc 7020

tctgttccta gactacacta cacattctgc aagcatagca cagagcaatg ttctacttta 7080

attactttca ttttcttgta tcctcacagc ctagaaaata acctgcgtta cagcatccac 7140

tcagtatccc ttgagcatga ggtgacacta cttaacatag ggacgagatg gtactttgtg 7200

tctcctgctc tgtcagcagg gcactgtact tgctgatacc agggaatgtt tgttcttaaa 7260

taccatcatt ccggacgtgt ttgccttggc cagttttcca tgtacatgca gaaagaagtt 7320

tggactgatc aatacagtcc tctgccttta aagcaatagg aaaaggccaa cttgtctacg 7380

tttagtatgt ggctgtagaa agggtataga tataaaaatt aaaactaatg aaatggcagt 7440

cttacacatt tttggcagct tatttaaagt cttggtgtta agtacgctgg agctgtcaca 7500

gctaccaatc aggcatgtct gggaatgagt acacggggac cataagttac tgacattcgt 7560

ttcccattcc atttgaatac acacttttgt catggtattg cttgctgaaa ttgttttgca 7620

aaaaaaaccc cttcaaattc atatatatta ttttaataaa tgaattttaa tttatctcaa 7680

tgttataaaa aagtcaattt taataattag gtacttatat acccaataat atctaacaat 7740

catttttaaa catttgttta ttgagcttat tatggatgaa tctatctcta tatactctat 7800

atactctaaa aaagaagaaa gaccatagac aatcatctat ttgatatgtg taaagtttac 7860

atgtgagtag acatcagatg ctccatttct cactgtaata ccatttatag ttacttgcaa 7920

aactaactgg aattctagga cttaaatatt ttaagtttta gctgggtgac tggttggaaa 7980

attttaggta agtactgaaa ccaagagatt ataaaacaat aaattctaaa gttttagaag 8040

tgatcataat caaatattac cctctaatga aaatattcca aagttgagct acagaaattt 8100

caacataaga taattttagc tgtaacaatg taatttgttg tctattttct tttgagatac 8160

agttttttct gtctagcttt ggctgtcctg gaccttgctc tgtagaccag gttggtcttg 8220

aactcagaga tctgcttgcc tctgccttgc aagtgctagg attaaaagca tgtgccacca 8280

ctgcctggct acaatctatg ttttataaga gattataaag ctctggcttt gtgacattaa 8340

tctttcagat aataagtctt ttggattgtg tctggagaac atacagactg tgagcagatg 8400

ttcagaggta tatttgctta ggggtgaatt caatctgcag caataattat gagcagaatt 8460

actgacactt ccattttata cattctactt gctgatctat gaaacataga taagcatgca 8520

ggcattcatc atagttttct ttatctggaa aaacattaaa tatgaaagaa gcactttatt 8580

aatacagttt agatgtgttt tgccatcttt taatttctta agaaatacta agctgatgca 8640

gagtgaagag tgtgtgaaaa gcagtggtgc agcttggctt gaactcgttc tccagcttgg 8700

gatcgacctg caggcatgct tccatgccaa ggcccacact gaaatgctca aatgggagac 8760

aaagagatta agctcttatg taaaatttgc tgttttacat aactttaatg aatggacaaa 8820

gtcttgtgca tgggggtggg ggtggggtta gaggggaaca gctccagatg gcaaacatac 8880

gcaagggatt tagtcaaaca actttttggc aaagatggta tgattttgta atggggtagg 8940

aaccaatgaa atgcgaggta agtatggtta atgatctaca gttattggtt aaagaagtat 9000

attagagcga gtctttctgc acacagatca cctttcctat caaccccggg atccaccatg 9060

tctagactgg acaagagcaa agtcataaac ggcgctctgg aattactcaa tggagtcggt 9120

atcgaaggcc tgacgacaag gaaactcgct caaaagctgg gagttgagca gcctaccctg 9180

tactggcacg tgaagaacaa gcgggccctg ctcgatgccc tgccaatcga gatgctggac 9240

aggcatcata cccacttctg ccccctggaa ggcgagtcat ggcaagactt tctgcggaac 9300

aacgccaagt cattccgctg tgctctcctc tcacatcgcg acggggctaa agtgcatctc 9360

ggcacccgcc caacagagaa acagtacgaa accctggaaa atcagctcgc gttcctgtgt 9420

cagcaaggct tctccctgga gaacgcactg tacgctctgt ccgccgtggg ccactttaca 9480

ctgggctgcg tattggagga acaggagcat caagtagcaa aagaggaaag agagacacct 9540

accaccgatt ctatgccccc acttctgaga caagcaattg agctgttcga ccggcaggga 9600

gccgaacctg ccttcctttt cggcctggaa ctaatcatat gtggcctgga gaaacagcta 9660

aagtgcgaaa gcggcgggcc ggccgacgcc cttgacgatt ttgacttaga catgctccca 9720

gccgatgccc ttgacgactt tgaccttgat atgctgcctg ctgacgctct tgacgatttt 9780

gaccttgaca tgctccccgg gtaactagaa ttccgcccct ctccctcccc cccccctaac 9840

gttactggcc gaagccgctt ggaataaggc cggtgtgcgt ttgtctatat gttattttcc 9900

accatattgc cgtcttttgg caatgtgagg gcccggaaac ctggccctgt cttcttgacg 9960

agcattccta ggcgtcgagg gacctaataa cttcgtatag catacattat acgaagttat 10020

acatgtttaa gggttccggt tccactaggt acaattcgat atcaagctta tcgataatca 10080

acctctggat tacaaaattt gtgaaagatt gactggtatt cttaactatg ttgctccttt 10140

tacgctatgt ggatacgctg ctttaatgcc tttgtatcat gctattgctt cccgtatggc 10200

tttcattttc tcctccttgt ataaatcctg gttgctgtct ctttatgagg agttgtggcc 10260

cgttgtcagg caacgtggcg tggtgtgcac tgtgtttgct gacgcaaccc ccactggttg 10320

gggcattgcc accacctgtc agctcctttc cgggactttc gctttccccc tccctattgc 10380

cacggcggaa ctcatcgccg cctgccttgc ccgctgctgg acaggggctc ggctgttggg 10440

cactgacaat tccgtggtgt tgtcggggaa atcatcgtcc tttccttggc tgctcgcctg 10500

tgttgccacc tggattctgc gcgggacgtc cttctgctac gtcccttcgg ccctcaatcc 10560

agcggacctt ccttcccgcg gcctgctgcc ggctctgcgg cctcttccgc gtcttcgcct 10620

tcgccctcag acgagtcgga tctccctttg ggccgcctcc ccgcatcgat accgtcgacc 10680

tcgatcgaga cctagaaaaa catggagcaa tcacaagtag caatacagca gctaccaatg 10740

ctgattgtgc ctggctagaa gcacaagagg aggaggaggt gggttttcca gtcacacctc 10800

agctagagct cgctgatcag cctcgactgt gccttctagt tgccagccat ctgttgtttg 10860

cccctccccc gtgccttcct tgaccctgga aggtgccact cccactgtcc tttcctaata 10920

aaatgaggaa attgcatcgc attgtctgag taggtgtcat tctattctgg ggggtggggt 10980

ggggcaggac agcaaggggg aggattggga agacaatagc aggcatgctg gggactcgag 11040

ctttaagacc aatgacttac aaggcagctg tagatcttag ccactcgagc cccatcctca 11100

ctgactccgt cctggagttg gatgagagat aatggcctta cgttgtgcca ggggagggtc 11160

gggctggatt tagcaagatt taccttctcc aaagagcggt gctgcagtgg cacagctgcc 11220

cacggaggtg ggggggtcac cgtccctgga ggtgatgaag aactgtgggg atgtggcact 11280

gagggacatg gccagtgggc acggtgggtg ggttggggtt ggtcttgggg atcttggagg 11340

gcttttccag ccttcatgat ttgacgattg tatgaacatc tacatggcaa ttctccagct 11400

gcctgtccca gtcctactga cccagctgta tctctccagg caagctcttc caccccttct 11460

gcttgcatcc agacaccatc aaacatgcag gctcagacac agggaccagc agtgtctgtg 11520

gcctttttgt gctcctctcc atgctgggtt ttaacttgct ctttgtcctt ctatcctatc 11580

ttcttatcct taaggctgtt ctgaacgctg tgacttggag agtgtcccag agccctcaac 11640

acctgcatgt cccacgtcca tgctgtcctg cacttcctta tccccaagat ctgcctctcc 11700

gtgatgcact gaattggcaa acatgtgtca ccccagacca acaatgtcac agcaaactcc 11760

cccttgatag gacaaggggg aatggcttta cactgagaca ggggaggttt gggttggata 11820

tgaggaggca gtttttcccc cagagggtgg tgacgcactg aacaggttgc ccaaggaggc 11880

tgtggatgcc ccatccctgc aggcattcaa ggccaggctg gatgtggctc tgggcagcct 11940

gggctgctgg ttgatgaccc tgcacatagc agggggttgg atctggatga gcactgtgct 12000

cctttgcaac ccaggccgtt ctatgattct gtcattctaa atctctcttt cagcctaaag 12060

ctttttcccc gtatcccccc aggtgtctgc aggctcaaag agcagcgaga agcgttcaga 12120

ggaaagcgat cccgtgccac cttccccgtg cccgggctgt ccccgcacgc tgccggctcg 12180

gggatgcggg gggagcgccg gaccggagcg gagccccggg cggctcgctg ctgcccccta 12240

gcgggggagg gacgtaatta catccctggg ggctttgggg gggggctgtc ccgtcgaggc 12300

ttgggtgata gttggtaaaa tgtgtttcaa gtgatgaaaa cttgaattat tatcaccgca 12360

acctactttt taaaaaaaaa agccaggcct gttagagcat gcttaaggga tccctaggac 12420

ttgctgagca cacaagagta gttacttggc aggctcctgg tgagagcata tttcaaaaaa 12480

caaggcagac aaccaagaaa ctacagttaa ggttacctgt ctttaaacca tctgcatata 12540

cacagggata ttaaaatatt ccaaataata tttcattcaa gttttccccc atcaaattgg 12600

gacatggatt tctccggtga ataggcagag ttggaaacta aacaaatgtt ggttttgtga 12660

tttgtgaaat tgttttcaag tgatagttaa agcccatgag atacagaaca aagctgctat 12720

ttcgaggtct cttggtttat actcagaagc acttctttgg gtttccctgc actatcctga 12780

tcatgtgcta ggcctacctt aggctgattg ttgttcaaat aaacttaagt ttcctgtcag 12840

gtgatgtcat atgatttcat atatcaaggc aaaacatgtt atatatgtta aacatttgta 12900

cttaatgtga aagttaggtc tttgtgggtt tgatttttaa ttttcaaaac ctgagctaaa 12960

taagtcattt ttacatgtct tacatttggt ggaattgtat aattgtggtt tgcaggcaag 13020

actctctgac ctagtaaccc tacctataga gcactttgct gggtcacaag tctaggagtc 13080

aagcatttca ccttgaagtt gagacgtttt gttagtgtat actagtttat atgttggagg 13140

acatgtttat ccagaagata ttcaggacta tttttgactg ggctaaggaa ttgattctga 13200

ttagcactgt tagtgagcat tgagtggcct ttaggcttga attggagtca cttgtatatc 13260

tcaaataatg ctggcctttt ttaaaaagcc cttgttcttt atcaccctgt tttctacata 13320

atttttgttc aaagaaatac ttgtttggat ctccttttga caacaatagc atgttttcaa 13380

gccatatttt ttttcctttt tttttttttt tttggttttt cgagacaggg tttctctgta 13440

tagccctggc tgtcctggaa ctcactttgt agaccaggct ggcctcgaac tcagaaatcc 13500

gcctgcctct gcctcctgag tgccgggatt aaaggcgtgc accaccacgc ctggctaagt 13560

tggatatttt gttatataac tataaccaat actaactcca ctgggtggat ttttaattca 13620

gtcagtagtc ttaagtggtc tttattggcc cttcattaaa atctactgtt cactctaaca 13680

gaggctgttg gtactagtgg cacttaagca acttcctacg gatatactag cagattaagg 13740

gtcagggata gaaactagtc tagcgttttg tatacctacc agctttatac taccttgttc 13800

tgatagaaat atttcaggac atctagagtg tactataagg ttgatggtaa gcttataagg 13860

aacttgaaag tggagtaact actccatttc tctgagggga gaattaaaat ttttgaccaa 13920

gtgttgttga gccactgaga atggtctcag aacataactt cttaaggaac cttcccagat 13980

tgccctcaac actgcaccac atttggtcct gcttgaacat tgccatggct cttaaagtct 14040

taattaagaa tattaattgt gtaattattg tttttcctcc tttagatcat tccttgagga 14100

caggacagtg cttgtttaag gctatatttc tgctgtctga gcagcaacag gtcttcgaga 14160

tcaacatgat gttcataatc ccaagatgtt gccatttatg ttctcagaag caagcagagg 14220

catgatggtc agtgacagta atgtcactgt gttaaatgtt gctatgcagt ttggattttt 14280

ctaatgtagt gtaggtagaa catatgtgtt ctgtatgaat taaactctta agttacacct 14340

tgtataatcc atgcaatgtg ttatgcaatt accattttaa gtattgtagc tttctttgta 14400

tgtgaggata aaggtgtttg tcataaaatg ttttgaacat ttccccaaag ttccaaatta 14460

taaaaccaca acgttagaac ttatttatga acaatggttg tagtttcatg cttttaaaat 14520

gcttaattat tcaattaaca ccgtttgtgt tataatatat ataaaactga catgtagaag 14580

tgtttgtcca gaacatttct taaatgtata ctgtctttag agagtttaat atagcatgtc 14640

ttttgcaaca tactaacttt tgtgttggtg cgagcaatat tgtgtagtca ttttgaaagg 14700

agtcatttca atgagtgtca gattgttttg aatgttattg aacattttaa atgcagactt 14760

gttcgtgttt tagaaagcaa aactgtcaga agctttgaac tagaaattaa aaagctgaag 14820

tatttcagaa gggaaataag ctacttgctg tattagttga aggaaagtgt aatagcttag 14880

aaaatttaaa accatatagt tgtcattgct gaatatctgg cagatgaaaa gaaatactca 14940

gtggttcttt tgagcaatat aacagcttgt tatattaaaa attttcccca cagatataaa 15000

ctctaatcta taactcataa atgttacaaa tggatgaagc ttacaaatgt ggcttgactt 15060

gtcactgtgc ttgttttagt tatgtgaaag tttggcaata aacctatgtc ctaaatagtc 15120

aaactgtgga atgacttttt aatctattgg tttgtctaga acagttatgt tgccatttgc 15180

cctaatggtg aaagaaaaag tggggagtgc cttggcactg ttcatttgtg gtgtgaacca 15240

aagagggggg catgcactta cacttcaaac atccttttga aagactgaca agtttgggtc 15300

ttcacagttg gaattgggca tcccttttgt cagggaggga gggagggagg gaggctggct 15360

tgttatgctg acaagtgtga ttaaattcaa actttgaggt aagttggagg aacttgtaca 15420

ttgttaggag tgtgacaatt tggactctta atgatttggt catacaaaat gaacctagac 15480

caacttctgg aagatgtata taataactcc atgttacatt gatttcacct gactaatact 15540

tatcccttat caattaaata cagaagatgc cagccatctg ggccttttaa cccagaaacc 15600

caagctccct tagtgtgtcc ccgatcctct agagtcgagc agtgtggttt tcaagaggaa 15660

gcaaaaagcc tctccaccca ggcctggaat gtttccaccc aatgtcgagc agtgtggttt 15720

tgcaagagga agcaaaaagc ctctccaccc aggcctggaa tgtttccacc caatgtcgag 15780

caaaccccgc ccagcgtctt gtcattggcg aattcgaaca cgcagatgca gtcggggcgg 15840

cgcggtccca ggtccacttc gcatattaag gtgacgcgtg tggcctcgaa caccgagcga 15900

ccctgcagcg acccgcttaa cagcgtcaac agcgtgccgc agatcttggt ggcgtgaaac 15960

tcccgcacct cttcggccag cgccttgtag aagcgcgtat ggcttcgtac cccggccatc 16020

agcacgcgtc tgcgttcgac caggctgcgc gttctcgcgg ccatagcaac cgacgtacgg 16080

cgttgcgccc tcgccggcag caagaagcca cggaagtccg cccggagcag aaaatgccca 16140

cgctactgcg ggtttatata gacggtcccc acgggatggg gaaaaccacc accacgcaac 16200

tgctggtggc cctgggttcg cgcgacgata tcgtctacgt acccgagccg atgacttact 16260

ggcgggtgct gggggcttcc gagacaatcg cgaacatcta caccacacaa caccgccttg 16320

accagggtga gatatcggcc ggggacgcgg cggtggtaat gacaagcgcc cagataacaa 16380

tgggcatgcc ttatgccgtg accgacgccg ttctggctcc tcatatcggg ggggaggctg 16440

ggagctcaca tgccccgccc ccggccctca ccctcatctt cgaccgccat cccatcgccg 16500

ccctcctgtg ctacccggcc gcgcgatacc ttatgggcag catgaccccc caggccgtgc 16560

tggcgttcgt ggccctcatc ccgccgacct tgcccggcac aaacatcgtg ttgggggccc 16620

ttccggagga cagacacatc gaccgcctgg ccaaacgcca gcgccccggc gagcggcttg 16680

acctggctat gctggccgcg attcgccgcg tttacgggct gcttgccaat acggtgcggt 16740

atctgcaggg cggcgggtcg tggcgggagg attggggaca gctttcgggg acggccgtgc 16800

cgccccaggg tgccgagccc cagagcaacg cgggcccacg accccatatc ggggacacgt 16860

tatttaccct gtttcgggcc cccgagttgc tggcccccaa cggcgacctg tacaacgtgt 16920

ttgcctgggc cttggacgtc ttggccaaac gcctccgtcc catgcacgtc tttatcctgg 16980

attacgacca atcgcccgcc ggctgccggg acgccctgct gcaacttacc tccgggatga 17040

tccagaccca cgtcaccacc ccaggctcca taccgacgat ctgcgacctg gcgcgcacgt 17100

ttgcccggga gatgggggag gctaactgaa acacggaagg agacaatacc ggaaggaacc 17160

cgcgctatga cggcaataaa aagacagaat aaaacgcacg ggtgttgggt cgtttgttca 17220

taaacgcggg gttcggtccc agggctggca ctctgtcgat accccaccga gaccccattg 17280

gggccaatac gcccgcgttt cttccttttc cccaccccac cccccaagtt cgggtgaagg 17340

cccagggctc gcagccaacg tcggggcggc aggccctgcc atagccacgg gccccgtggg 17400

ttagggacgg ggtcccccat ggggaatggt ttatggttcg tgggggttat tattttgggc 17460

gttgcgtggg gtcagtccac gactggactg agcagacaga cccatggttt ttggatggcc 17520

tgggcatgga ccgcatgtac tggcgcgaca cgaacaccgg gcgtctgtgg ctgccaaaca 17580

cccccgaccc ccaaaaacca ccgcgcggat ttctggcgcc gccggacgaa ctaaacctga 17640

ctacggcatc tctgcccctt cttcgctggt acgaggagcg cttttgtttt gtattggtca 17700

ccacggccga gtttcctcga ccgatgccct tgagagcctt caacccagtc agctccttcc 17760

ggtgggcgcg gggcatgact atcgtcgccg cacttatgac tgtcttcttt atcatgcaac 17820

tcgtaggaca ggtgccggca gcgctctggg tcattttcgg cgaggaccgc tttcgctgga 17880

gcgcgacgat gatcggcctg tcgcttgcgg tattcggaat cttgcacgcc ctcgctcaag 17940

ccttcgtcac tggtcccgcc accaaacgtt tcggcgagaa gcaggccatt atcgccggca 18000

tggcggccga cgcgctgggc tacgtcttgc tggcgttcgc gacgcgaggc tggatggcct 18060

tccccattat gattcttctc gcttccggcg gcatcgggat gcccgcgttg caggccatgc 18120

tgtccaggca ggtagatgac gaccatcagg gacagcttca aggatcgctc gcggctctta 18180

ccagcctaac ttcgatcact ggaccgctga tcgtcacggc gatttatgcc gcctcggcga 18240

gcacatggaa cgggttggca tggattgtag gcgccgccct ataccttgtc tgcctccccg 18300

cgttgcgtcg cggtgcatgg agccgggcca cctcgacctg aatggaagcc ggcggcacct 18360

cgctaacgga ttcaccactc caagaattgg agccaatcaa ttcttgcgga gaactgtgaa 18420

tgcgcaaacc aacccttggc agaacatatc catcgcgtcc gccatctcca gcagccgcac 18480

gcggcgcatc tcgggcagcg ttgggtcctg gccacgggtg cgcatgatcg tgctcctgtc 18540

gttgaggacc cggctaggct ggcggggttg ccttactggt tagcagaatg aatcaccgat 18600

acgcgagcga acgtgaagcg actgctgctg caaaacgtct gcgacctgag caacaacatg 18660

aatggtcttc ggtttccgtg tttcgtaaag tctggaaacg cggaagtcag cgccctgcac 18720

cattatgttc cggatctgca tcgcaggatg ctgctggcta ccctgtggaa cacctacatc 18780

tgtattaacg aagcgctggc attgaccctg agtgattttt ctctggtccc gccgcatcca 18840

taccgccagt tgtttaccct cacaacgttc cagtaaccgg gcatgttcat catcagtaac 18900

ccgtatcgtg agcatcctct ctcgtttcat cggtatcatt acccccatga acagaaatcc 18960

cccttacacg gaggcatcag tgaccaaaca ggaaaaaacc gcccttaaca tggcccgctt 19020

tatcagaagc cagacattaa cgcttctgga gaaactcaac gagctggacg cggatgaaca 19080

ggcagacatc tgtgaatcgc ttcacgacca cgctgatgag ctttaccgca gctgcctcgc 19140

gcgtttcggt gatgacggtg aaaacctctg acacatgcag ctcccggaga cggtcacagc 19200

ttgtctgtaa gcggatgccg ggagcagaca agcccgtcag ggcgcgtcag cgggtgttgg 19260

cgggtgtcgg ggcgcagcca tgacccagtc acgtagcgat agcggagtgt atactggctt 19320

aactatgcgg catcagagca gattgtactg agagtgcacc atatgcggtg tgaaataccg 19380

cacagatgcg taaggagaaa ataccgcatc aggcgctctt ccgcttcctc gctcactgac 19440

tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa ggcggtaata 19500

cggttatcca cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa 19560

aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct 19620

gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa 19680

agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg 19740

cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcatagctca 19800

cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa 19860

ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg 19920

gtaagacacg acttatcgcc actggcagca gccactggta acaggattag cagagcgagg 19980

tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta cactagaagg 20040

acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc 20100

tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag 20160

attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac 20220

gctcagtgga acgaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc 20280

ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag 20340

taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt 20400

ctatttcgtt catccatagt tgcctgactc cccgtcgtgt agataactac gatacgggag 20460

ggcttaccat ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca 20520

gatttatcag caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact 20580

ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca 20640

gttaatagtt tgcgcaacgt tgttgccatt gctgcaggca tcgtggtgtc acgctcgtcg 20700

tttggtatgg cttcattcag ctccggttcc caacgatcaa ggcgagttac atgatccccc 20760

atgttgtgca aaaaagcggt tagctccttc ggtcctccga tcgttgtcag aagtaagttg 20820

gccgcagtgt tatcactcat ggttatggca gcactgcata attctcttac tgtcatgcca 20880

tccgtaagat gcttttctgt gactggtgag tactcaacca agtcattctg agaatagtgt 20940

atgcggcgac cgagttgctc ttgcccggcg tcaacacggg ataataccgc gccacatagc 21000

agaactttaa aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc 21060

ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg cacccaactg atcttcagca 21120

tcttttactt tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa 21180

aagggaataa gggcgacacg gaaatgttga atactcatac tcttcctttt tcaatattat 21240

tgaagcattt atcagggtta ttgtctcatg agcggataca tatttgaatg tatttagaaa 21300

aataaacaaa taggggttcc gcgcacattt ccccgaaaag tgccacctga cgtctaagaa 21360

accattatta tcatgacatt aacctataaa aataggcgta tcacgaggcc ctttcgtctt 21420

caagaa 21426

Claims (10)

1. An R26-e (CN 362-1) vector, which is characterized by comprising a Rosa26 site 5 '-homology arm, PTight promoter, urokinase type plasminogen activator gene, ployA1, albumin promoter Alb promoter, tetracycline transactivator, ployA2 and Rosa26 site 3' -homology arm, wherein the sequence of the vector is shown in SEQ ID No. 15.

2. The R26-e (CN 362-1) vector of claim 1, wherein the tetracycline trans-acting factor is M2rtTA.

3. The R26-e (CN 362-1) vector according to claim 1, wherein the nucleotide sequence of PTight promoter is shown in positions 4685 to 5008 of SEQ ID No. 15.

4. The R26-e (CN 362-1) vector according to claim 1, wherein the nucleotide sequence of urokinase-type plasminogen activator gene is shown in positions 5021 to 6322 of SEQ ID No. 15.

5. The R26-e (CN 362-1) vector of claim 1, wherein the nucleotide sequence of the albumin promoter is shown in position 6712..9054 of SEQ ID No. 15.

6. The process for preparing R26-e (CN 362-1) vectors according to any of claims 1 to 5, comprising the following steps:

a. PCR amplification is carried out by taking plasmid containing bgh polyA element as template to obtain target fragment polyA1, and the target fragment polyA1 is recombined into a carrier CN362 to obtain a CN 362-polyA 1 carrier; the plasmid map of CN362 is shown in figure 1;

b. PCR amplification is carried out by taking plasmid containing bgh polyA element as template to obtain target fragment polyA2, and the target fragment polyA2 is recombined into a carrier CN 362-polyA 1 to obtain a CN 362-polyA 2 carrier;

c. The target fragment CN 362-polyA 2 is obtained by PCR amplification by taking a CN 362-polyA 2 vector as a template, and is recombined into a vector Rosa26-Ins to obtain an R26-e (CN 362-1) vector, wherein the plasmid map of the Rosa26-Ins is shown in figure 4.

7. The method for preparing R26-e (CN 362-1) vector according to claim 6, wherein the primer pair sequences for PCR amplification in step a are shown in SEQ ID No.1 and SEQ ID No. 2.

8. The method for preparing R26-e (CN 362-1) vector according to claim 6, wherein the primer pair sequences for PCR amplification in the step b are shown in SEQ ID No.3 and SEQ ID No. 4.

9. The method for preparing R26-e (CN 362-1) vector according to claim 6, wherein the primer pair sequences for PCR amplification in step c are shown in SEQ ID No.5 and SEQ ID No. 6.

10. The method for producing R26-e (CN 362-1) vector according to claim 6, wherein the restriction enzymes used in the recombination are NotI, kpnI, xhoI.