CN112795652A

CN112795652A - Application of annular RNAcircURI1 in preparation of gastric cancer biomarker and kit thereof

Info

Publication number: CN112795652A
Application number: CN202110139931.XA
Authority: CN
Inventors: 林文楚; 王小林
Original assignee: Hefei Institutes of Physical Science of CAS
Current assignee: Hefei Institutes of Physical Science of CAS
Priority date: 2021-02-02
Filing date: 2021-02-02
Publication date: 2021-05-14

Abstract

The application of a circular RNAcircURI1 in preparing gastric cancer biomarkers, wherein the nucleotide sequence of the circular RNAcircURI1 is shown as SEQ ID No: 1 is shown. The invention verifies the ring RNA biomarker in gastric cancer through high-throughput sequencing screening, the ring RNAcircURI1 is screened and verified in GC for the first time, and the biomarker can be used as a clinical diagnosis target point of gastric cancer and a research and development target point of therapeutic drugs. Has strong reference and application value for the future treatment of GC.

Description

Application of annular RNAcircURI1 in preparation of gastric cancer biomarker and kit thereof

Technical Field

The invention belongs to the fields of biology and medicine, and relates to application of annular RNAcircURI1 in preparation of gastric cancer biomarkers and a kit thereof.

Background

Gastric Cancer (GC) is one of the most common malignant tumors worldwide, asia is one of the most frequently encountered regions in the world, and the incidence of the malignant tumors is the second in China. Due to lack of early discovery and timely treatment, 5-year survival rates are less than 30%.

Circular RNA is produced by reverse splicing of mRNA precursors of exons of thousands of genes in eukaryotes. Circular RNA is generally expressed in lower amounts and exhibits cell and tissue specificity compared to linear RNA (linear RNA). Because the RNA is in a covalent closed-loop structure and has no exposed end, the circular RNA can resist the degradation of exonuclease RNase R and can exist in blood and other body fluids highly stably, which is also a great advantage of the circular RNA as a biomarker for disease diagnosis prediction.

At present, most of circular RNA can be used as a miRNA sponge to adsorb miRNA, the biological behavior of downstream mRNA of the miRNA is influenced, related diseases can be more than 90, and the proportion of tumor related diseases is high. For example, the circular RNA circCDR1as can regulate and control important tumor-related proteins downstream of miR-7 by regulating the function of miR-7, so as to influence the occurrence and development of tumors, including Epidermal Growth Factor Receptor (EGFR), insulin receptor substrate, protein kinase, protein activation kinase, transcription factor and the like. Besides, researchers also find that the expression abundance of the circular RNA circHIPK3 in tumor tissues of breast cancer, colon cancer, liver cancer, stomach cancer, kidney cancer and the like is obviously higher than that of normal tissues, and the proliferation of tumor cells is regulated and controlled.

The discovery of cancer biomarkers provides a potential solution for early diagnosis and treatment of cancer. Most cancer patients are diagnosed at most in the middle and advanced stages of cancer, mainly due to the lack of sensitive and specific biomarkers for clinical diagnosis. Therefore, early diagnosis and accurate classification of diseases are key factors for cancer treatment programs. This in turn requires the use of more effective biomarkers. The discovery and application of various types of biomarkers have contributed greatly to clinical treatment and diagnosis of various diseases for decades, and compared with other types of biomarkers, the circular RNA biomarker has many advantages as an emerging biomarker, such as high stability in plasma or serum, difficulty in degradation and the like, high sensitivity and specificity, and compared with a common protein marker, the RNA biomarker has lower cost, and compared with a DNA biomarker, the state and the regulation process of RNA entering cells can be dynamically observed.

Disclosure of Invention

The invention aims to provide application of annular RNAcircURI1 in preparation of gastric cancer biomarkers and a kit thereof.

In order to achieve the above objects and other related objects, the present invention provides the following technical solutions: the application of a circular RNAcircURI1 in preparing gastric cancer biomarkers, wherein the nucleotide sequence of the circular RNAcircURI1 is shown as SEQ ID No: 1 is shown in the specification;

GAAGAAGGTAGATAATGACTATAATGCCCTTCGAGAAAGACTCAGCACCTTGCCTGATAAATTGTCTTATAATATAATGGTACCATTTGGCCCTTTTGCCTTCATGCCAGGAAAACTTGTCCATACTAATGAAGTCACTGTTTTACTGGGGGACAACTGGTTTGCAAAGTGCTCAGCAAAGCAGGCTGTAGGTTTAGTTGAGCACCGGAAAGAAC。

in order to achieve the above objects and other related objects, the present invention provides the following technical solutions: a kit for detecting gastric cancer, the kit comprising a primer pair: a forward primer F: GTCCATACTAATGAAGTCAC, respectively; the reverse primer R: CAAGGTGCTGAGTCTTTCTC.

The preferable technical scheme is as follows: the kit also comprises an internal reference primer pair, wherein the internal reference primer pair comprises: a forward primer F: CGGCGACGACCCATTCGAAC and reverse primer R: GAATCGAACCCTGATTCCC.

Due to the application of the technical scheme, compared with the prior art, the invention has the advantages that:

the invention verifies the circular RNA biomarker in gastric cancer through high-throughput sequencing screening, the circURI1 is screened and verified in GC for the first time, and the biomarker can be used as a clinical diagnosis target point of gastric cancer and a research and development target point of a therapeutic drug. Has strong reference and application value for the future treatment of GC.

Drawings

FIG. 1 shows the genomic position of the biomarker circURI1 selected by the present invention.

FIG. 2 shows the expression of the selected biomarker circURI1 in clinical samples. Wherein paraGC: paracancerous normal stomach tissue, GC: gastric cancer tissue.

Detailed Description

The following description of the embodiments of the present invention is provided for illustrative purposes, and other advantages and effects of the present invention will become apparent to those skilled in the art from the present disclosure.

Please refer to fig. 1-2. It should be understood that the structures, ratios, sizes, and the like shown in the drawings and described in the specification are for illustrative purposes only and are not intended to limit the scope of the present invention. The following examples are provided for a better understanding of the present invention, and are not intended to limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The experimental materials used in the following examples were all purchased from a conventional biochemical reagent store unless otherwise specified.

Tissue sample sources: all gastric cancer patients used in the examples had cancer tissues and tissues adjacent to the cancer from university of medical, Anhui.

Total RNA of gastric cancer tissue and para-cancer tissue were extracted separately, screened for high throughput sequencing and verified in clinical samples of 49 patients with Gastric Cancer (GC).

Example (b): application of annular RNAcircURI1 in preparation of gastric cancer biomarker and kit thereof

1. Collecting tissues of gastric cancer patients:

all fresh gastric cancer patients had cancer tissues and paracarcinoma tissues from university of medical, Anhui. All operations are approved by ethical committee of the national institute of fertilizer and Material science, and informed consent is signed by patients and family members. The specific operation is as follows: the cancer tissue and the tissue beside the cancer of the patient are taken out of the tissue with the size of soybean within half an hour after the excised body is removed by operation, and the tissue is gently clamped by a pair of surgical forceps soaked by DEPC water and put into the DEPC water to wash and remove the redundant residual blood. Then placed in RNAhold buffer (TransGen) for temporary storage.

2. RNA extraction

1) The tissue was thoroughly ground with an electric homogenizer and approximately 200. mu.l of trizol reagent was initially added to a 1.5mL of an EP tube without RNase, and 800. mu.l of trizol was added after the tissue was sufficiently ground. Then mix by gentle shaking. The operations were all performed on ice.

2) Adding 200 mul of trichloromethane, gently shaking, and standing for 5-10 minutes at room temperature.

3) The solution was then separated by centrifugation at 12000g for 15min in a 4 ℃ centrifuge.

4) After the centrifugation is finished, the solution is seen to be divided into three layers, wherein the upper layer is a clear water phase, and the middle layer and the lower layer are organic phases. Wherein the RNA is distributed in the upper aqueous phase. The organic phase is protein and DNA.

5) Carefully aspirate the upper aqueous phase into a new rnase-free 1.5ml EP tube, take care not to touch the middle layer to avoid DNA contamination, add an equal volume of isopropanol, mix well, and let stand in a freezer at-80 ℃ for 20 minutes. This step can help in RNA precipitation and maintain the integrity of the RNA.

6) RNA was precipitated by centrifugation at 12000g for 15 minutes in a 4 ℃ centrifuge.

7) Adding 1ml of 75-80% glacial ethanol, and centrifuging at 7500g in a 4 ℃ centrifuge for 5 minutes to clean once. This example was supplemented with 1ml of 75% by volume glacial ethanol.

8) The ethanol is poured off, the air is dried for 10 minutes, and a proper amount of DEPC water is added to dissolve the RNA.

3. RNA purification (DNase I digestion)

39.5. mu.l of the RNA dissolved in DEPC water was added to 5. mu.l of 10 × Reaction Buffer, 5. mu.l of RQ1 RNase-Free DNase I, and 0.5. mu.l of RNase Inhibitor, and digested in a 37 ℃ water bath for 30 minutes.

Add 5. mu.l of Stop Solution and inactivate DNase I in a 72 ℃ water bath for 5 minutes.

3M sodium acetate (pH 5.2) (50:1) and 300. mu.l of absolute ethanol were added, and the mixture was precipitated in a refrigerator at-80 ℃ for 120 minutes or more.

Centrifuge at 12000g for 15 minutes in a 4 ℃ centrifuge and discard the supernatant.

Adding 1ml of 75-80% glacial ethanol, and centrifuging at 7500g in a 4 ℃ centrifuge for 5 minutes to clean once. The ethanol is poured off, the mixture is dried for 10 minutes at room temperature, and a proper amount of DEPC water is added to dissolve the RNA.

4. Reverse transcription (Promega reverse transcription system)

1) RNA concentration was measured and 300ng-500ng RNA was inverted. Mu.l of random primer was added and made up to 10. mu.l with DEPC water.

2) Denaturing for 5min in a 72 deg.C metal bath, and then placing on ice for 2 min

To the above 10. mu.l system was added:

putting the system into a PCR instrument, and carrying out reverse transcription according to the following reaction:

5 minutes at 25 ℃; 60 minutes at 42 ℃; 15 minutes at 70 ℃.

3) The resulting cDNA can be diluted appropriately for use in subsequent PCR experiments.

5. Real-time quantitative PCR

1) The real-time PCR system is as follows:

2) the system is a 50 μ l system of one sample, which is added to wells of a 96-well plate, 15 μ l per well, and 3 wells per sample.

3) Sealing the 96-well plate with a heat-sealing film, centrifuging, and loading.

4) Real-time PCR was run as follows:

data acquisition

5) And (3) data analysis: data were analyzed using the Pikoreal software 2.2 software, using the housekeeping gene 18S rRNA as an internal reference, and the CT values of 18S were subtracted from the CT values collected in the gastric cancer group and the paracancer group, respectively, to obtain differences Δ 1 and Δ 2, and then the magnitudes of 2-. DELTA.1 and 2-. DELTA.2, i.e., the expression amounts of gastric cancer tissue and paracancer tissue, respectively, relative to 18S rRNA, were calculated, respectively.

Primer sequence F of the gene of interest circURI 1: GTCCATACTAATGAAGTCAC and R is CAAGGTGCTGAGTCTTTCTC.

The primer sequence of the internal reference gene 18S rRNA is F: CGGCGACGACCCATTCGAAC, R: GAATCGAACCCTGATTCCC).

6. Cancer risk analysis method

The invention adopts the cancer tissues and the paracarcinoma tissues of 49 fresh gastric cancer patients from the university of medical science of Anhui to carry out high-throughput RNA-seq sequencing analysis, and the result shows that the expression level of circURI1 is remarkably increased in the gastric cancer tissues relative to the paracarcinoma samples (figure two). Therefore, the degree of cancer risk can be judged according to the expression level of circURI1 relative to 18S rRNA in tissues of gastric cancer patients, namely the expression level of circURI1 relative to 18S rRNA shows a positive correlation trend with the cancer risk. The higher the expression level of circURI1 relative to 18S rRNA, the greater the risk of cancer; the lower the expression level of circURI1 relative to 18S rRNA, the lower the risk of cancer.

7. Sample DNA extraction and fluorescent PCR amplification

The used samples are cancer tissues and paracarcinoma tissues of a fresh gastric cancer patient, RNA in the fresh gastric cancer biopsy tissues is extracted by a trizol kit, after DNase I digestion and reverse transcription by a Promega reverse transcription kit, the extracted sample cDNA is subjected to fluorescence PCR amplification by using corresponding primers (the primer sequence of a target gene circURI1 is F: GTCCATACTAATGAAGTCAC, R: CAAGGTGCTGAGTCTTTCTC, the primer sequence of an internal reference gene 18S rRNA is F: CGGCGACGACCCATTCGAAC, and R: GAATCGAACCCTGATTCCC).

The specific implementation method comprises the following steps:

A. obtaining tissue from a clinical patient

The cancer tissues and tissues around the cancer of the gastric cancer patients were removed from the soybean-sized tissues within half an hour after surgical excision of the tissues, and the tissues were gently grasped with DEPC water-soaked surgical forceps and placed in DEPC water to wash off the excess residual blood. Then placed in RNAhold buffer (TransGen) for temporary storage.

RNA extraction

7) Adding 1ml of 75-80% glacial ethanol, and centrifuging at 7500g in a 4 ℃ centrifuge for 5 minutes to clean once.

RNA purification (DNase I digestion)

D. Reverse transcription (Promega reverse transcription system)

To the above 10. mu.l system was added:

5 minutes at 25 ℃; 60 minutes at 42 ℃; 15 minutes at 70 ℃.

3) The resulting cDNA was diluted ten-fold and used in subsequent PCR experiments.

E. Real-time fluorescent quantitative PCR sample adding

And B, respectively taking 10ng of the sample nucleic acid template to be detected prepared in the step A, and adding the sample nucleic acid template to No. 1-12 tubes of the 8-linked PCR reaction tube according to the following system. And preparing reagents and solution required by the reaction, wherein the reagents and solution are mother solution of every four compound holes:

taking 15 mu L of the mother liquor, namely a fluorescence PCR reaction system used in the final multiple-hole reaction, covering a tube cover of a PCR reaction tube tightly, fully mixing the reaction tubes, and performing instantaneous centrifugation for 10 s.

The target gene is circURI1 of cancer tissue or para-cancer tissue of a fresh gastric cancer patient, and the internal reference gene is 18S rRNA corresponding to each sample. Primer sequence F of the gene of interest circURI 1: GTCCATACTAATGAAGTCAC and R is CAAGGTGCTGAGTCTTTCTC. The primer sequence of the internal reference gene 18S rRNA is F: CGGCGACGACCCATTCGAAC, R: GAATCGAACCCTGATTCCC). The fluorescent PCR loading layout is as follows:

real-time fluorescent quantitative PCR amplification procedure: the real-time fluorescent quantitative PCR amplification instrument is used for detecting the expression level of circURI1 relative to 18S rRNA in gastric cancer tissues and para-carcinoma tissues of gastric cancer patients.

The real-time fluorescent PCR reaction program was set as follows:

the first stage is as follows:

and a second stage:

after the PCR reaction is finished, judging an amplification result according to a fluorescent quantitative PCR amplification instrument by combining an amplification curve and a Ct value: when the template to be detected has an obvious fluorescence amplification curve, the melting curve is a single peak, and the Ct value is less than 40, the quality of the nucleic acid template of the sample to be detected is good, and the amplification result is positive; when the template to be detected has an obvious fluorescence amplification curve, the number of peaks presented by the melting curve is not single, and the Ct value is more than 40, the amplification result is negative.

The foregoing is illustrative of the preferred embodiment of the present invention and is not to be construed as limiting thereof in any way, and any modifications or variations thereof that fall within the spirit of the invention are intended to be included within the scope thereof.

SEQUENCE LISTING

<110> institute of science of fertilizer combination and substance science of Chinese academy of sciences

Application of <120> annular RNAcircURI1 in preparation of gastric cancer biomarker and kit thereof

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 215

<212> RNA

<213> nucleotide sequence of circular RNAcircURI1

<400> 1

gaagaaggta gataatgact ataatgccct tcgagaaaga ctcagcacct tgcctgataa 60

attgtcttat aatataatgg taccatttgg cccttttgcc ttcatgccag gaaaacttgt 120

ccatactaat gaagtcactg ttttactggg ggacaactgg tttgcaaagt gctcagcaaa 180

gcaggctgta ggtttagttg agcaccggaa agaac 215

<210> 2

<211> 20

<212> DNA

<213> Forward primer F

<400> 2

gtccatacta atgaagtcac 20

<210> 3

<211> 20

<212> DNA

<213> reverse primer R

<400> 3

caaggtgctg agtctttctc 20

<210> 4

<211> 20

<212> DNA

<213> Forward primer F of reference primer set

<400> 4

cggcgacgac ccattcgaac 20

<210> 5

<211> 19

<212> DNA

<213> reverse primer R of internal reference primer set

<400> 5

gaatcgaacc ctgattccc 19

Claims

1. The application of the ring-shaped RNAcircURI1 in preparing gastric cancer biomarkers is characterized in that: the nucleotide sequence of the ring-shaped RNAcircURI1 is shown as SEQ ID No: 1 is shown.

2. A kit for detecting gastric cancer, which is characterized in that: the kit comprises a primer pair: a forward primer F: GTCCATACTAATGAAGTCAC, respectively; the reverse primer R: CAAGGTGCTGAGTCTTTCTC.

3. The kit for detecting gastric cancer according to claim 2, characterized in that: the kit also comprises an internal reference primer pair, wherein the internal reference primer pair comprises: a forward primer F: CGGCGACGACCCATTCGAAC and reverse primer R: GAATCGAACCCTGATTCCC.