CN110669844B - Kit for detecting treatment applicability of pemetrexed and cisplatin - Google Patents
Kit for detecting treatment applicability of pemetrexed and cisplatin Download PDFInfo
- Publication number
- CN110669844B CN110669844B CN201911117779.4A CN201911117779A CN110669844B CN 110669844 B CN110669844 B CN 110669844B CN 201911117779 A CN201911117779 A CN 201911117779A CN 110669844 B CN110669844 B CN 110669844B
- Authority
- CN
- China
- Prior art keywords
- mir
- hsa
- kit
- pemetrexed
- cisplatin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The invention discloses a kit for detecting the treatment applicability of pemetrexed and cisplatin, which comprises: an hsa-miR-6077 detection system, which records a vector of a mathematical model for determining the high/low demarcation standard of hsa-miR-6077 expression level, and when the hsa-miR-6077 expression level in a biological sample is not higher than the standard, the patient is prompted to be sensitive to treatment of pemetrexed and cisplatin; whereas when above the standard, the patient is suggested to be insensitive to pemetrexed + cisplatin treatment. The kit can be used for judging whether a patient with lung adenocarcinoma is suitable for adopting a pemetrexed and cisplatin combined treatment scheme, so that accurate medical treatment is realized.
Description
Technical Field
The invention belongs to the field of biological detection, relates to a kit for detecting the treatment applicability of pemetrexed and cisplatin, and particularly relates to a kit for judging whether a patient with lung adenocarcinoma is suitable for treatment by pemetrexed and cisplatin by detecting hsa-miR-6077 in a biological sample.
Background
Lung cancer is the most common and most mortality tumor, with morbidity and mortality ranking first for all tumors. Non-small cell lung cancer accounts for the vast majority of lung cancers, while lung adenocarcinoma is the most common subtype of lung cancer. Pemetrexed is a multi-target antifolate drug, and can inhibit various folate-dependent enzymes, so that the anti-tumor effect is achieved. Pemetrexed in combination with cisplatin chemotherapy is a first-line treatment for lung adenocarcinoma, but not all lung adenocarcinoma patients can benefit from this treatment due to the presence of drug resistant patients. Therefore, the method can accurately predict the sensitivity of the patient with the lung adenocarcinoma to the pemetrexed and cisplatin combined chemotherapy, and has very important significance for improving the treatment effect of the patient and reducing the social burden.
At present, some possible biomarkers (such as thymidylate synthase and the like) are proposed in some reports to be used for predicting the sensitivity of a lung adenocarcinoma patient to pemetrexed and cisplatin combined chemotherapy, but due to the reasons of high cost, complex process, low accuracy and the like, the biomarkers cannot be widely used in clinic, and the markers with higher sensitivity, specificity and application value can be applied to the formulation of a personalized chemotherapy scheme of the lung adenocarcinoma patient.
Micro ribonucleic acid (miRNA) is a non-coding RNA with a regulation function and is about 20-25 nucleotides in length. miRNA participates in various regulation ways, plays an extremely important role in tumor generation, proliferation, metabolism and apoptosis, and has wide development prospect in the aspects of tumor diagnosis, monitoring and the like. The discovery of biomarkers from mirnas for predicting the applicability of a specific drug, i.e., the sensitivity of a patient to a specific drug treatment, will help to achieve accurate medical treatment for the patient.
Disclosure of Invention
The inventor discovers that hsa-miR-6077 can be used for predicting the sensitivity of a patient with lung adenocarcinoma to the treatment of pemetrexed and cisplatin through comprehensive systematic analysis and verification of a lung adenocarcinoma miRNA map, and fills the blank of the field, thereby forming the basis of the invention. Specifically, the invention comprises the following technical scheme:
A kit for detecting the therapeutic applicability of pemetrexed + cisplatin, comprising: the hsa-miR-6077 detection system is used for detecting the expression quantity of hsa-miR-6077 in a biological sample; a vector describing a mathematical model for determining a high/low cut-off criterion for hsa-miR-6077 expression level, wherein when the hsa-miR-6077 expression level in a biological sample is not higher than the criterion, the patient is indicated to be suitable for pemetrexed + cisplatin combination therapy, i.e., the patient is sensitive to pemetrexed + cisplatin therapy; conversely, when hsa-miR-6077 expression in the biological sample is higher than the standard, the patient is not suitable for the pemetrexed + cisplatin combination treatment, i.e., the patient is not sensitive to the pemetrexed + cisplatin treatment. Wherein the nucleotide sequence of hsa-miR-6077 is as follows:
5’-GGGAAGAGCUGUACGGCCUUC-3’(SEQ ID NO:1)。
the above mathematical model is: the expression quantity of hsa-miR-6077 in the biological sample is expressed as qPCR (quantitative polymerase chain reaction) Ct value of hsa-miR-6077 extracted from the biological sample and Ct value of internal reference, wherein Ct is the difference between the Ct value of the quantitative PCR of hsa-miR-6077 extracted from the biological sample and the Ct value of the internal reference; the standard is as follows: taking 3.2 as a critical value for Ct, if the critical value is more than or equal to 3.2, the hsa-miR-6077 is low in expression, so that the patient is prompted to be sensitive to the treatment of pemetrexed + cisplatin and is not resistant to drugs, and the combined treatment of pemetrexed + cisplatin is suitable; if the expression level is less than 3.2, the hsa-miR-6077 is highly expressed, which indicates that the patient is insensitive to the pemetrexed + cisplatin treatment and resistant to the drug and is not suitable for the pemetrexed + cisplatin combined treatment.
Preferably, the internal reference can be U6 or the housekeeping gene GAPDH, more preferably U6 as an internal reference control. U6 is a small nucleic acid RNA (snRNA) that is expressed intracellularly and is commonly used as an internal reference in qPCR for mirnas.
The carrier may be a paper specification, e.g. a specification with an APP download window, such as a two-dimensional code, or a computer program storage device or system, such as a usb-disk, a web-disk, etc.
In a preferred embodiment, the kit further comprises an RNA extraction and separation system for extracting and separating miRNA from the biological sample.
For example, the RNA extraction and isolation system may be miRcute miRNA extraction and isolation kit (DP501) from tiangen biochemical technology (beijing) ltd.
In one embodiment, the hsa-miR-6077 detection system can beMiRcute enhanced miRNA cDNA first strand synthesis kit (KR211) and MiRcute of Tiangen Biochemical technology (Beijing) Co., Ltd TM Enhanced miRNA fluorescence quantitative detection kit (FP 411).
The PCR amplification primer sequence of the hsa-miR-6077 in the hsa-miR-6077 detection system is as follows:
a forward primer: 5'-AACAAGGGGAAGAGCTGTACGG-3' (SEQ ID NO: 2);
reverse primer: 5'-CAGTGCAGGGTCCGAGGT-3' (SEQ ID NO: 3).
The real-time quantitative PCR primer sequence of the U6 serving as the internal reference is as follows:
a forward primer: 5'-CTCGCTTCGGCAGCACA-3' (SEQ ID NO:4),
reverse primer: 5'-AACGCTTCACGAATTTGCGT-3' (SEQ ID NO: 5).
The biological sample may be selected from the group consisting of: lung cancer tissue, blood, plasma, serum, body fluid, cells. For example, the biological sample may be lung cancer tissue.
The kit can detect the expression level of hsa-miR-6077 in a patient sample, and judge whether a patient with lung adenocarcinoma is sensitive to the combination of pemetrexed and cisplatin and is resistant to drugs or not, and whether a pemetrexed and cisplatin combined treatment scheme is suitable for being adopted or not, so that the treatment of the patient is prevented from being delayed, and the aim of accurate medical treatment is fulfilled.
Drawings
FIG. 1 is a graph showing the growth of cells treated with pemetrexed after transfection of hsa-miR-6077 and two control miRNAs (NC19 and NC22) into lung adenocarcinoma cell line A549. Wherein NC19 is a miRNA control micic produced by Ribo Bio Inc., product number NC19(miR1N0000003-1-5), length 19 nt; NC22 is another miRNA control micic produced by leber bio, product number NC22(miR1N0000001-1-5) and length 22 nt.
FIG. 2 is a graph showing the growth of cells treated with cisplatin after transfection of hsa-miR-6077 and two control miRNAs (NC19 and NC22) into lung adenocarcinoma cell line A549.
FIG. 3 is a graph showing the growth of cells treated with pemetrexed and cisplatin after hsa-miR-6077 and two control miRNAs (NC19 and NC22) are transfected into lung adenocarcinoma cell line A549 respectively.
FIG. 4 is a graph showing the growth of cells treated with pemetrexed after transfection of hsa-miR-6077 and two control miRNAs (NC19 and NC22) into lung adenocarcinoma cell line H1975, respectively.
FIG. 5 is a graph showing the growth of cells treated with cisplatin after transfection of hsa-miR-6077 and two control miRNAs (NC19 and NC22) into lung adenocarcinoma cell line H1975, respectively.
FIG. 6 is a graph showing the growth of cells treated with pemetrexed and cisplatin, respectively, after transfection of hsa-miR-6077 and two control miRNAs (NC19 and NC22) into lung adenocarcinoma cell line H1975, respectively.
FIG. 7 is a survival curve drawn using the survivor, survivval and ggplot2 packages in the R language after classifying 34 patients with lung adenocarcinoma according to their hsa-miR-6077 expression levels. Where the optimal cutoff is determined by the surfmer package for R, the cutoff is set at 3.235765. Above this value this is set as the low hsa-miR-6077 expression panel, below this value it is set as the high hsa-miR-6077 expression panel. The C index was found to be 0.64.
Detailed Description
In the present invention, the terms "microRNA", "miRNA" and "miR" represent the same meaning, interchangeable, and they all refer to microRNA, i.e. non-coding single-stranded RNA molecules.
The invention discovers for the first time that the miRNA hsa-miR-6077 can be applied to the judgment of the treatment sensitivity of a patient with lung adenocarcinoma to pemetrexed and cisplatin, and therefore, the miRNA is used as a biomarker for judging whether the patient is suitable for receiving the pemetrexed and cisplatin combined treatment.
When the biomarker for the application is discovered from miRNA, the inventor researches nearly 2000 miRNAs in A549 cells by applying a Crispr/Cas9 whole genome high-throughput drug-resistant gene screening technology, compares the correlation of the miRNAs and the sensitivity of lung adenocarcinoma to the treatment of pemetrexed and cisplatin, and finds that the proliferation activity of lung adenocarcinoma cells after the hsa-miR-6077 gene knockout is more inhibited by pemetrexed and cisplatin. Then, the drug resistance to pemetrexed or cisplatin is detected in the lung adenocarcinoma cells transfected with hsa-miR-6077, and the drug resistance to pemetrexed or cisplatin of the lung adenocarcinoma cells is obviously improved after the expression level of hsa-miR-6077 is improved. Therefore, the method is suitable for being used as a prognostic index for judging the sensitivity of the lung adenocarcinoma patient to the pemetrexed + cisplatin combined treatment. Then, the expression condition of hsa-miR-6077 in 34 cases of patients who receive pemetrexed + cisplatin treatment in a surgical excision specimen is detected by adopting a qPCR method, and the prognosis condition of the patients is analyzed, so that the patients with low hsa-miR-6077 expression are more sensitive to the patients with high pemetrexed + cisplatin treatment expression, and the prognosis is better, so that the expression difference of the miRNA in the patients with lung adenocarcinoma is determined, and the application value is realized in the aspect of judging the sensitivity or drug resistance of the patients with lung adenocarcinoma to the pemetrexed + cisplatin treatment.
After the miRNA detection kit is used for quantifying the expression level of each miRNA in a biological sample, statistical processing can be carried out by a mathematical analysis method, for example, survival analysis is realized by using a surfminer package in an R language, and the miRNA expression high/low boundary standard with sample classification significance is obtained on the basis. Such mathematical methods are preferably performed by a computer, classifying the patient, and building a mathematical model.
For simplicity of description, the formula qpcr. ct. mir.6077-qpcr. ct. u6 may be referred to herein simply as the mathematical model, and it is obvious to those skilled in the art that it includes the criterion that qpcr. ct takes 3.2 as the classification cut-off value, i.e. < 3.2 belongs to hsa-miR-6077 high expression and ≧ 3.2 belongs to hsa-miR-6077 low expression.
As a specific application of the above mathematical model, it allows to be input in the form of computer software (computer program) to an information processing module of a gene assaying device such as a gene sequencer or to an information processing module of a PCR instrument. Furthermore, the mathematical model can be input into an intelligent medical system or into a computer of a doctor in the form of computer software (computer program) to help the doctor determine a lung adenocarcinoma treatment plan and implement precise medical treatment.
In a preferred embodiment, the above-mentioned kits may further comprise at least one of the following items, respectively: a carrier means, the space of which is divided into defined spaces that can receive one or more containers, such as kits, vials, tubes, and the like, each container containing a separate component for use in the method of the invention; instructions, which may be written on bottles, test tubes and the like, or on a separate piece of paper, or on the outside or inside of the container, for example paper with a download window for the operation demonstration video APP, such as a two-dimensional code, or in the form of multimedia, such as a CD, a usb-disc, a web-disc, etc.
The invention will be further illustrated with reference to the following specific examples. It is to be understood that these examples are for illustrative purposes only and are not intended to limit the present invention. Further, it should be understood that various changes and modifications may be made by one skilled in the art after reading the concept of the present invention and those equivalents may also fall within the scope of the invention as defined by the appended claims.
The addition amount, content and concentration of various substances are referred to herein, wherein the percentage refers to the mass percentage unless otherwise specified.
Examples
The RNA extraction kit and the miRNA quantitative detection kit used in the examples are provided by Tiangen Biochemical technology (Beijing) Co., Ltd.), and the DNA sequence and the primers used in PCR are synthesized by Tiangen Biochemical technology (Beijing) Co., Ltd. The procedures were as described in the kit instructions.
The human lung adenocarcinoma cell strains A549 and H1975 are provided by Zhongshan Hospital of Fudan university, and the culture conditions are as follows: in DMEM/F12 medium (Thermo Fisher Scientific, USA) containing 10% FBS, 5% CO at 37 ℃ 2 Cultured in an incubator (Thermo Fisher Scientific Co., U.S.A.).
Example 1 Whole genome high throughput drug resistance Gene screening Using Crispr/Cas9 technology
1.1 construct a series of sgRNAs according to the existing Crispr/Cas9 knock-out library, transfect the sgRNAs into lung adenocarcinoma cells A549, ensure that each cell only transfers one sgRNA or does not transfer the sgRNAs by adopting proper virus dosage, and then kill the cells which are not transferred with the sgRNAs by using puromycin treatment. Each a549 cell obtained thereby had a random gene (miRNA) knocked out.
1.2 subsequently, cells with certain miRNA gene knocked out are treated and screened by using a chemotherapeutic drug pemetrexed + cisplatin, the proliferation of sensitive cells can be inhibited or even die, and the normal proliferation of drug-resistant cells is not affected. When knocking out a gene results in an increase in sensitivity of a cell to a drug, the proportion of sgrnas of the cell and the gene to the sgrnas in all cells and all sgrnas becomes lower and lower as the treatment time is prolonged. By performing high throughput sequencing analysis on sgrnas in cells before and after treatment, respectively, we can infer changes in cell proliferation after knocking out each miRNA. Through the step, nearly 2000 miRNAs are researched, and the fact that a cell subset of one miRNA gene, namely hsa-miR-6077 knockout cell subset, is remarkably reduced compared with a control after pemetrexed + cisplatin treatment is found. The experimental data are shown in table 1 below:
TABLE 1 change of hsa-miR-6077 Gene knockout cell subset before and after Pemetrexed + cisplatin treatment
Here, Log (Fc) p&c Log (Fc) represents the log of the fold change in expression of a certain sgRNA after 7 days of pemetrexed + cisplatin treatment and before drug treatment DMSO The control group, i.e., the log of the change in expression value of the same sgRNA after 7 days of DMSO treatment and before the dosing treatment, is indicated. Therefore, it can be concluded that after hsa-miR-6077 knockout, the drug resistance of lung adenocarcinoma cells to pemetrexed + cisplatin is weakened.
Example 2 Change in Pemetrexed + cisplatin resistance following transfection of Lung adenocarcinoma cells into hsa-miR-6077
We transfected hsa-miR-6077 and two control miRNAs, N19, N22 (two miRNA controls NC19(miR1N0000003-1-5) and NC22(miR1N0000001-1-5) from Ruibo Bio), respectively, in A549 and H1975 lung adenocarcinoma cells, followed by treatment of the cells after transfection of hsa-miR-6077 with pemetrexed, cisplatin and pemetrexed + cisplatin, respectively. After treatment, the cell proliferation capacity was measured using CCK 8. The results of the experiment are shown in FIGS. 1 to 6. Compared with a control group, the proliferation capacity of A549 and H1975 lung adenocarcinoma cells transfected into hsa-miR-6077 is remarkably stronger than that of control groups N19 and N22 after being treated by pemetrexed or cisplatin.
It can be concluded that after the expression level of hsa-miR-6077 is increased, the drug resistance of lung adenocarcinoma cells to pemetrexed and cisplatin is enhanced, and the sensitivity is weakened.
After the correlation between the hsa-miR-6077 gene and the drug resistance of lung adenocarcinoma cells to pemetrexed + cisplatin is determined, the expression condition and patient prognosis analysis of the hsa-miR-6077 gene in the tumor tissues of lung adenocarcinoma patients receiving pemetrexed + cisplatin combined chemotherapy need to be further examined.
Example 3 analysis of a sample from a patient with Lung adenocarcinoma
We used qRT-PCR to detect the expression of hsa-miR-6077 in the tumor tissues of 34 cases of lung adenocarcinoma patients receiving pemetrexed + cisplatin combined chemotherapy. Patients were subsequently followed up to 5 years more, comparing the association of these mirnas with the patient prognosis. Therefore, the following specific steps are designed:
1. and extracting miRNA in the tissue sample.
2. And detecting the expression of hsa-miR-6077 by adopting qRT-PCR.
3. Patients were followed for survival (>5 years).
4. And (4) utilizing a survivval package and a ggplot2 package in the R language to draw a survival curve, and analyzing the detection result.
Example 4 extraction of MiRNA from tissue samples
miRNAs in lung cancer tissue samples are extracted by adopting miRcute miRNA extraction and separation kit (DP501) of Tiangen Biochemical technology (Beijing) Co. The specific operation comprises the following steps:
4.1 sample treatment: grinding lung cancer tissues in liquid nitrogen, adding 1ml of lysate MZ to each 30-50 mg of lung cancer tissues, and homogenizing with a homogenizer. The sample volume does not exceed one tenth of the lysate MZ volume.
4.2 the homogenate sample was left at room temperature for 5min to allow complete separation of the nucleic acid protein complex.
4.3 centrifugation at 12,000rpm for 5min at 4 ℃ and supernatant was taken and transferred to a new RNase-free centrifuge tube.
4.4 Add 200. mu.l chloroform, cover the tube, shake vigorously for 15sec, and let stand at room temperature for 5 min.
4.5 centrifugation at 12,000rpm for 15min at 4 ℃ the sample was divided into three layers: a yellow organic phase, an intermediate layer and a colorless aqueous phase, the RNA being predominantly in the aqueous phase, the volume of the aqueous phase being approximately 50% of the lysate MZ reagent used. The aqueous phase was transferred to a new tube and subjected to the next step.
4.6 measure the volume of the transfer liquid, slowly add absolute ethyl alcohol with the volume 0.43 times of the volume of the transfer liquid, and mix evenly. The resulting solution was transferred to the adsorption column miRspin together with the precipitate, centrifuged at 12,000rpm for 30sec at room temperature, the adsorption column miRspin was discarded after centrifugation, and the effluent was retained.
4.7 measuring the volume of the effluent, slowly adding absolute ethyl alcohol with the volume 0.75 times that of the effluent, and uniformly mixing. The resulting solution was transferred to adsorption column miRelute together with the precipitate, centrifuged at 12,000rpm for 30sec at room temperature, the effluent was discarded after centrifugation, and the adsorption column miRelute was retained.
4.8 to the adsorption column miRelute, 500. mu.l of deproteinized solution MRD was added, and the mixture was allowed to stand at room temperature for 2min, centrifuged at room temperature for 30sec at 12,000, and the waste liquid was discarded.
4.9 to the adsorption column MiRelute was added 500. mu.l of the rinse solution RW, and the mixture was left to stand at room temperature for 2min, centrifuged at 12,000rpm at room temperature for 30sec, and the waste liquid was discarded. This step is repeated.
4.10 the column MiRelute was placed in a 2ml collection tube and centrifuged at 12,000rpm for 1min at room temperature to remove residual liquid.
4.11 transfer the adsorption column miRelute into a new RNase-Free 1.5ml centrifuge tube, add 15-30 μ l RNase-Free ddH 2 O, left at room temperature for 2min, and centrifuged at 12,000rpm at room temperature for 2 min.
4.12 the obtained miRNA is stored at-70 ℃ for standby use to prevent degradation.
Example 5 addition of Poly tails and reverse transcription
Performing Poly tailing and reverse transcription of miRNA first strand cDNA by using a MiRcute enhanced miRNA first strand cDNA first strand synthesis kit (KR211) of Tiangen Biochemical technology (Beijing) Co., Ltd, and specifically operating the method comprises the following steps:
5.1 adding 2. mu.l of 10 XPoly Buffer, 4. mu.l of 5 XrATP Solution, 13.6. mu.l of RNA extract and 0.4. mu.l of Ecoli Poly polymerase (finally adding the polymerase) into a 0.2ml centrifuge tube, uniformly mixing by using a pipettor, and carrying out short-time centrifugation; 60 minutes at 37 ℃.
5.2 adding 1 mul RNase, 13.5 mul tailing solution, 2 mul 10 XRT Buffer solution, 1 mul Super Pure dNTP, 2 mul 10 XRT Primer and 0.5 mul Quant RTase into a 0.2ml centrifuge tube, mixing uniformly by a pipettor, and centrifuging briefly; 60min at 37 ℃; obtaining the tailing of miRNA and the cDNA of reverse transcription product.
Example 6 real-time quantitative PCR and quantitative analysis of miRNA
Real-time quantitative PCR: using miRcute from Tiangen Biochemical technology (Beijing) Ltd TM The enhanced miRNA fluorescent quantitative detection kit (FP411) amplifies cDNA by real-time quantitative PCR, and comprises the following specific operations:
6.1 adding 2 mul Reverse Primer, 2 mul microRNA Primer, 1.6 mul 50 XROX, 10 mul 2 XPremix, 4.4 mul cDNA liquid, mixing; each sample was provided with 3 secondary wells. The PCR primer sequence (5 '-3') for the cDNA of hsa-miR-6077 is as follows:
a forward primer: 5'-AACAAGGGGAAGAGCTGTACGG-3' (SEQ ID NO: 2);
reverse primer: 5'-CAGTGCAGGGTCCGAGGT-3' (SEQ ID NO: 3).
The PCR conditions were: preheating at 94 ℃ for 2 minutes, and at 94 ℃ for 20 seconds +60 ℃ for 34 seconds for 40 cycles.
6.2 the miRcute miRNA fluorescent quantitative detection kit provided by Tiangen corporation is adopted to detect on 7500HT fluorescent quantitative PCR instrument provided by Life Technology corporation.
And obtaining the Ct value of hsa-miR-6077.
6.3 likewise, the same operation is carried out for the internal reference U6. The real-time quantitative PCR primer sequence of U6 is:
a forward primer: CTCGCTTCGGCAGCACA (SEQ ID NO:4),
reverse primer: AACGCTTCACGAATTTGCGT (SEQ ID NO: 5).
Ct values for U6 were obtained.
Example 7 establishment of high and low expression levels for hsa-miR-6077
The survival condition of the lung adenocarcinoma patients receiving the pemetrexed and cisplatin combined chemotherapy is once a year and is continuous for more than 5 years, and the longest follow-up time is 10 years. Survival curves were drawn using the survivor, survivval and ggplot2 packages in the R language after classifying 34 patients with lung adenocarcinoma according to hsa-miR-6077 expression levels, see fig. 7. The optimal cut-off in the survival curve is determined by the surfmer package for R, with the cut-off set at 3.235765. Above this value, the expression was designated as the low hsa-miR-6077 expression group, and below this value, the expression was designated as the high hsa-miR-6077 expression group, and the C index was found to be 0.64. The survival curve shows that miR-361-5p has high expression abundance in lung adenocarcinoma tissues, the survival difference between the two groups is obvious, and the method can be used for predicting the sensitivity of lung adenocarcinoma patients to pemetrexed and cisplatin treatment.
The lung data set for the survivor package used when plotting the survival curves shown in FIG. 7 is shown in Table 2 below.
TABLE 2 statistical data of patients with lung adenocarcinoma
Wherein survival represents the patient's survival time in months; status indicates patient outcome, 0 indicates deletion (i.e., survival after study end or missed visits without follow-up death), 1 indicates death; low hsa-miR-6077 means that hsa-miR-6077 is Low in expression, and High hsa-miR-6077 means that hsa-miR-6077 is High in expression.
According to the data in table 2, a mathematical model for determining the high/low boundary standard of hsa-miR-6077 expression level can be established, and the mathematical model expresses the hsa-miR-6077 expression level as qpcr.ct ═ qpcr.ct.ct.mir.6077-qpcr.ct.u 6, namely, the difference between the Ct value of hsa-miR-6077 quantitative PCR extracted from a biological sample and the Ct value of the internal parameter. The high/low cutoff criteria for expression may be: the method is reasonable when the Ct value is 3.2 taken as a critical value, the Ct value is a simplified value of a cutoff value 3.235765 in a survival curve, if the Ct value is more than or equal to 3.2, hsa-miR-6077 is low in expression, and a patient is prompted to be sensitive to and intolerant to pemetrexed + cisplatin treatment and is suitable for combined treatment by using pemetrexed + cisplatin; if the expression level is less than 3.2, the hsa-miR-6077 is highly expressed, which indicates that the patient is insensitive to the pemetrexed + cisplatin treatment and drug-resistant, and is not suitable for the pemetrexed + cisplatin combined treatment.
The above experiment results show that the kit can be used for detecting the expression level of hsa-miR-6077 in a patient sample. If the expression of hsa-miR-6077 in a tumor sample of a patient with lung adenocarcinoma is low, the patient is sensitive to pemetrexed + cisplatin; if hsa-miR-6077 expression is high, the patient is resistant to pemetrexed + cisplatin. Therefore, by means of the mathematical model, doctors can judge whether lung adenocarcinoma patients are suitable for adopting a pemetrexed and cisplatin combined treatment scheme, and accurate medical treatment is realized.
Sequence listing
<110> Zhongshan Hospital affiliated to Fudan university
<120> a kit for detecting therapeutic applicability of pemetrexed + cisplatin
<130> SHPI1910682
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> RNA
<213> person ()
<400> 1
gggaagagcu guacggccuu c 21
<210> 2
<211> 22
<212> DNA
<213> Artificial sequence ()
<400> 2
aacaagggga agagctgtac gg 22
<210> 3
<211> 18
<212> DNA
<213> Artificial sequence ()
<400> 3
cagtgcaggg tccgaggt 18
<210> 4
<211> 17
<212> DNA
<213> Artificial sequence ()
<400> 4
ctcgcttcgg cagcaca 17
<210> 5
<211> 20
<212> DNA
<213> Artificial sequence ()
<400> 5
Claims (10)
1. A kit for detecting the suitability of pemetrexed + cisplatin treatment for a patient with lung adenocarcinoma, comprising: the hsa-miR-6077 detection system is used for detecting the expression quantity of hsa-miR-6077 in a biological sample; a vector describing a mathematical model for determining a high/low cutoff standard for hsa-miR-6077 expression level, which, when the hsa-miR-6077 expression level in a biological sample is not above the standard, indicates that the patient is susceptible to pemetrexed + cisplatin treatment; on the contrary, when the expression level of hsa-miR-6077 in the biological sample is higher than the standard, the patient is not sensitive to the treatment of pemetrexed + cisplatin, and the nucleotide sequence of the hsa-miR-6077 is SEQ ID NO: 1.
2. The kit of claim 1, wherein the mathematical model is the difference between the Ct value of hsa-miR-6077 quantitative PCR extracted from the biological sample and the Ct value of the internal reference, expressed as qpcr.ct ═ qpcr.ct.mir.6077-qpcr.ct.u6, in the biological sample; the standard is as follows: taking 3.2 as a critical value for Ct of qPCR, and if the critical value is more than or equal to 3.2, the hsa-miR-6077 is low in expression; if < 3.2, hsa-miR-6077 is highly expressed.
3. The kit of claim 2, wherein the internal reference is U6.
4. The kit of claim 1, further comprising an RNA extraction and isolation system for extracting and isolating miRNA from a biological sample.
5. The kit of claim 4, wherein the RNA extraction and isolation system is the miRcute miRNA extraction and isolation kit DP 501.
6. The kit of claim 1, wherein the hsa-miR-6077 detection system is miRcute enhanced miRNA cDNA first strand synthesis kit KR211 and miRcute TM An enhanced miRNA fluorescent quantitative detection kit FP 411.
7. The kit of claim 6, wherein the PCR amplification primer sequences in the hsa-miR-6077 detection system are a forward primer SEQ ID NO. 2 and a reverse primer SEQ ID NO. 3.
8. The kit of claim 1, wherein the carrier is a paper insert or a computer program storage device or system.
9. The kit of claim 1, wherein the biological sample is selected from the group consisting of: lung cancer tissue, blood, plasma, serum, body fluid, cells.
10. The kit of claim 9, wherein the biological sample is lung cancer tissue.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911117779.4A CN110669844B (en) | 2019-11-15 | 2019-11-15 | Kit for detecting treatment applicability of pemetrexed and cisplatin |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911117779.4A CN110669844B (en) | 2019-11-15 | 2019-11-15 | Kit for detecting treatment applicability of pemetrexed and cisplatin |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110669844A CN110669844A (en) | 2020-01-10 |
| CN110669844B true CN110669844B (en) | 2022-08-12 |
Family
ID=69087833
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911117779.4A Active CN110669844B (en) | 2019-11-15 | 2019-11-15 | Kit for detecting treatment applicability of pemetrexed and cisplatin |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110669844B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104212895A (en) * | 2014-09-03 | 2014-12-17 | 复旦大学附属中山医院 | Application of miR-361-5p as internal reference miRNA in diagnosing and monitoring of tumors |
| CN104411339A (en) * | 2012-06-21 | 2015-03-11 | 北京命码生科科技有限公司 | Microparticle comprising functional microRNA/siRNA and application thereof |
| WO2018048354A1 (en) * | 2016-09-07 | 2018-03-15 | Agency For Science, Technology And Research | A method of identifying risk of cancer and therapeutic options |
| CN108107134A (en) * | 2018-02-06 | 2018-06-01 | 中国医学科学院肿瘤医院 | The new marker for the effect of predicting pemetrexed joint platinum class treatment non-small cell lung cancer and its application |
| CN110199024A (en) * | 2016-11-25 | 2019-09-03 | 法国国家科学研究中心 | The method for treating the medicament and prediction reaction of NSCLC patient |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012135817A2 (en) * | 2011-03-31 | 2012-10-04 | University Of Houston | Microrna 130a,b as a tumor suppressor and sensitizing agent for chemotherapy |
-
2019
- 2019-11-15 CN CN201911117779.4A patent/CN110669844B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104411339A (en) * | 2012-06-21 | 2015-03-11 | 北京命码生科科技有限公司 | Microparticle comprising functional microRNA/siRNA and application thereof |
| CN104212895A (en) * | 2014-09-03 | 2014-12-17 | 复旦大学附属中山医院 | Application of miR-361-5p as internal reference miRNA in diagnosing and monitoring of tumors |
| WO2018048354A1 (en) * | 2016-09-07 | 2018-03-15 | Agency For Science, Technology And Research | A method of identifying risk of cancer and therapeutic options |
| CN110199024A (en) * | 2016-11-25 | 2019-09-03 | 法国国家科学研究中心 | The method for treating the medicament and prediction reaction of NSCLC patient |
| CN108107134A (en) * | 2018-02-06 | 2018-06-01 | 中国医学科学院肿瘤医院 | The new marker for the effect of predicting pemetrexed joint platinum class treatment non-small cell lung cancer and its application |
Non-Patent Citations (4)
| Title |
|---|
| 2010年-2015年SEER数据库肺腺鳞癌患者临床特征及预后分析;詹成等;《中国肺癌杂志》;20180831;第21卷(第8期);第600-609页 * |
| EGFR-T790M突变所致吉非替尼耐药肺腺癌细胞化疗药物敏感性变化的研究;李学真等;《中国癌症杂志》;20151231;第25卷(第2期);第129-134页 * |
| MicroRNA-6077 enhances the sensitivity of patients-derived lung adenocarcinoma cells to anlotinib by repressing the activation of glucose transporter 1 pathway;De-bin Ma et al.;《Cellular Signalling》;20190814;第64卷;第1-13页 * |
| miR-6077 promotes cisplatin/pemetrexed resistance in lung adenocarcinoma via CDKN1A/cell cycle arrest and KEAP1/ferroptosis pathways;Guoshu Bi et al.;《Molecular Therapy: Nucleic Acids》;20220630;第28卷;第366-386页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110669844A (en) | 2020-01-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tiberio et al. | Challenges in using circulating miRNAs as cancer biomarkers | |
| Lee et al. | The importance of standardization on analyzing circulating RNA | |
| Leti et al. | High-throughput sequencing reveals altered expression of hepatic microRNAs in nonalcoholic fatty liver disease–related fibrosis | |
| Lae et al. | Global gene expression profiling of PAX‐FKHR fusion‐positive alveolar and PAX‐FKHR fusion‐negative embryonal rhabdomyosarcomas | |
| Santangelo et al. | Circulating microRNAs as emerging non-invasive biomarkers for gliomas | |
| Liu et al. | Blood-based liquid biopsy: Insights into early detection and clinical management of lung cancer | |
| WO2014058394A1 (en) | Method of prognosis and stratification of ovarian cancer | |
| Seyhan | microRNAs with different functions and roles in disease development and as potential biomarkers of diabetes: progress and challenges | |
| US20220127684A1 (en) | Serum miRNA Markers for Diagnosing Liver Cancer and Predicting Liver Cancer Metastasis and Detection Kit Thereof | |
| Iacono et al. | Retrospective study testing next generation sequencing of selected cancer-associated genes in resected prostate cancer | |
| Shah et al. | Circulating microRNAs in cellular and antibody-mediated heart transplant rejection | |
| Rao et al. | Identification of plasma exosomes long non-coding RNA HAGLR and circulating tumor cells as potential prognosis biomarkers in non-small cell lung cancer | |
| CN110628913A (en) | lncRNA marker related to breast cancer | |
| Dwivedi et al. | Application of single-cell omics in breast cancer | |
| KR20220163971A (en) | Thyroid cancer prognosis and treatment methods | |
| CN110669844B (en) | Kit for detecting treatment applicability of pemetrexed and cisplatin | |
| Huang et al. | Expression profiles of tRNA-derived fragments and their potential roles in lung adenocarcinoma | |
| CN110951870A (en) | Application of miRNA expression quantity in predicting therapeutic effect of clopidogrel | |
| CN103757122B (en) | Based on hsa-miR-188-5p detection kit and the detection method thereof of AllGlo fluorescence probe quantitative PCR | |
| CN110628914A (en) | LncRNA marker related to breast cancer, detection primer and application thereof | |
| CN113151462B (en) | Application of lung cancer prognosis diagnosis marker and detection kit | |
| US20160208346A1 (en) | Method and composition for detection of oncogenic hpv | |
| US20230265523A1 (en) | Molecular marker for early pancreatic neoplasm detection, detection method and use thereof | |
| Shi et al. | Upregulated mitosis-associated genes CENPE, CENPF, and DLGAP5 predict poor prognosis and chemotherapy resistance of Acute Myeloid Leukemia | |
| CN103589786B (en) | Method, test kit and the primer of detection RRM1 mRNA relative expression quantity and probe |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |