CN109207595A - A kind of Human epidermal growth factor receptor gene T790M mutation detection kit and its detection method - Google Patents
A kind of Human epidermal growth factor receptor gene T790M mutation detection kit and its detection method Download PDFInfo
- Publication number
- CN109207595A CN109207595A CN201811164972.9A CN201811164972A CN109207595A CN 109207595 A CN109207595 A CN 109207595A CN 201811164972 A CN201811164972 A CN 201811164972A CN 109207595 A CN109207595 A CN 109207595A
- Authority
- CN
- China
- Prior art keywords
- seq
- probe
- gene
- growth factor
- factor receptor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The present invention provides a kind of Human epidermal growth factor receptor gene T790M mutation detection kit and its detection methods；Human epidermal growth factor receptor gene T790M mutation detection kit is detected, which can quickly, efficiently, accurately detect Human epidermal growth factor receptor gene T790M mutation；The advantages that using the detection method of mentioned reagent box detection Human epidermal growth factor receptor gene T790M mutation, this method detection method is easy to operate, high sensitivity, specific high, and Fit Models are wide, and testing result is true and reliable and easy to spread.
Description
Technical field
The present invention relates to genetic test fields, and in particular to a kind of Human epidermal growth factor receptor gene T790M mutation detection kit and
Its detection method.
Background technique
Lung cancer is the number one killer in the tumour world.In the patients with lung cancer newly made a definite diagnosis every year, wherein most is advanced stage
NSCLC.Currently, had be including Tarceva and Gefitinib representative EGFR-TKIs, as first-line treatment medicinal application
In clinical treatment NSCLC patient.Late NSCLC molecular targeted therapy aspect achieves breakthrough to EGFR-TKI, makes to suffer from
The middle position progression free survival phase (PFS) of person and Overall survival (OS) extend, and objective remission rate improves, and life quality is greatly changed
It is kind, but most of patient will appear TKI drug resistance after mean treatment 10 months and lead to treatment failure, make Patients with Non-small-cell Lung
Treatment fallen into new predicament.It is currently understood that more acquired resistance mechanism has: EGFR extron 20 T790M mutation, c-
The activation of MET/HGF signal path, the activation of PI3K access and Small Cell Lung Cancer conversion etc..Research finds EGFR gene 20
Exon T790M gene mutation is to lead to the drug resistant main factor of EGFR-TKI.
T790M mutation, that is, there are methionine to replace threonine in the extron 20 kinases area EGFR, and EGFR structure is caused to be sent out
It is raw to change, make TKI is in combination to be obstructed, so that it is restarted original repressed phosphorylative signal transduction process,
The signal transduction that finally makes this kind of drug that EGFR phosphorylation can not be blocked to be mediated and lead to drug resistance.T790M changes EGFR sky
Between structure, be unfavorable for TKI competitive binding, to generate primary or acquired resistance.T790M is sent out in the NSCLC just controlled
Raw rate about 8.2%；The incidence about 50% in the case for acquired resistance occur there are EGFR sensitive mutation.
The detection method of EGFR gene T790M mutation at present mainly has digital pcr (Digital PCR, dPCR), the next generation
Sequencing technologies (Next Generation Sequencing, NGS) and amplification refractory mutation system (Amplification
Refractory mutation system, ARMS).Although digital pcr technology has susceptibility high, accuracy is high, can be absolute
The advantages that quantitative, but technology needs to be popularized, kit research and development are not easy, and susceptibility or have bottleneck.NGS technology also has shortcoming:
It is expensive；It reads long to be about 30-250bp, it is shorter than Sanger sequencing, burden is caused to sequence assembly；Testing result still needs to
Goldstandard " Sanger sequencing " is wanted to verify；The accuracy that small fragment for detecting exon and introne junctional area lacks is not
It is enough；There is still a need for template to be measured carry out microemulsion PCR amplification, it is cumbersome, limit sequencing speed.ARMS technology is current
The main stream approach for the genetic test that regulation is supported, ARMS technology popularization degree is high, and hospital is suitble to carry out extensively, easy to be quick, specifically
Property is good, is the detection in Gene Mutation product of current medical market mainstream, but traditional ARMS technology detection sensitivity is relatively low
(1%), the sensibility inside tissue can also meet clinical needs, but the detection inside blood is in contrast inclined
It is low, it is unable to satisfy the low pattern detection of mutated target sequence abundance, especially increasingly developed liquid Biopsy.
Summary of the invention
Present invention solves the technical problem that be the defect and deficiency for overcoming existing EGFR gene T790M mutation detection techniques,
Provide primer, the probe of detection Human epidermal growth factor receptor gene T790M mutation.It is prominent that the primer, probe are able to detect Human epidermal growth factor receptor gene T790M
Become, high sensitivity, high specificity.
The present invention also provides a kind of detection Human epidermal growth factor receptor gene T790M mutation detection kit, the kit can quickly,
Efficiently, accurately detection Human epidermal growth factor receptor gene T790M mutation.
The present invention also provides the detection method for using the detection Human epidermal growth factor receptor gene T790M mutation of mentioned reagent box, this method
Detection method is easy to operate, high sensitivity, and specificity is high, and Fit Models are wide, and it is excellent that testing result is true and reliable and easy to spread etc.
Point.
The present invention includes following content:
A kind of Human epidermal growth factor receptor gene T790M mutation detection kit, including primer sets and probe；
The primer sets are at least one set in following two groups: for drawing for EGFR gene T790M abrupt climatic change
Object SEQ ID NO.1 and SEQ ID NO.2；For specific primer SEQ ID NO.4 and the SEQ ID of external control EGFR gene
NO.5；
The probe is at least one set selected from the probe below for primer corresponding site:
For the specific probe SEQ ID NO.3 of EGFR gene T790M abrupt climatic change；
For the specific probe SEQ ID NO.6 of external control EGFR gene.
Preferably, the 5 ' ends of the Human epidermal growth factor receptor gene T790M mutation detection kit probe SEQ ID NO.3 are marked with
Fluorophor FAM, 3 ' ends are marked with quenching group MGB；
The end probe SEQ ID NO.6 5 ' is marked with fluorophor VIC, and 3 ' ends are marked with quenching group MGB；
Preferably, the Human epidermal growth factor receptor gene T790M mutation detection kit further includes the primer sets for reference gene
And probe, the primer sets include SEQ ID NO.7 and SEQ ID NO.8, the probe is SEQ ID NO.9.
Preferably, the 5 ' ends of the Human epidermal growth factor receptor gene T790M mutation detection kit probe SEQ ID NO.9 are marked with
Fluorophor CY5,3 ' ends are marked with quenching group BHQ1.
Preferably, the Human epidermal growth factor receptor gene T790M mutation detection kit includes for EGFR gene T790M mutation inspection
The primer SEQ ID NO.1 and SEQ ID NO.2 of survey；For specific primer SEQ the ID NO.4 and SEQ of external control EGFR gene
ID NO.5；
For the specific probe SEQ ID NO.3 of EGFR gene T790M abrupt climatic change；
For the specific probe SEQ ID NO.6 of external control EGFR gene.
Preferably, the 5 ' ends of the Human epidermal growth factor receptor gene T790M mutation detection kit probe SEQ ID NO.3 are marked with
Fluorophor FAM, 3 ' ends are marked with quenching group MGB；
The end probe SEQ ID NO.6 5 ' is marked with fluorophor VIC, and 3 ' ends are marked with quenching group MGB.
Preferably, the Human epidermal growth factor receptor gene T790M mutation detection kit further includes enzyme mixation, including UDG enzyme,
Archaeal dna polymerase, PCR buffer, MgCl2, dNTPs and dUTP.
Preferably, the Human epidermal growth factor receptor gene T790M mutation detection kit further includes positive reference substance and negative control
Product, positive reference substance are the mixed liquor of NCI-H1975 genomic DNA and NCI-H3122 genomic DNA；
The negative controls are sterilizing ultrapure water.
A kind of Human epidermal growth factor receptor gene T790M mutation detection methods, the detection method include the following steps:
(1) design obtains primer and probe, and the primer sets are at least one set in following two groups: being directed to EGFR
The primer SEQ ID NO.1 and SEQ ID NO.2 of gene T790M abrupt climatic change；For the specific primer of external control EGFR gene
SEQ ID NO.4 and SEQ ID NO.5；
The probe is at least one set selected from the probe below for primer corresponding site:
For the specific probe SEQ ID NO.3 of EGFR gene T790M abrupt climatic change；
For the specific probe SEQ ID NO.6 of external control EGFR gene.
(2) sample to be examined DNA is extracted, as detection template；
(3) PCR reaction solution of detection EGFR gene T790M, external control EGFR gene is respectively configured；
(4) sample to be examined, positive reference substance, negative controls are added in corresponding PCR reaction tube respectively.
(5) carry out multiple fluorescence quantitative PCR detection, multiplexed PCR amplification program are as follows: 37 DEG C 2 minutes；95 DEG C of initial denaturations 10 are divided
Clock；95 DEG C are denaturalized 15 seconds, and 60 DEG C are annealed 30 seconds, 50 circulations.
(6) according to multiple fluorescence quantitative PCR result judgement gene mutation.
Primer and probe sets in the present invention is as follows:
SEQ ID NO.1:5 ' ccaccgtgcagctcataat3 '
SEQ ID NO.2:5 ' tgtctttgtttcccggac3 '
SEQ ID NO.3:FAM-gctcatgcccttcgg-MGB
SEQ ID NO.4:5 ' AAATCCTGCATGGCGC3 '
SEQ ID NO.5:5 ' GCCACTGGATGCTCTCCA3 '
SEQ ID NO.6:VIC-AACAACCCTGCCCTGTG-MGB
SEQ ID NO.7:5 ' GATGTTCACTGAAGAGTACCAGAAA3 '
SEQ ID NO.8:5 ' CCACGTATTTTCTGCGTTTTTG3 '
SEQ ID NO.9:CY5-TCTGCTAGAGCAGTACCATCTGGGTCTGG-BHQ1
In summary content, technical solution provided by the invention are as follows:
A kind of specific primer of detection Human epidermal growth factor receptor gene T790M mutation, the primer is respectively to be directed to EGFR gene
The specific primer 1 and 2 of T790M abrupt climatic change, for the specific primer 3 and 4 of external control EGFR gene, for reference gene
The specific primer 5 and 6 of GUSB detection.Specific primer is as follows:
Primer 1:5 ' ccaccgtgcagctcataat3 '
Primer 2: 5 ' tgtctttgtttcccggac3 '
Primer 3:5 ' AAATCCTGCATGGCGC3 '
Primer 4:5 ' GCCACTGGATGCTCTCCA3 '
Primer 5:5 ' GATGTTCACTGAAGAGTACCAGAAA3 '
Primer 6:5 ' CCACGTATTTTCTGCGTTTTTG3 '
A kind of specific probe of detection Human epidermal growth factor receptor gene T790M mutation, the probe is respectively to be directed to EGFR gene
The specific probe 1 of T790M abrupt climatic change is detected for the specific probe 2 of external control EGFR gene for reference gene GUSB
Specific probe 3.Specific probe is as follows:
Probe 1:FAM-gctcatgcccttcgg-MGB
Probe 2:VIC-AACAACCCTGCCCTGTG-MGB
Probe 3:CY5-TCTGCTAGAGCAGTACCATCTGGGTCTGG-BHQ1
A kind of Human epidermal growth factor receptor gene T790M mutation detection kit, the kit include for EGFR gene T790M mutation inspection
The specific primer and specific probe of survey, specific primer and specific probe and needle for the detection of external control EGFR gene
To the primer and probe of internal reference GUSB genetic test.The kit further includes enzyme mixation, including UDG enzyme, archaeal dna polymerase, PCR
Buffer, MgCl2, dNTPs and dUTP.
The kit further includes positive reference substance and negative controls, and the positive reference substance is NCI-H1975 genome
The mixed liquor of DNA and NCI-H3122 genomic DNA.Negative controls are sterilizing ultrapure water.
The present invention also provides a kind of EGFR gene T790M mutation detection methods, this method includes using above-mentioned detection people
EGFR gene T790M mutation, external control EGFR gene and reference gene primer and probe or above-mentioned detection Human epidermal growth factor receptor gene T790M
The step of kit detection Human epidermal growth factor receptor gene T790M mutation of mutation.
Detection method detects gene mutation using fluorescent quantitative PCR technique, the specific steps are as follows:
(1) sample to be examined DNA is extracted, as detection template；
(2) it according to sample number to be detected (containing 1 positive control and 1 negative control), calculates and prepares each reaction mixing
Prepared detection reaction solution is dispensed into eight PCR reaction tubes by liquid respectively.
(3) sample to be examined, positive reference substance, negative controls are added in corresponding PCR reaction tube respectively.
(4) carry out multiple fluorescence quantitative PCR detection, multiplexed PCR amplification program are as follows: 37 DEG C 2 minutes；95 DEG C 10 minutes；95
DEG C 15 seconds, 60 DEG C (collecting fluorescence signal) 30 seconds, 50 circulations.
(5) situation is mutated according to multiple fluorescence quantitative PCR result judgement EGFR gene T790M.
Compared with prior art, the present invention has the following advantages:
(1) high sensitivity: can 100000 copy wild type gene group DNA backgrounds under accurately detect 0.01% be put into it is prominent
Become DNA；
(2) specificity is high: the wild type gene group DNA of 100000 copies is resistant to, without there is non-specific amplification；
(3) it is detected using multiple fluorescence quantitative PCR technology, detection process is to close the border reaction, and add anti-pollution
System and internal control system more accurate, steadily can carry out abrupt climatic change to sample, it is ensured that real result is credible；
(4) easy to operate quick, and result interpretation is simply objective, convenient for analysis, is suitable for large-scale promotion application.
Detailed description of the invention
In order to more clearly explain the embodiment of the invention or the technical proposal in the existing technology, to embodiment or will show below
There is attached drawing needed in technical description to be briefly described, it should be apparent that, the accompanying drawings in the following description is only this
Some embodiments of invention without any creative labor, may be used also for those of ordinary skill in the art
To obtain other drawings based on these drawings.
Fig. 1 is 2 medium sensitivity of the embodiment of the present invention (10/10000) testing result figure；
Fig. 2 is 2 medium sensitivity of the embodiment of the present invention (10/100000) testing result figure；
Fig. 3 is specific (10000) testing result figure in the embodiment of the present invention 2；
Fig. 4 is specific (100000) testing result figure in the embodiment of the present invention 2；
Fig. 5 is EGFR gene T790M sudden change sample testing result figure in the embodiment of the present invention 3；
Fig. 6 is negative sample testing result figure in the embodiment of the present invention 3；
Specific embodiment
Below in conjunction with the drawings and specific embodiments, the present invention will be described in detail, in following embodiment unless otherwise specified, institute
Using raw material sources in conventional practices commercially available, that used method is well known to those skilled in the art.
1 Human epidermal growth factor receptor gene T790M mutation detection kit of embodiment
Specific primer and specific probe are designed according to target gene sequence, the primer and probe of design can be according to existing
There is method to carry out artificial synthesized.Specific primer and probe is as follows:
Primer 1 (T790M-Fo): 5 ' ccaccgtgcagctcataat3 '
Primer 2 (T790M-Re): 5 ' tgtctttgtttcccggac 3 '
Primer 3 (Control-Fo): 5 ' AAATCCTGCATGGCGC 3 '
Primer 4 (Control-Re): 5 ' GCCACTGGATGCTCTCCA 3 '
Primer 5 (GUSB-Fo): 5 ' GATGTTCACTGAAGAGTACCAGAAA3 '
Primer 6 (GUSB-Re): 5 ' CCACGTATTTTCTGCGTTTTTG3 '
Probe 1 (T790M-Pr): FAM-gctcatgcccttcgg-MGB
Probe 2 (Control-Pr): VIC-AACAACCCTGCCCTGTG-MGB
Probe 3 (GUSB-Pr): CY5-TCTGCTAGAGCAGTACCATCTGGGTCTGG-BHQ1
Kit forms:
The present invention says that the kit of offer specifically includes that component is as shown in table 1,1. in containing corresponding T790M abrupt climatic change try
Agent, EGFR external control gene and reference gene reagent are mutated by FAM signal designation, and EGFR external control gene is indicated by VI C signal, interior
Join gene by CY5 signal designation.
Table 1: reagent constituents
2 Human epidermal growth factor receptor gene T790M mutation detection methods of embodiment
Using the kit detection Human epidermal growth factor receptor gene T790M mutation of the embodiment of the present invention 1, comprising the following steps:
(1) sample to be tested processing and template extraction；
Fresh Frozen or paraffin embedding human tumour tissue are taken, extracts DNA with extracts kit, or extract under informed consent
According to the human tumour peripheral blood in patients of medical conventional decimation, plasma dna is extracted with extracts kit after extraction blood plasma, extracts DNA
Stoste is as PCR detection template.
(2) system is prepared
All components in kit are melted on ice, according to sample number to be detected, calculates and prepares reaction mixture and (be shown in Table
2)。
Table 2 detects reaction solution and prepares formula
Prepared PCR reaction solution vortex oscillation is mixed, of short duration centrifugation.According to the amount point of each 20 μ L of PCR reaction tube
This mixed liquor is not dispensed into each PCR reaction tube.
Sample to be examined DNA, positive reference substance (STD) and negative controls (NTC) are pressed to the amount of each 5 μ L of reaction tube respectively
It is added in corresponding PCR pipe, PCR reaction tube is put into quantitative PCR apparatus.
(3) PCR amplification
(4) interpretation of result
Threshold value setting: according to different type of machines given threshold.Ct value determines: selection STD reaction tube, NTC and example reaction pipe
Threshold value delimited together, obtain T790M and internal reference Ct value.
Negative to be risen without amplification curve without template blank control (NTC)；
Expand according to △ Ct value (△ Ct=T790M Ct value-EGFR external control gene C t value), CtT790M value and whether there is or not obvious
Increase curve, determines the catastrophe of corresponding sample.
2. CtT790M < 40, positive
2. CtT790M >=40, if △ Ct≤14.0, T790M Positive mutants；It is negative or be lower than reagent if △ Ct > 14.0
Box detection limit.
If the detection reagent of positive reference substance reaction tube has obvious amplification curve, and FAM signal positive control
CtT790M≤30, VIC signal and CY5 signal positive control pipe CtREF≤25 illustrate that experiment is effective.
Feminine gender should rise without template blank control (NTC) without amplification curve；Otherwise show that this experimental result is invalid, it is proposed that
Replacement operation environment or reaction reagent, are tested again.
The EGFR external control gene and reference gene Ct value of sample should control within 25, for assessing in reaction system
Nucleic acid-templated amount.If EGFR external control gene and reference gene Ct value are greater than 25, illustrate that the DNA being added contains PCR inhibitor or DNA
Additional amount is very little, need to extract again or increase DNA additional amount and do again.(only for full negative findings；If it is determined that for sun
Property, it is as a result still reliable).
Sensitivity, specific detection
By NC I-H1975 cell genomic dna (20/5 μ L of copy) and NCI-H3122 cell genomic dna, (20000 are copied
According to sensitivity quality-control product is mixed and made into equal volume, (respectively 0.1%, 0.01% is prominent respectively by shellfish/5 μ L, 200000/5 μ L of copy
Become content), while NCI-H3122 cell genomic dna is diluted to/5 μ L's of the copy of 10000 copies/5 μ L and 100000 respectively
Wild type quality-control product.All sensitivity quality-control products and wild type quality-control product are according to Human epidermal growth factor receptor gene T790M provided by the present invention
Mutation detection kit and detection method are detected.
FAM, VIC, CY5 signal have amplification curve, wild type quality-control product detection knot in sensitivity quality-control product testing result
FAM signal is expanded without curve in fruit, and VIC, CY5 signal have amplification curve, and Ct value see the table below 3.Analysis chart is shown in Fig. 1-4.Knot
Fruit shows that 0.01% mutant DNA can be detected under 10000 copies and 100000 copy wild type gene group DNA backgrounds.Together
When be resistant to the wild type gene group DNA of 100000 copies, without there is non-specific amplification.
3 quality-control product of table detects Ct value
The practical application of 3 detection method of embodiment
Using EGFR gene T790M mutation in kit of the present invention and detection method detection peripheral blood from patients with lung cancer, method
It is as follows:
1. the processing of sample to be examined
Patients with Non-small-cell Lung of the selection 20 after the first generation, second generation EGFR-TKIs drug resistance, according to informed same
In the mind according to medical conventional decimation peripheral blood, separated plasma uses QIAamp circulating nucleic acid kit
(55114, Qiagen) plasma DNA is extracted, the stoste of extraction is as PCR detection template.
2. fluorescence quantitative PCR detection
PCR detection is carried out to 20 samples, prepares detection reaction solution according to the following table 4
4 detection architecture reaction solution of table is prepared
Prepared PCR reaction solution vortex oscillation is mixed, of short duration centrifugation.According to the amount point of each 20 μ L of PCR reaction tube
This mixed liquor is not dispensed into each PCR reaction tube.
20 sample DNAs to be checked, positive reference substance (STD) and negative controls (NTC) are pressed into each reaction tube 5 respectively
The amount of μ L is added in corresponding PCR pipe, and PCR reaction tube is put into quantitative PCR apparatus.
Carry out PCR amplification, amplification program are as follows:
Testing result:
Negative control and positive control experiment are normal as the result is shown, carry out according to 2 kinds of embodiment of criterion to result
Interpretation, as the result is shown:
In 20 blood samples.Detecting 11 EGFR gene T790M mutation altogether, Positive mutants rate is 55%, remaining 9
For feminine gender.Positive sample and negative sample detection and analysis figure are shown in Fig. 5-6.
While being detected using kit of the present invention and detection method, the present invention has carried out number to above-mentioned sample simultaneously
PCR verifying, the results showed that, 20 testing results are complied fully with digital pcr testing result.
In addition, it should be noted that, the specific embodiments described in this specification, source chemicals title etc. can not
Together.The equivalent or simple change that all principles described according to the invention patent design are done, is included in the protection of the invention patent
In range.Those skilled in the art described specific embodiment can be made it is various modification or
It supplements or is substituted in a similar manner, without departing from structure of the invention or surmount model defined in the claims
It encloses, is within the scope of protection of the invention.
Claims (10)
1. a kind of Human epidermal growth factor receptor gene T790M mutation detection kit, it is characterised in that: including primer sets and probe；
The primer sets are at least one set in following two groups: for the primer SEQ of EGFR gene T790M abrupt climatic change
ID NO.1 and SEQ ID NO.2；For the specific primer SEQ ID NO.4 and SEQ ID NO.5 of external control EGFR gene；
The probe is at least one set selected from the probe below for primer corresponding site:
For the specific probe SEQ ID NO.3 of EGFR gene T790M abrupt climatic change；
For the specific probe SEQ ID NO.6 of external control EGFR gene.
2. Human epidermal growth factor receptor gene T790M mutation detection kit according to claim 1, it is characterised in that: the probe
5 ' the ends of SEQ ID NO.3 are marked with fluorophor FAM, and 3 ' ends are marked with quenching group MGB；
The end probe SEQ ID NO.6 5 ' is marked with fluorophor VIC, and 3 ' ends are marked with quenching group MGB.
3. Human epidermal growth factor receptor gene T790M mutation detection kit according to claim 1, it is characterised in that: the reagent
Box further includes the primer sets and probe for reference gene, and the primer sets include SEQ ID NO.7 and SEQ ID NO.8, institute
Stating probe is SEQ ID NO.9.
4. Human epidermal growth factor receptor gene T790M mutation detection kit according to claim 3, it is characterised in that: the probe
5 ' the ends of SEQ ID NO.9 are marked with fluorophor CY5, and 3 ' ends are marked with quenching group BHQ1.
5. Human epidermal growth factor receptor gene T790M mutation detection kit according to claim 1, it is characterised in that: the reagent
Box includes the primer SEQ ID NO.1 and SEQ ID NO.2 for EGFR gene T790M abrupt climatic change；For external control EGFR base
The specific primer SEQ ID NO.4 and SEQ ID NO.5 of cause；
For the specific probe SEQ ID NO.3 of EGFR gene T790M abrupt climatic change；
For the specific probe SEQ ID NO.6 of external control EGFR gene.
6. Human epidermal growth factor receptor gene T790M mutation detection kit according to claim 5, it is characterised in that: the probe
5 ' the ends of SEQ ID NO.3 are marked with fluorophor FAM, and 3 ' ends are marked with quenching group MGB；
The end probe SEQ ID NO.6 5 ' is marked with fluorophor VIC, and 3 ' ends are marked with quenching group MGB.
7. Human epidermal growth factor receptor gene T790M mutation detection kit according to claim 5, it is characterised in that: the detection
Kit further includes enzyme mixation, including UDG enzyme, archaeal dna polymerase, PCR buffer, MgCl2, dNTPs and dUTP.
8. according to any Human epidermal growth factor receptor gene T790M mutation detection kit of claim 5-7, it is characterised in that: described
Detection kit further include positive reference substance and negative controls, positive reference substance is NCI-H1975 genomic DNA and NCI-
The mixed liquor of H3122 genomic DNA；
The negative controls are sterilizing ultrapure water.
9. a kind of Human epidermal growth factor receptor gene T790M mutation detection methods, it is characterised in that: the detection method includes the following steps:
(1) design obtains primer and probe, and the primer sets are at least one set in following two groups: being directed to EGFR gene
The primer SEQ ID NO.1 and SEQ ID NO.2 of T790M abrupt climatic change；For the specific primer SEQ of external control EGFR gene
ID NO.4 and SEQ ID NO.5；
The probe is at least one set selected from the probe below for primer corresponding site:
For the specific probe SEQ ID NO.3 of EGFR gene T790M abrupt climatic change；
For the specific probe SEQ ID NO.6 of external control EGFR gene；
(2) sample to be examined DNA is extracted, as detection template；
(3) PCR reaction solution of detection EGFR gene T790M, external control EGFR gene is respectively configured；
(4) sample to be examined, positive reference substance, negative controls are added in corresponding PCR reaction tube respectively；
(5) carry out multiple fluorescence quantitative PCR detection, multiplexed PCR amplification program are as follows: 37 DEG C 2 minutes；95 DEG C initial denaturation 10 minutes；
95 DEG C are denaturalized 15 seconds, and 60 DEG C are annealed 30 seconds, 50 circulations；
(6) according to multiple fluorescence quantitative PCR result judgement gene mutation.
10. Human epidermal growth factor receptor gene T790M mutation detection methods according to claim 9, it is characterised in that: in 60 DEG C of annealing ranks
Section collects fluorescence signal.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811164972.9A CN109207595A (en) | 2018-10-07 | 2018-10-07 | A kind of Human epidermal growth factor receptor gene T790M mutation detection kit and its detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811164972.9A CN109207595A (en) | 2018-10-07 | 2018-10-07 | A kind of Human epidermal growth factor receptor gene T790M mutation detection kit and its detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109207595A true CN109207595A (en) | 2019-01-15 |
Family
ID=64982827
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811164972.9A Pending CN109207595A (en) | 2018-10-07 | 2018-10-07 | A kind of Human epidermal growth factor receptor gene T790M mutation detection kit and its detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109207595A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110438226A (en) * | 2019-07-25 | 2019-11-12 | 深圳市优圣康生物科技有限公司 | A kind of kit, sample treatment and the determination method of the mutation of detection cis-trans |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104818318A (en) * | 2014-07-02 | 2015-08-05 | 厦门艾德生物医药科技有限公司 | Primers, probes, detection system and kit for one time detection of lung cancer multiple genes |
| CN105886648A (en) * | 2016-06-06 | 2016-08-24 | 武汉海吉力生物科技有限公司 | Kit used for detecting T790M mutation of EGFR gene |
| CN106319042A (en) * | 2016-08-18 | 2017-01-11 | 上海睿昂生物技术有限公司 | PCR micro droplet kit for examining human EGFR gene mutation |
| CN106755400A (en) * | 2016-12-21 | 2017-05-31 | 上海浦美生物医药科技有限公司 | A kind of detection method of blood EGFR gene T790M mutation |
| WO2018102162A1 (en) * | 2016-11-30 | 2018-06-07 | Exosome Diagnostics, Inc. | Methods and compositions to detect mutations in plasma using exosomal rna and cell free dna from non-small cell lung cancer patients |
| CN108504725A (en) * | 2018-06-12 | 2018-09-07 | 上海浦美生物医药科技有限公司 | A kind of primer and probe for detecting EGFR TKI sensitizing mutations |
-
2018
- 2018-10-07 CN CN201811164972.9A patent/CN109207595A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104818318A (en) * | 2014-07-02 | 2015-08-05 | 厦门艾德生物医药科技有限公司 | Primers, probes, detection system and kit for one time detection of lung cancer multiple genes |
| CN105886648A (en) * | 2016-06-06 | 2016-08-24 | 武汉海吉力生物科技有限公司 | Kit used for detecting T790M mutation of EGFR gene |
| CN106319042A (en) * | 2016-08-18 | 2017-01-11 | 上海睿昂生物技术有限公司 | PCR micro droplet kit for examining human EGFR gene mutation |
| WO2018102162A1 (en) * | 2016-11-30 | 2018-06-07 | Exosome Diagnostics, Inc. | Methods and compositions to detect mutations in plasma using exosomal rna and cell free dna from non-small cell lung cancer patients |
| CN106755400A (en) * | 2016-12-21 | 2017-05-31 | 上海浦美生物医药科技有限公司 | A kind of detection method of blood EGFR gene T790M mutation |
| CN108504725A (en) * | 2018-06-12 | 2018-09-07 | 上海浦美生物医药科技有限公司 | A kind of primer and probe for detecting EGFR TKI sensitizing mutations |
Non-Patent Citations (1)
| Title |
|---|
| E. CASTELLANOS-RIZALDOS ET AL.: "Plasma EGFR T790M mutationcombined exosomal RNA and circulating tumor DNA qPCR assay detection in NSCLC patients using a", 《EUROPEAN JOURNAL OF CANCER》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110438226A (en) * | 2019-07-25 | 2019-11-12 | 深圳市优圣康生物科技有限公司 | A kind of kit, sample treatment and the determination method of the mutation of detection cis-trans |
| CN110438226B (en) * | 2019-07-25 | 2021-09-03 | 深圳市优圣康生物科技有限公司 | Kit for detecting cis-trans mutation, sample processing method and judgment method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108949990B (en) | Kit and method for detecting EGFR gene mutation | |
| CN105349654B (en) | A kind of probe for detecting EGFR genetic mutation, primer, detection architecture and kit | |
| CN106591438B (en) | Nucleic acid combination, kit and application for detecting Her2 gene | |
| CN106399555A (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) detection method as well as standard substance and detection kit for real-time fluorescent quantitative PCR detection | |
| CN106591472A (en) | Kit, reaction system and method for detecting human EGFR gene T790M mutation | |
| CN105803088B (en) | The primer and probe and its kit of one group of detection Kras gene mutation | |
| CN106434941A (en) | Kit, reaction system and method for detecting human EGFR gene mutation | |
| CN106801091A (en) | The kit and reaction system of the deletion mutation of detection human EGFR gene exons 19 | |
| CN103923975A (en) | Kit for detecting deletion mutation of EGFR gene exon 19, and method thereof | |
| CN109112216A (en) | The kit and method of triple qPCR detection DNA methylations | |
| CN108559776A (en) | A kind of biomarker and its application for sudden weak smart auxiliary diagnosis | |
| CN106103742A (en) | A kind of method of enrichment cycles Tumour DNA and reagent | |
| CN106811517A (en) | It is a kind of for detecting that c-MET gene extrons 14 are skipped the composition and kit of mutation | |
| CN110699454A (en) | Oligonucleotide, method and kit for detecting relative expression quantity of MLL5 gene in sample | |
| CN110846409A (en) | Primer combination for detecting TNNI3K gene mutation and application thereof | |
| CN108949961A (en) | For detecting kit and its screening of adenovirus pneumonia | |
| CN110438206B (en) | Set of primers, probes and kit for detecting EGFR gene 19 exon deletion mutation | |
| CN109207595A (en) | A kind of Human epidermal growth factor receptor gene T790M mutation detection kit and its detection method | |
| CN107815494B (en) | Method, kit and oligonucleotide for detecting relative expression amount of PCM1-JAK2 | |
| CN116536402A (en) | Nucleic acid composition and kit for detecting BCR-ABL fusion gene ABL kinase region by ARMS-PCR method | |
| CN110004217A (en) | The detection method and application of EGFR gene T790M site mutation in the blood plasma of periphery | |
| CN110656171A (en) | Application of small nucleolus ribonucleic acid SNORD33 as biomarker for preparing detection kit | |
| CN109385474A (en) | Breast cancer molecular parting and DISTANT METASTASES IN risk genes group and diagnostic products and application | |
| CN110551821B (en) | Primers, probe and kit for detecting MEF2D gene rearrangement by using fluorescent quantitative PCR | |
| CN107586851A (en) | A kind of KRAS, NRAS, BRAF gene mutation detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |