CN112760337A

CN112760337A - Application of bovine rumen microbial cellulase eg gene in lactobacillus expression

Info

Publication number: CN112760337A
Application number: CN202110280895.9A
Authority: CN
Inventors: 王川; 万学瑞; 魏亚琴; 邹爱爱; 孙康永杰
Original assignee: Gansu Agricultural University
Current assignee: Gansu Agricultural University
Priority date: 2021-03-16
Filing date: 2021-03-16
Publication date: 2021-05-07

Abstract

The invention discloses an application of cow rumen microbial cellulase cbh gene and eg gene in lactic acid bacteria co-expression, belonging to the technical field of biological engineering. The invention realizes the co-expression of the cbh gene and the eg gene of the cellulase in the lactic acid bacteria by three steps of extracting DNA, constructing a vector and recombining a strain. The invention clones cellobiohydrolase gene cbh and endo-beta-1, 4-glucanase gene of bovine rumen microorganisms, clones the genes together with lactobacillus signal peptide usp45 into an expression vector pMG36e to obtain a secretory expression vector pMG36e, wherein eg is cbh, the total enzyme activity, exonuclease enzyme activity and endonuclease enzyme activity of the total enzyme activity are measured by using a DNS method, the filter paper enzyme activity is 7.2956 +/-1.5241U/mL, the exonuclease enzyme activity of supernatant precipitated protein of recombinant bacterial liquid is 13.0266 +/-0.2514U/mL, and the endonuclease enzyme activity is 14.7655 +/-0.1017U/mL.

Description

Application of bovine rumen microbial cellulase eg gene in lactobacillus expression

Technical Field

The invention belongs to the technical field of biological engineering, and particularly relates to an application of bovine rumen microbial cellulase eg gene in lactobacillus expression.

Background

The cellulase is a complex enzyme system for degrading cellulose into monosaccharide, mainly acts on beta-D-1-4 glucosidic bonds of the cellulose to degrade the cellulose into cellobiose, glucose and other substances, and mainly comprises the following components according to the difference of action parts: 1) endoglucanases (EG), i.e. endo-1,4- β -D-glucan-glucanohydrolases (endo-1,4- β -D-glucanase, ec3.2.1.4), also known as Cx enzymes; 2) exoglucanase (CBH), an exo- β -1, 4-D-glucan-cellobiohydrolase (exo-B-1,4-D-glucanase, ec 3.2.1.91); 3) beta-glucosidase (beta-glucosidase, BG), i.e. beta-D-glucosaccharase (beta-D-glucosidase, EC 3.2.1.21). It is through the 3 kinds of enzymes are combined together, cellulose material is degraded into monosaccharide, they are not all necessary. Endoglucanase mainly plays a role in beta-D-1, 4 glucosidic bonds of cellulose, so that the beta-D-1, 4 glucosidic bonds are broken to generate a large number of short-chain cellulose molecules and oligosaccharides, and some cellulose molecules have non-reducing ends. The exo-beta-1, 4-glucanase mainly acts on cellulose micromolecules with non-reducing ends and reducing ends of endoglucanase hydrolysate, and cellobiose molecules are generated by hydrolyzing beta-D-1, 4-glucosidic bonds of cellulose. Further hydrolysis of this disaccharide and other cellooligosaccharides is degraded to glucose by the action of β -glucosidase.

The silage of the straws can be stored for a long time, the palatability of the feed can be improved, and the contents of cellulose, vitamins, protein and the like of the feed are not influenced basically. However, the cell wall of the plant straw contains 40-50% of cellulose, the content is basically unchanged in the ensiling process, the plant straw needs to be hydrolyzed into monosaccharide under the action of cellulase, the monosaccharide is easy to be absorbed and utilized by animals, the cell wall of the plant is damaged, nutrient components in protoplasm can be released, and the utilization rate of the feed and the production performance of the animals are increased. Researches also find that the cellulase added into the feed can supplement the deficiency of endogenous enzymes of herbivores, has the effect of eliminating anti-nutritional factors, can improve the production performance of livestock and poultry, and has the functions of reducing the adhesion and planting of pathogenic microorganisms and the like. Therefore, a cellulase gene co-expression vector is introduced into lactic acid bacteria through a genetic engineering method to construct a secretory expression strain, and the successful construction of the lactic acid bacteria secretory expression vector can realize the secretory expression of a foreign gene, so that the cellulase can be directly added into a silage raw material for silage without carrying out fermentation production, purification and addition processes of an enzyme preparation, the cellulase is continuously secreted while silage is carried out, the cellulose in straws is degraded, the generated monosaccharide can be utilized by the lactic acid bacteria, silage is promoted, and the quality, the nutritional value and the digestibility of the silage can be improved.

Disclosure of Invention

The invention aims to provide the application of bovine rumen microbial cellulase eg gene in lactobacillus expression, which can improve the utilization rate of cellulose in silage and improve the quality, the nutritional value and the digestibility of the silage.

In order to achieve the purpose, the invention adopts the following technical scheme:

an application of cow rumen microbial cellulase cbh gene and eg gene in lactobacillus co-expression comprises the following steps:

1) extracting total DNA of bovine rumen mixed microorganisms;

2) amplifying by taking total DNA as a template to obtain a cbh gene and an eg gene fragment, integrating the cbh gene and the eg gene fragment with a lactobacillus signal peptide usp45 into an expression vector pMG36e to construct a secretory expression vector pMG36e, wherein eg is cbh;

3) the recombinant plasmid with correct sequencing is electrically transduced into lactic acid such as coccus L.lactis NZ9000 to obtain pMG36e:: eg:: cbh/L.lactis NZ9000 recombinant strain.

Further, the bovine rumen microbial cellulase gene consists of an aspergillus fumigatus cellobiohydrolase cbh gene and a paenibacillus polymyxa endo-beta-1, 4-glucanase gene.

Further, the lactobacillus acceptor bacteria is L.lactis NZ 9000.

The application of the cow rumen microbial cellulase cbh gene and the eg gene in lactic acid bacteria co-expression is realized by adopting the following modes:

1) recombining the aspergillus fumigatus cellobiohydrolase cbh gene with a paenibacillus polymyxa eg gene to obtain a recombinant lactobacillus strain;

2) respectively taking filter paper, regenerated amorphous cellulose and CMC-Na as substrates, and determining total enzyme activity, exonuclease enzyme activity and endonuclease enzyme activity by using a DNS method;

3) and (3) determining the substrate specificity, the most suitable pH and temperature of the recombinase and the influence of metal ions and chemical reagents on the enzyme activity by taking the supernatant of the recombinant bacteria liquid as a crude enzyme.

Further, the recombinant lactobacillus strain in the step 1) secretes the recombinant cellulase to the outside of the cell, and two bands are arranged between 48 kDa and 65 kDa.

Further, the enzyme activity of the filter paper in the step 2) is 7.2956 +/-1.5241U/mL, the enzyme activity of the exonuclease of the recombinant bacteria liquid supernatant precipitated protein is 13.0266 +/-0.2514U/mL, and the enzyme activity of the endonuclease is 14.7655 +/-0.1017U/mL.

Further, the substrate specific size sequence in the step 3) is microcrystalline cellulose > regenerated amorphous cellulose > CMC-Na > absorbent cotton > filter paper.

Further, the optimal pH and temperature in step 3) are pH 6 and 80 ℃, respectively.

The Aspergillus fumigatus cellobiohydrolase cbh gene is numbered XM _745951.1 in GeneBank, the paenibacillus polymyxa eg gene and the GeneBank is numbered AB _ 695293.1.

1mM of Fe2+ and Ba2+ have a promoting effect on recombinant lactobacillus cellulase; while 1mM of Mn2+ and Cu2+ hardly has influence on enzyme activity; meanwhile, 1mM of Zn2+, Mg2+, Ca2+, Hg2+, Co2+, K +, Mg2+, EDTA and 1% of Tween 20 have inhibition effect on enzyme activity. 5mM of Mn2+, Fe2+, Ba2+, Ca2+, Cu2+, Co2+, Mg2+ and 10% of Tween 20 have promotion effect on enzyme activity; 5mM of Zn2+, Hg2+, K + and EDTA have inhibitory effect on enzyme activity.

Compared with the prior art, the invention has the beneficial effects that:

1) according to the invention, a plurality of pairs of primers are designed according to cellulase cbh gene and eg gene sequences downloaded by NCBI, and two target bands with the size of about 1500bp are respectively amplified by taking the whole genome of bovine rumen as a template; cloning the lactobacillus signal peptide usp45 and the lactobacillus signal peptide usp45 into an expression vector pMG36e to obtain a secretory expression vector pMG36e: eg: cbh; the recombinant plasmid is double-digested by Sac I and XbaI, XbaI and Pst I endonucleases respectively, the Sac I single-digested recombinant plasmid and a pMG36e empty plasmid are used for verification, two bands with the size of about 1500bp are cut out from the recombinant plasmid, and the plasmid is sent to Jinzhi company for sequencing, and the result shows that the pMG36e comprises eg and cbh recombinant plasmid is successfully constructed.

2) The invention adopts 10% TCA/acetone precipitation to concentrate protein in the supernatant, and prepares the supernatant and the precipitate respectively for SDS-PAGE analysis by using pMG36e:: eg: cbh/L.lactis NZ9000 bacterial liquid and pMG36e empty plasmid bacterial liquid, and the result shows that the concentrated protein has two bands between 48-65kDa, which shows the expression of the target protein.

3) The invention takes pMG36e cgh/L.lactis NZ9000 bacterial liquid, supernatant, precipitate and concentrated protein and pMG36e/NZ9000 bacterial liquid as negative control, and respectively adds CMC-Na/GM17 and microcrystalline cellulose/GM 17 solid culture medium as blank control for incubation reaction at 30 ℃. The enzyme has certain enzyme activity as shown in the specification that the pMG36e comprises eg, cbh/L.lactis NZ9000 supernatant, pMG36e comprises eg, cbh/L.lactis NZ9000 concentrated protein and pMG36e comprises eg, cbh/L.lactis NZ9000 bacterial solution has obvious hydrolysis loop, and the diameter of the concentrated hydrolysis loop is larger than that of pMG36e, eg, cbh/L.lactis NZ9000 supernatant.

4) The invention clones cellobiohydrolase gene cbh and endo-beta-1, 4-glucanase gene of bovine rumen microorganisms, clones the genes together with lactobacillus signal peptide usp45 into an expression vector pMG36e to obtain a secretory expression vector pMG36e, wherein eg is cbh, the total enzyme activity, exonuclease enzyme activity and endonuclease enzyme activity of the total enzyme activity are measured by using a DNS method, the filter paper enzyme activity is 7.2956 +/-1.5241U/mL, the exonuclease enzyme activity of supernatant precipitated protein of recombinant bacterial liquid is 13.0266 +/-0.2514U/mL, and the endonuclease enzyme activity is 14.7655 +/-0.1017U/mL.

Drawings

FIG. 1 is a schematic diagram of a recombinant plasmid of the present invention;

FIG. 2 is a genetic cluster analysis of the eg gene and cbh gene of bovine rumen microbial cellulase of the present invention;

FIG. 3 shows the bovine rumen microbial cellulase eg gene and cbh gene amplification and recombinant plasmid restriction enzyme digestion verification;

FIG. 4 is SDS-PAGE electrophoresis of protein expression of recombinant strains according to the invention;

FIG. 5 shows that the recombinant strain takes CMC-Na as a substrate Congo red hydrolysis ring and takes microcrystalline cellulose as a substrate Congo red dyeing hydrolysis ring;

FIG. 6 shows the analysis of enzymatic properties in the present invention.

Wherein red in FIG. 1 represents inserted bovine rumen microbial cellulase cbh gene, and green represents eg gene;

in FIG. 2, it is found that the cbh gene of bovine rumen microbial cellulase is one-fold with the cellobiohydrolase gene of Aspergillus fumigatus, and the eg gene is one-fold with the paenibacillus polymyxa endo-beta-1, 4-glucanase gene;

in FIG. 3, M10000:10000bp of DNAmarker; m5000:5000bp DNAmarker; 1, amplifying bovine rumen microbial cellulase cbh gene; 2, amplifying bovine rumen microbial cellulase eg gene; 3: single enzyme digestion of pMG36e plasmid; 4: single enzyme digestion of recombinant plasmid; 5: carrying out double digestion on the recombinant plasmid SacI and Xba I; 6: carrying out double enzyme digestion on the recombinant plasmid Xba I and Pst I;

in FIG. 4, M is a protein Marker; 1: pMG36e/NZ9000 bacterial liquid; pMG36e/NZ9000 supernatant; 3: pMG36e/NZ9000 precipitate; 4 pMG36e, eg, cbh/NZ9000 bacteria liquid; 6 pMG36e: eg: cbh/NZ9000 supernatant; 7 pMG36e: eg: cbh/NZ9000 concentrated protein; 8: 0.1g/mL cellulase standard.

1 in FIG. 5: pMG36e/NZ9000 precipitate; 2: pMG36e/NZ9000 bacterial liquid; 3: pMG36e/NZ9000 supernatant; 4: pMG36e, eg, cbh/NZ9000 bacterial liquid; 5: pMG36e: eg: cbh/NZ9000 supernatant pMG36e: eg: cbh/NZ9000 precipitate; 7: pMG36e: eg: cbh/NZ9000 concentrated protein; 8: 0.1g/mL cellulase standard.

FIG. 6 is a graph A, B, C, D showing the effect of different substrates, different metal ions and chemical reagents, different pH values, and different temperatures on the activity of recombinant enzymes in sequence.

Detailed Description

The following examples are given to further illustrate the embodiments of the present invention. The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.

The following will further specifically describe the application of the bovine rumen microbial cellulase eg gene in the expression of lactic acid bacteria.

Materials and methods

1. Test materials

1) Strains and carriers: specifically rumen fluid, lactobacillus (L.lactis) NZ9000, E.coli JM109 and a vector pMG36 e.

2) Preparing a culture medium:

LB liquid medium:

tryptone 1g

Yeast extract 0.5g

Sodium chloride NaCl 1g

Adding water to 100mL, and autoclaving at 121 deg.C for 30 min.

LB solid medium: to 100mL of LB liquid medium was added 1.6g of agar, and autoclaved at 121 ℃ for 20 min.

GM17 liquid medium (erythromycin resistance):

adding water to 100mL, and autoclaving at 115 deg.C and pH7.1 for 20 min. (Vc mother liquor preparation: 5g vitamin C solid powder added with 100mL distilled water, filtered by a 0.45 μm bacteria filter; 0.025g/mL erythromycin mother liquor preparation: 0.125g erythromycin dissolved in 50mL absolute ethanol)

GM17 solid medium: to 100mL of GM17 liquid medium was added 1.5g of agar and autoclaved at 115 ℃ for 20 min.

CMC-Na/GM17 solid medium (for Congo red staining): adding 1g of CMC-Na into 100mL of GM17 solid culture medium, heating while stirring, and autoclaving at 115 ℃ for 20min after the CMC-Na is dissolved; microcrystalline cellulose/GM 17 solid medium: 1g of microcrystalline cellulose was added to 100mL of GM17 solid medium, and the mixture was stirred while heating, and after stirring, the mixture was autoclaved at 15 ℃ for 20 min.

3) Main reagents and instruments:

4) reagent preparation

10% (w/v) TCA/acetone: 10g TCA (trichloroacetic acid) was dissolved in 100mL acetone and stored at-20 ℃;

lysozyme buffer solution: 0.3moL/L sucrose, 25mmoL/L Tris-HCl (pH8.0), 25mmoL/L EDTA (pH8.0).

2 × SDS loading buffer: SDS 4g, bromophenol blue 0.2g, glycerol 20mL, 1.0moL/LTris-HCl 10mL, beta-mercaptoethanol 10mL, and distilled water to 100 mL.

Tris-glycine electrophoresis buffer: 3.02g Tris, 18.8g glycine and 1g SDS were weighed into a 1L beaker, dissolved by stirring, and added with distilled water to a constant volume of 1000 mL.

Elution buffer: 500mmoL/L NaCl, 20mmoL/L Tris-HCl, 250mmoL/L imidazole, pH 8.9.

10% SDS 1g of SDS was weighed out and dissolved in 10mL of ddH 2O.

1.0mol/L Tris-HCl buffer 6.6g Tris was weighed, 40mL distilled water was added, pH was adjusted to 6.8 with concentrated hydrochloric acid, and distilled water was added to 50mL.

1.5mol/L Tris-HCl buffer 9.08g Tris was weighed, 40mL distilled water was added, pH was adjusted to 8.8 with concentrated hydrochloric acid, and distilled water was added to 50mL.

Congo red staining solution: 0.1g Congo red is weighed out and dissolved in 10mL ddH2O, and placed at 4 ℃ for use

100mmol/L CaCl2 solution: adding distilled water into 1.109g CaCl2 to reach a constant volume of 100mL, autoclaving at 121 ℃ for 30min, and storing at 4 ℃.

15% glycerol CaCl2 solution: 2mL of glycerol +8mL of 100mmol/L CaCl2 solution, autoclaving at 121 ℃ for 30min, and storing at 4 ℃.

Solution A: 10% of glycerol, 0.5mol/L of sucrose and autoclaving at 115 ℃ for 20 min.

Solution B: 0.05mol/L ETDA, 0.5mol/L sucrose, 10% glycerol, and autoclaving at 115 deg.C for 20 min.

1% (W/V) carboxymethyl cellulose suspension: dissolving 1g of carboxymethyl cellulose in 100mL of water, mixing uniformly, and placing in a refrigerator at 4 ℃ for later use.

0.1M sodium acetate buffer: the purchased 3M sodium acetate buffer was diluted 30 times, adjusted pH with acetic acid and NaOH, and kept in a refrigerator at 4 ℃ for further use.

2% (W/V) carboxymethyl cellulose suspension: 2g of carboxymethyl cellulose is dissolved in 100mL of sodium acetate buffer solution, mixed evenly and put in a refrigerator at 4 ℃ for standby.

2% (W/V) microcrystalline cellulose suspension: 2g of microcrystalline cellulose is dissolved in 100mL of sodium acetate buffer solution, mixed evenly and put in a refrigerator at 4 ℃ for standby.

Preparation of Regenerated Amorphous Cellulose (RAC):

A. weighing 0.2g of microcrystalline cellulose, placing the microcrystalline cellulose into a 50mL centrifuge tube, adding 600 mu L of 0 ℃ sterile water, and stirring uniformly to obtain slurry;

B. 10mL of 85% pre-cooled phosphoric acid at 0 ℃ is measured, 8mL is slowly added, rapid stirring is carried out while adding,

adding the rest 2mL after fully mixing, fully stirring to completely dissolve the microcrystalline cellulose, and after a few minutes, enabling the solution to become transparent;

C. standing on ice for 1h, and stirring at proper time;

D. 40mL of 0 ℃ sterile water was added thereto in an amount of 10mL each time, and the mixture was sufficiently stirred to obtain a white precipitate. Centrifuging at 4 deg.C for 20min at 5,000 Xg, discarding the supernatant, washing the precipitate with precooled sterile water for 4 times to remove residual phosphoric acid;

E. adding 2mol/L Na2CO3 solution 200 mu L into the precipitate to neutralize residual phosphoric acid, then adding 45mL of precooled sterile water, centrifuging, removing supernatant, and repeatedly washing the precipitate until the pH value is 5-7;

F. the resulting precipitate was diluted to 1% and stored at 4 ℃ for further use.

2. Experimental methods

1) Designing a primer:

(the gliding single line is a Sac I recognition site);

Eg-R:GCTCTAGACTAATTTGGTTCTGTTCCCCA-3' (the glide single line is Xba I recognition site)

(the underlined single line is the Xba I recognition sequence);

cbh-R：AACTGCAGTACAGGCACTGAGAGTAATA, respectively; (the underlined single line is Pst I recognition sequence);

wherein the gliding double line is a ribosome binding site, and the gliding wavy line is a lactobacillus signal peptide usp45 sequence.

2) The extraction of the genome is to extract the total DNA of the rumen of the cattle by an improved CTAB method and carry out electrophoresis detection, and the method specifically comprises the following steps: 50mL of unfrozen rumen fluid is taken, centrifuged at 1000r/min for 10min to discard the precipitate, centrifuged at 12000r/min for 10min to discard the supernatant, and the precipitate is suspended by 5mL of TE buffer solution. Taking 1mL of the treated rumen microorganism sample, adding 5mL of DNA extraction solution (100mmol/L Tris-HCl,50mmol/L EDTA, 2% dodecyl sarcosine), and fully and uniformly mixing on an oscillator; adding 100 μ' L2 mg/mL proteinase K, quickly freezing in liquid nitrogen for 5min, then keeping the temperature in 65 deg.C water bath for 10min, repeating for 3 times; adding 20% SDS (sodium dodecyl sulfate) with the volume of 1/5, carrying out warm bath at 65 ℃ for 10min, standing at room temperature for 5min, centrifuging to collect supernatant, adding a NaCl solution into the supernatant until the final concentration is 1mol/L, CTAB reaches 1%, carrying out warm bath at 65 ℃ for 10min, placing the supernatant on ice, adding equal volumes of phenol, chloroform, isoamyl alcohol (25: 24: 1) and chloroform, respectively extracting once and twice, adding 3mol/L sodium acetate solution with the volume of 1/10 and absolute ethyl alcohol with the volume of 2 times, and placing the mixture on ice for more than 15 min; centrifuging at 12000r/min for 10min, collecting precipitate, washing with 75% ethanol for 2-3 times, drying, and dissolving in appropriate amount of TE buffer solution.

3) The rumen fluid genome is taken as a template, and the cbh gene amplification conditions are as follows: pre-denaturation at 98 ℃ for 5 min; denaturation at 98 ℃ for 30 s; renaturation at 60 ℃ for 30 s; extension at 72 ℃ for 30 s; a total of 30 cycles; extension at 72 ℃ for 10 min. The reaction system is shown in Table 1, and the eg gene amplification conditions are as follows: pre-denaturation at 94 ℃ for 5 min; 30s at 94 ℃; 30s at 56 ℃; 90s at 72 ℃; a total of 30 cycles; extending for 10min at 72 ℃; the PCR reaction system is shown in Table 2, and 3. mu.L of PCR product is taken after the PCR amplification is finished, the detection is carried out through 1% agarose gel, and the fragment size is observed. Purifying and recovering by using a DNA gel recovery kit;

TABLE 1 PCR reaction System (50. mu.L) for cbh Gene

Template	1μL
		P₁	2.5μL
P₂	2.5μL
		Taq enzyme	25μL
ddH₂O	19μL
		Total amount of	50μL

TABLE 2 PCR reaction System for eg genes (50. mu.L)

4) Extraction of the pMG36e plasmid:

a single colony of E.coli Top10 of pMG36e was cultured overnight in 3mL of LB liquid medium to a final concentration of 600. mu.g/mL (erythromycin). Centrifuging at 12000r/min for 1min, and collecting thallus plasmid extraction kit for extraction. mu.L of the extracted plasmid was collected and examined by 1% agarose gel.

5) Double enzyme digestion of the target gene and the empty plasmid:

the amplified gene and plasmid pMG36e were subjected to double digestion simultaneously, digestion was carried out at 37 ℃ for 3h, the double digestion system is shown in Table 2, and 4. mu.L of the digested product was detected on 1% agarose gel (detection before digestion was carried out for comparison).

TABLE 3 cbh double cleavage reaction with pMG36e (50. mu.L)

cbh/pMG36e	30μL
		XbaⅠ	3μL
PstⅠ	3μL

10×K Buffer	5μL
		ddH₂O	9μL
Total amount of	50μL

6) Purification of the cleavage products

The gene fragment after double enzyme digestion in the agarose gel and the plasmid pMG36e are cut and put into a clean 1.5mL centrifuge tube, the product is purified and recovered by a gel recovery kit, and the DNA is stored at the temperature of minus 20 ℃.

7) Ligation of cbh Gene to pMG36e

The cbh gene after enzyme digestion and pMG36e are connected through T4 ligase at 22 ℃ overnight, and the connection reaction system is shown in Table 3;

TABLE 4 ligation reaction System (10. mu.L)

pMG36e	1.7μL
		cbh	6.3μL
T₄ DNA Ligase	1μL
		10×Ligase buffer	1μL
Total amount of	10μL

8) And (3) transformation:

adding 100L of escherichia coli Top10 into the ligation product, gently mixing uniformly, and carrying out ice bath for 30 min.

② heat shock at 42 ℃ for 90s, ice bath for 3 min.

③ 890L of non-resistant LB liquid culture medium is added into a 1.5mL centrifuge tube, and the mixture is subjected to shaking culture at 37 ℃ for 1h and 5000r/min and then centrifuged for 2 min.

Fourthly, the supernatant is discarded, and after being mixed evenly, the mixture is added into a sterile L rod and spread on LB solid culture medium containing erythromycin (600 mug/mL). Culturing at 37 ℃ for 12-16 h.

9) Identification of positive transformants:

taking 1.5mL centrifuge tubes, adding 3mL of LB solution of erythromycin, then picking 12 single colonies on an overnight culture dish by clamping a minimum tip with forceps, directly throwing the tip of the picked colonies into the centrifuge tube, and putting 12 test tubes into a shaker at 37 ℃ and 220r/min for overnight culture. And (3) carrying out PCR identification on the bacterial liquid, and setting an experimental group, a negative control and a positive control, wherein the template of the experimental group is the cultured bacterial liquid, the negative control template is ddH2O, the positive control takes the target gene obtained by amplification as a template, PCR amplification is carried out under the conditions shown in the system shown in the table 4, and the PCR product is identified by 1% agarose gel electrophoresis. The experimental group takes cbh-F/R as a primer and recombinant bacteria liquid as a template to carry out PCR identification on the bacteria liquid, the reaction system is shown in the table, the reaction conditions are adopted, 3 mu L of amplification product is taken, and the detection is carried out through 1% agarose gel. The experimental group can expand the target band. And (3) identifying the double enzyme digestion correctly, wherein a bacterial liquid PCR reaction system comprises the following steps:

TABLE 5 bacterial liquid PCR reaction System (15. mu.L) of cbh Gene

Bacterial liquid	1μL
		P₁	0.6μL
P₂	0.6μL
		Taq enzyme	7.5μL
ddH₂O	4.5μL
		Total amount of	15μL

10) pMG36e: double restriction enzyme validation of cbh:

setting an experimental group and a control group, wherein the control group is pMG36e empty plasmid, extracting plasmid from recombinant strain liquid (stored at the temperature of minus 20 ℃), carrying out double enzyme digestion verification by Xba I and Pst I, carrying out enzyme digestion for 13h at the temperature of 37 ℃ in a double enzyme digestion reaction system shown in the table 2, detecting 4 mu L of enzyme digestion products by 1% agarose gel, carrying out PCR (polymerase chain reaction) and double enzyme digestion identification on the liquid which is positive, extracting the plasmid, and then taking 20L of the liquid to be sent to the Jinzhi biotechnology Limited company for sequencing.

11) eg and pMG36e, wherein the cbh double enzyme digestion system is shown in the table 3, the connection system is shown in the table 4, and the bacteria liquid PCR system is shown in the table 5;

12) double restriction enzyme validation of pMG36e: eg: cbh:

setting an experimental group and a control group, wherein the control group is pMG36e empty plasmid, extracting plasmid from recombinant strain liquid (stored at the temperature of minus 20 ℃), performing double enzyme digestion verification respectively by SacI, XbaI and Pst I, the double enzyme digestion reaction system is shown in the table 3, performing enzyme digestion at the temperature of 37 ℃ for 3h, detecting 4 mu L of enzyme digestion product by 1% agarose gel, detecting the liquid which is positive in PCR and double enzyme digestion identification of the liquid, extracting the plasmid, and then taking 20L of the liquid to be sent to the Jinzhi biotechnology Limited company for sequencing.

Expression of the recombinant plasmid in l.lactis NZ9000 is as follows:

1. preparation of lactic acid bacteria sensory cells: l.lactis NZ9000 bacterial liquid is taken at the temperature of minus 80 ℃, and solid non-anti-GM 17 plates are streaked for 30 ℃ to be cultured for 2 days.

1) A single colony of L.lactis NZ9000 was picked up and cultured in 5mL of GM17 liquid medium (no antibody) at 30 ℃ in a static manner.

2) Adding the bacterial liquid into the mixture according to the proportion of 1: 100, adding the mixture into GM17 liquid culture medium, and standing and culturing at 30 ℃.

3) When the OD600 of the bacterial liquid is detected to be 0.4, the culture is stopped, and the conical flask is placed on ice for 15 min.

4) After ice bath, the conical flask is slightly shaken, and the thalli are poured into a 50mL sterilized centrifuge tube and centrifuged for 20min at the temperature of 4 ℃ and at the speed of 4000 r/min.

5) Removing the supernatant, placing a 50mL centrifuge tube on ice, taking 10mL precooled solution A to suspend the thalli, fully mixing uniformly, and adding all the solution A until the total volume is 50mL.

6) Centrifuging at 4 deg.C and 6000r/min for 10min, resuspending with 25mL precooled solution B, and centrifuging at 4 deg.C and 6000r/min for 10min after combining the two tubes.

7) Collecting the precipitate, ice-cooling for 15min, re-suspending with 25mL of pre-cooled solution A, and centrifuging at 4 ℃ and 6000r/min for 10min to collect the thallus.

8) Add 4mL of ice-precooled solution A to the tube, resuspend the pellet, and dispense 100. mu.L of solution per tube in sterilized 1.5mL tubes, and store at-70 ℃.

2. Electrotransformation of L.lactis NZ9000 by recombinant plasmid

Taking out the competent cells at-70 ℃, placing the cells in an ice box for 15min to melt, adding 10 mu L of plasmid with correct sequencing into 100 mu L of competent cells NZ9000, gently blowing, uniformly mixing, putting the mixture on ice for 15min, taking out, transferring the mixture into an ice-cold click cup under the aseptic condition, and clicking by using a shock instrument under the shock condition: 1100V, 100. omega. and 25. mu.F. After electric shock transformation, 1mL of GM17 liquid culture medium (without antibody) is quickly added, ice bath is carried out for 5min, then all liquid in an electric shock cup is transferred into a centrifugal tube with 1.5mL, after static culture at 30 ℃ is carried out for 3h, resuscitative bacteria liquid is coated in GM17 solid culture medium with erythromycin final concentration of 2.5 mu g/mL, single colony is picked, PCR reaction system of positive clone is screened by adopting PCR amplification method after crude genome is boiled, and PCR reaction system of temperature reference recombinant plasmid pMG36e:: eg:: cbh bacteria liquid PCR reaction system is screened.

Concentration and SDS-PAGE analysis of pMG36e eg cbh/NZ9000 protein

1) 10% TCA/acetone precipitated concentrated protein: adding the bacterial liquid which is successfully electrotransferred into 100mL of GM17 culture medium according to the ratio of 1: 100, statically culturing for 36h at 30 ℃, transferring the bacterial liquid into two clean 50mL centrifuge tubes (autoclaving), centrifuging for 10min at 12000r/min, precipitating proteins of the supernatant by using precooled 10% TCA/acetone, centrifuging for 10min at 12000r/min, washing and precipitating twice by using precooled acetone, placing the precipitate in a ventilation cabinet for 30min, airing to completely remove the acetone, and adding 1mL of precipitation buffer to dissolve the precipitate.

2) SDS-PAGE electrophoresis:

the glue preparation formula comprises the following components:

TABLE 5 formulation of the gums

Reagent	12% separation gel	5% concentrated gum
			ddH₂O	3.3mL	4.1mL
1.5M Tris-HCl	2.5mL	-
			1.0M Tris-HCl	-	0.75mL
30％Acr	4.0mL	1.0mL
			10％APS	0.1mL	0.06mL
10％SDS	0.1mL	0.06mL
			TEMED	0.01mL	0.01mL
Total	10mL	10mL

Rapidly blowing and uniformly mixing, adding 8mL of separation glue into a gap between two glass plates, slightly adding a distilled water pressure line, discharging bubbles between the two glass plates, standing for 30min, obliquely observing whether the separation glue is solidified, pouring out the upper layer of distilled water after the separation glue is solidified, preparing 5% concentrated glue in a small beaker, rapidly blowing and uniformly mixing by using a gun, filling the gap between the two glass plates with the concentrated glue, completely discharging the bubbles between the glass plates, inserting a comb with the diameter of 1.0mm, and standing for 30min, and observing whether the concentrated glue is solidified.

② processing the sample. Respectively taking 1mL of the supernatant, the precipitate, the bacterial liquid, the supernatant of the recombinant strain, the precipitated protein, the bacterial liquid and the cellulase standard substance, respectively, uniformly mixing with 2 xSDS Loading Buffer and the sample, boiling in boiling water for 10min, cooling, centrifuging at 12000r/min for 5min, and taking the supernatant and running glue.

And carrying out SDS-PAGE electrophoresis. Firstly, pre-electrophoresis is carried out on the prepared glue for 30min under the voltage of 80V, after electrophoresis, 30 mu L of processed samples before induction, after induction and after purification are respectively added into a hole, electrophoresis is carried out by the voltage of 100V, when a sample strip runs to the junction of the separation glue and the concentrated glue, the voltage is adjusted to be 200V, and when the strip runs to the most edge, the electrophoresis is stopped.

And fourthly, dyeing and decoloring. And (3) slowly taking the well-run glue down from the glass plate, putting the glue into Coomassie brilliant blue staining solution for dyeing for 5h, taking out the dyed glue, washing the glue with water, and putting the glue into the decolorizing solution for decolorizing until the glue presents a clear strip.

The enzyme activity was measured as follows:

1. preparation of glucose Standard Curve

Three parallel tubes of 24 samples with a scale were taken, and the following reagents were added in the order of Table 6.

TABLE 6 order of addition of reagents

Sequentially mixing, boiling in water bath for 10min, vortex mixing, and ultraviolet irradiating with the first tube as blank control

The absorbance was measured at 550nm under a spectrophotometer, and a glucose standard curve was plotted with the glucose concentration as the abscissa and the absorbance as the ordinate.

2. Preparation of crude enzyme solution

Performing static culture at 30 ℃ for 36h, transferring the bacterial liquid into two clean 50mL centrifuge tubes, centrifuging at 12000r/mi for 10min, and collecting the supernatant as a crude enzyme liquid;

3. congo red staining method for determining enzyme activity

The enzyme activity of endoglucanase is measured by Congo red dyeing method, 30 microliter of crude enzyme solution and concentrated protein are taken and added into a perforated CMC-Na/GM17 solid culture medium and a microcrystalline cellulose/GM 17 solid culture medium, after overnight culture in a 30 ℃ incubator, 1% Congo red is used for dyeing for 1 hour, 1mol/L NaCl solution is used for decoloring for 1 hour, and the hydrolytic activity of the endoglucanase is roughly judged according to the diameter of a hydrolytic ring.

4. Research on enzyme activity property of recombinant cellulase

1) Detection of recombinase substrate specificity

RAC, sodium carboxymethylcellulose (CMC-Na), absorbent cotton, microcrystalline cellulose and filter paper are respectively used as substrates, 1mL of crude enzyme is added, the reaction is carried out for 30min at 50 ℃, the yield of reducing sugar is measured by a DNS method,

the specific activities of the recombinase on different substrates were calculated to characterize the substrate specificity of the enzyme.

2) Influence of temperature on the activity of recombinant enzymes

Uniformly mixing 1mL of recombinant crude enzyme and 1mL of substrate microcrystalline cellulose according to a certain proportion, respectively reacting at 30-90 ℃ for 30min, determining the activity of the cellulase according to DNS, and drawing a relation curve of relative enzyme activity and reaction temperature by taking the highest enzyme activity as 100%.

3) Effect of pH on recombinant enzyme Activity

Acetic acid-sodium acetate buffer solutions with pH values of 3, 4, 5, 6, 7, 8 and 9 are respectively selected to prepare microcrystalline cellulose reaction substrate solutions, each group is repeated for three times, the activity of cellulose exoglucanase is determined according to a DNS method, and the influence of different pH values on the activity of recombinant exoglucanase is analyzed.

4) Effect of Metal ions and chemical reagents on the Activity of recombinant enzymes

After the optimal temperature and the optimal pH value of the highest enzyme activity of the reaction are determined, different metal ions and chemical reagents are respectively added into the reaction liquid of the crude enzyme liquid and the microcrystalline cellulose to ensure that the final reaction concentrations are 1.0mmol/L, 5.0mmol/L and 1 percent and 10 percent of chemical reagents, and Mn2+, Zn2+, Fe2+, Ba2+ and Ca2+ are mainly measured

Cu2+, Hg2+, Co2+, K +, Mg2+, EDTA and Tween 20 have influence on enzyme activity, the reaction is carried out at room temperature for 30min, each group is repeated for three times, high-temperature and high-pressure inactivated enzyme with the same volume is added after the reaction as a control, and DNS is used for inactivating enzyme

The method is used for measuring the enzyme activity and the influence of metal ions and chemical reagents on the enzyme activity.

5. Enzyme activity determination of recombinant cellulase

After the optimal substrate, pH and temperature are determined, 1% microcrystalline cellulose is prepared by using an acetic acid-sodium acetate buffer solution with the optimal pH, 1mL of the microcrystalline cellulose is taken, 1mL of 10% TCA/acetone is added to precipitate and concentrate protein in a test tube, the reaction is carried out at 80 ℃ for 30min, 1.5mL of DNS reagent is added, after boiling water bath is carried out for 10min, then the test tube is placed in ice water for cooling, distilled water is added to each test tube to 25mL respectively, vortex mixing is carried out, enzyme for high-pressure high-temperature fire extinguishing is used as a blank control, absorbance is measured at the position with the wavelength of 550nm respectively, and the result.

4. Determination of Total enzyme Activity of cellulase by Filter paper enzyme Activity (FPA)

The total enzyme activity of the cellulase is measured by adopting filter paper enzyme activity (FPA), a Xinhua filter paper strip of 1cm multiplied by 6cm (50 +/-1 mg) is placed in a test tube, 1mL of concentrated protein and 1.0mL of acetic acid-sodium acetate buffer solution with the optimal pH are sequentially placed in the test tube, then the test tube is sealed by plastic paper, water bath at the optimal temperature is carried out for 30min, the concentrated protein and the acetic acid-sodium acetate buffer solution are taken out and rapidly added with 1.5mL of DNS, the DNS is boiled for 10min, distilled water is added after cooling, the volume is kept to 25mL, and the OD.

6. Calculation of enzyme Activity

Y＝1000CVX/MV1T

In the formula: y-enzyme Activity of the sample (U/mL)

C-glucose content in test solution (mg/mL)

V-volume of constant volume after DNS reaction (mL)

Dilution factor of crude enzyme solution in X-reaction

Molecular weight of M-glucose

V1-volume of crude enzyme solution (mL) taken after dilution for catalyzing the degradation of cellulose

T-hydrolysis reaction time (min)

The regression equation was obtained from the measured data with Excel software: 0.9709x +0.0289, R²A good linear relationship of the standard curve was obtained at 0.997.

As a result of Congo red dyeing, the obvious hydrolysis ring can not be formed by using CMC-Na as a substrate, and no hydrolysis ring is formed by using microcrystalline cellulose as a substrate.

And (3) determining the substrate specificity, the most suitable pH and temperature of the recombinase and the influence of metal ions and chemical reagents on the enzyme activity by taking the supernatant of the recombinant bacteria liquid as a crude enzyme. The activity on microcrystalline cellulose, filter paper, absorbent cotton, CMC-Na and Regenerated Amorphous Cellulose (RAC) is found, and the substrate specificity is in the order of microcrystalline cellulose > RAC > CMC-Na > absorbent cotton > filter paper; the optimum pH and temperature were pH 6 and 80 ℃. 1mM of Fe2+ and Ba2+ have a promoting effect on recombinant lactobacillus cellulase; while 1mM of Mn2+ and Cu2+ hardly has influence on enzyme activity; meanwhile, 1mM of Zn2+, Mg2+, Ca2+, Hg2+, Co2+, K +, Mg2+, EDTA and 1% of Tween 20 have inhibition effect on enzyme activity. 5mM of Mn2+, Fe2+, Ba2+, Ca2+, Cu2+, Co2+, Mg2+ and 10% of Tween 20 have promotion effect on enzyme activity; 5mM of Zn2+, Hg2+, K + and EDTA have inhibitory effect on enzyme activity.

The enzyme activity of the recombinase filter paper is 7.2956 +/-1.5241U/mL, the enzyme activity of the protease exonuclease precipitated by the supernatant of the recombinant bacterial liquid is 13.0266 +/-0.2514U/mL, and the enzyme activity of the endonuclease is 14.7655 +/-0.1017U/mL.

From the above experimental results, it can be seen that: according to a cellulase eg gene cbh gene sequence downloaded by NCBI, primers are designed, and two target bands with the size of about 1500bp are respectively amplified by taking the whole genome of bovine rumen as a template; the recombinant plasmid pMG36e, eg, cbh and pMG36e empty plasmids are simultaneously digested by SacI, XbaI and PstI endonucleases respectively, two bands with the size of about 1500bp are cut out from the recombinant plasmid, and the plasmid is sent to Jinweizhi company for sequencing, and the result shows that the pMG36e, eg, cbh recombinant plasmid is successfully constructed.

The invention adopts 10% TCA/acetone precipitation to concentrate protein in the supernatant, pMG36e:: eg: cbh/NZ9000 bacterial liquid, supernatant, precipitation and pMG36e bacterial liquid of empty plasmid, the supernatant and the precipitation are respectively prepared and subjected to SDS-PAGE analysis, the result shows that the concentrated protein has two obvious bands between 48-65kDa, and the expression of the target protein is shown.

The invention takes pMG36e cgh/NZ 9000 bacterial liquid, supernatant, sediment and concentrated protein and pMG36e/NZ9000 bacterial liquid, the supernatant and the sediment as negative controls, and ddH2O as a blank control, and CMC-Na/GM17 solid culture medium and microcrystalline cellulose/GM 17 solid culture medium are added for incubation reaction at 30 ℃. Congo red dyeing results show that CMC-Na as a substrate has a hydrolysis ring, and microcrystalline cellulose as a substrate has no hydrolysis ring.

And the most suitable substrate, pH and temperature of the recombinase and the influence of metal ions and chemical reagents with different concentrations on the enzyme activity of the recombinase are determined.

The invention clones the cellulase eg and cbh genes of bovine rumen, successfully constructs the secretory expression plasmid pMG36e:: eg:: cbh/NZ 900.

Finally, it should be noted that: although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that modifications may be made to the embodiments or portions thereof without departing from the spirit and scope of the invention.

Claims

1. An application of cow rumen microbial cellulase cbh gene and eg gene in lactobacillus co-expression is characterized by comprising the following steps:

1) extracting total DNA of bovine rumen mixed microorganisms;

2. The use of the cbh gene and the eg gene of bovine rumen microbial cellulase in lactic acid bacteria co-expression according to claim 1, wherein the cbh gene of bovine rumen microbial cellulase consists of the cbh gene of aspergillus fumigatus cellobiohydrolase and the endo-beta-1, 4-glucanase gene of paenibacillus polymyxa.

3. The use of the cbh gene and the eg gene of bovine rumen microbial cellulase in co-expression of lactic acid bacteria according to claim 1, wherein the recipient bacterium of lactic acid bacteria is L.lactis NZ 9000.

4. The use of the cbh gene and the eg gene of bovine rumen microbial cellulase in lactic acid bacteria co-expression according to claim 1, 2 or 3, which comprises the following steps:

1) extracting total DNA of bovine rumen mixed microorganisms;

5. The use of the cbh gene and the eg gene of bovine rumen microbial cellulase in lactic acid bacteria co-expression according to claim 4, wherein:

6. The use of the cbh gene and the eg gene of bovine rumen microbial cellulase in lactic acid bacteria co-expression according to claim 5, wherein the recombinant lactobacillus strain in step 1) secretes the recombinant cellulase extracellularly, and there are two bands between 48-65 kDa.

7. The use of the bovine rumen microbial cellulase cbh gene and eg gene in lactobacillus co-expression according to claim 5, wherein the filter paper enzyme activity in step 2) is 7.2956 ± 1.5241U/mL, the exonuclease enzyme activity of the recombinant bacterial liquid supernatant precipitated protein is 13.0266 ± 0.2514U/mL, and the endonuclease enzyme activity is 14.7655 ± 0.1017U/mL.

8. The use of the bovine rumen microbial cellulase cbh gene and eg gene in lactobacillus co-expression according to claim 5, wherein the substrate specificity size sequence in step 3) is microcrystalline cellulose > regenerated amorphous cellulose > CMC-Na > absorbent cotton > filter paper.

9. The use of the cbh gene and the eg gene of bovine rumen microbial cellulase in co-expression of lactic acid bacteria according to claim 5, wherein the optimal pH and temperature in step 3) are pH 6 and 80 ℃.