CN112760307A

CN112760307A - Zearalenone toxin degrading enzyme mutant and production strain thereof

Info

Publication number: CN112760307A
Application number: CN202110124614.0A
Authority: CN
Inventors: 李宾; 程斯达; 康丽华; 张静静; 郭瑞; 黄亦钧; 李玉强
Original assignee: Weifang Kdn Biotech Co ltd; Qingdao Vland Biotech Group Co Ltd
Current assignee: Weifang Kdn Biotech Co ltd; Qingdao Vland Biotech Group Co Ltd
Priority date: 2021-01-29
Filing date: 2021-01-29
Publication date: 2021-05-07
Anticipated expiration: 2041-01-29
Also published as: CN112760307B

Abstract

The invention relates to the technical field of genetic engineering, and particularly provides a zearalenone toxin degrading enzyme mutant and a production strain thereof. Compared with the wild type, the mutants H1-T1 and H1-T2 are recombined and expressed in pichia pastoris, the specific enzyme activity is respectively improved by 75.1 percent and 172.2 percent, the production cost of the enzyme is favorably reduced, and the popularization and the application of the enzyme in the feed field are promoted.

Description

Zearalenone toxin degrading enzyme mutant and production strain thereof

Technical Field

The invention belongs to the technical field of genetic engineering and microbial modification, and particularly relates to a zearalenone degrading enzyme mutant and a production strain thereof.

Background

Mycotoxins (mycotoxins) are toxic secondary metabolites produced by mold during growth, and mainly include Aflatoxins (AF), trichothecenes (trichothecenes, such as T-2 toxin, neosolanum solani-cenol NEO and vomitoxin DON), zearalenone (zenaloenone, ZEN), ochratoxin a (OTA), and fumonisins (fumonisins). The raw materials such as grains and the like are polluted by the mould in the field, if the environmental temperature and the humidity are proper in the processes of transportation, processing and storage, the mould can continue to grow, and the toxin content can be increased successively. According to the estimation of the Food and Agriculture Organization (FAO) of the United nations, 25% of grains are polluted by mycotoxin every year all over the world, and 2% of grains cannot be eaten on average; in addition, the diseases and death caused by animal poisoning due to toxin pollution cause huge economic loss to the food industry and the animal husbandry.

Zearalenone (ZEN), also known as the F-2 toxin, was isolated in 1962 from maize contaminated with gibberellic disease by Stob et al. The Fusarium graminearum, Fusarium culmorum and Fusarium crookwellense are mainly produced by Fusarium graminearum, Fusarium culmorum and Fusarium crookwellense, the Fusarium is parasitic and saprophytic, the ecological adaptability is strong, the distribution is wide, and corn, wheat, barley, oat and other grains are mildewed and easily infected with Fusarium and polluted by ZEN. The ZEN is absorbed by the animals through eating the ZEN-polluted feed, has estrogen-like effect, can compete with estrogen to bind to corresponding receptors (ER) in vivo, activates downstream reaction elements, triggers estrogen receptor dimerization, further generates a series of pseudo-estrogen effects, causes the estrogen level disorder in the animals and destroys the reproductive system of the animals, particularly sows. Mainly manifested by decreased appetite, immunosuppression and slow growth, and the continuous poisoning can cause reproductive disorders of female animals, causing infertility, abortion and stillbirth. ZEN also has strong carcinogenicity, and can affect meat and dairy products edible to humans through animal intake, posing a serious threat to human health.

In order to avoid ZEN entering the food chain by means of feed, food ingredients, etc., ZEN can be reduced or removed by some means in addition to increasing the supervision and detection efforts on feed, food ingredients, etc. The method for degrading ZEN and the derivative thereof mainly comprises a chemical method, a physical method and a biological method. The chemical method is mainly characterized in that chemical reagents such as strong acid and strong alkali, such as ozone, hydrogen peroxide, sodium carbonate and the like, and ZEN are subjected to chemical reaction to be converted into other low-toxicity or even non-toxic substances. The physical methods include high temperature method, radiation method, high pressure method and adsorption method. However, these techniques are only partially effective, do not completely remove ZEN, and have hindered industrial application due to their high cost and low efficiency. Chemical and physical treatments can also destroy the nutritional components of grains and feeds and can introduce secondary pollution. Compared with the prior art, the biological method has the advantages of environmental protection, high efficiency, low cost and the like, and more importantly, the biological method can not cause secondary pollution to food or feed raw materials. This method therefore shows great promise in the food and feed industry.

The biological method mainly comprises microbial adsorption and enzyme degradation. For a microbial adsorption method, researches find that the main components of cell walls of fungi such as yeasts and lactic acid bacteria are peptidoglycan, the peptidoglycan are connected through glycosidic bonds to form a net structure on the surface of the cell walls, and the peptidoglycan has a remarkable adsorption effect on mycotoxins such as ZEN. The biological enzyme degradation method is mainly characterized in that enzymes (lactone hydrolase, protease, peroxidase and the like) generated by metabolism of microorganisms can destroy the structure of ZEN by means of hydrolysis or oxidation and the like so as to convert the ZEN into low-toxicity or non-toxicity substances. For example, ZN can be detoxified by screening Acinetobacter sp. SM04 by YU et al, and then peroxidase of the bacterium is identified to have a function of detoxifying ZEN. TAKAHASHI-ANDO et al, for the first time reported a ZEN lactone hydrolase ZHD101 derived from Clinostacchys rosea IFO 7063, which has the ability to degrade ZEN.

The enzymatic degradation method has the advantages of mild treatment conditions, high product quality, strong specificity and the like, so that the enzymatic degradation of zearalenone is a hot spot of the current research.

Disclosure of Invention

The invention aims to provide a zearalenone toxin degrading enzyme mutant and a production strain thereof. The specific enzyme activity of the mutant is obviously improved, the production cost of the mutant is favorably reduced, and the popularization and the application of the mutant in the field of feed are promoted.

The invention provides a zearalenone toxin degrading enzyme, and the amino acid sequence of the degrading enzyme is SEQ ID NO. 1.

One coding nucleotide sequence of the zearalenone toxin degrading enzyme is SEQ ID NO. 2.

The invention provides a zearalenone toxin degrading enzyme mutant, which is characterized in that the 85 th amino acid of the zearalenone toxin degrading enzyme with the amino acid sequence of SEQ ID NO. 1 is changed from Ala into Val.

The amino acid sequence of the mutant is SEQ ID NO. 3, and one coding nucleotide sequence of the mutant is SEQ ID NO. 4.

The invention also provides a zearalenone toxin degrading enzyme mutant, which is characterized in that the 186 th amino acid of the zearalenone toxin degrading enzyme mutant with the amino acid sequence of SEQ ID NO. 3 is changed from Asp to Lys.

The amino acid sequence of the mutant is SEQ ID NO. 5, and one coding nucleotide sequence of the mutant is SEQ ID NO. 6.

The invention also provides a polypeptide carrying the coding sequence of SEQ ID NO:4 or SEQ ID NO:6, and a recombinant expression vector of the zearalenone toxin degrading enzyme mutant gene.

The invention also provides a pichia pastorisPichia pastoris) Comprising the above recombinant expression vector.

The plasmid is transferred into pichia pastoris, and the specific enzyme activity level of the zearalenone toxin degrading enzyme mutant subjected to recombinant expression is remarkably improved.

The pichia pastoris also comprises an acetyl coenzyme A synthetase C2 gene.

The coding nucleotide sequence of the acetyl coenzyme A synthetase C2 gene is SEQ ID NO: 7.

the acetyl coenzyme A synthetase C2 gene is transferred into pichia pastoris, and the enzyme activity level of the zearalenone toxin degrading enzyme mutant of the recombinant expression is obviously improved.

The pichia is named as pichia H1-T2-17 (Pichia pastoris H1-T2-17), which has been deposited in the china type culture collection of the university of wuhan, china at 12/2/2020 with the deposition number CCTCC NO: m2020818.

Compared with wild type, the zearalenone toxin degrading enzyme mutants H1-T1 and H1-T2 provided by the invention are recombined and expressed in pichia pastoris, the specific enzyme activity is respectively improved by 75.1% and 172.2%, and unexpected technical effects are achieved.

In addition, the enzyme activity of the zearalenone toxin degrading enzyme mutant expressed by the acetyl coenzyme A synthetase C2 gene can be obviously improved by intracellular co-expression in pichia pastoris engineering bacteria. The modified Pichia pastoris H1-T2-17 has the highest enzyme activity reaching 1610U/ml, which is 41.9 percent higher than that before modification. The pichia pastoris strain can be widely applied to the production of zearalenone toxin degrading enzyme, and is beneficial to reducing the production cost of the enzyme, so that the wide application of the pichia pastoris strain in the field of feeds is promoted.

Detailed Description

The present invention uses conventional techniques and methods used IN the fields of genetic engineering and MOLECULAR BIOLOGY, such as the methods described IN MOLECULAR CLONING, A LABORATORY MANUAL, 3nd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can adopt other conventional methods, experimental schemes and reagents in the field on the basis of the technical scheme described in the invention, and the invention is not limited to the specific embodiment of the invention.

Strain and carrier: coli DH5 alpha deposited by the same company, Pichia pastoris GS115, vector pPIC9k, pPICZA, Amp, G418, Zeocin were purchased from Invitrogen.

Enzyme and kit: DNA polymerase was purchased from Takara, T4 ligase and restriction enzyme were purchased from Fermentas, plasmid extraction kit and gel purification recovery kit were purchased from Omega, GeneMorph II random mutagenesis kit was purchased from Beijing Bomais Biotech, Inc., and zearalenone toxin-degrading enzyme detection kit RIDASCREEN Aflatoxin B130/15R 1211 was purchased from R-Biopharm.

The formula of the culture medium is as follows:

coli medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, ph 7.0;

LB + Amp medium: adding 100 mu g/mL ampicillin into LB culture medium;

yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;

YPD + Zeocin medium: adding 100 mu g/ml Zeocin into YPD culture medium;

yeast screening medium (MD medium): 1.34% YNB, 4X 10^-5Biotin, 1% glycerol, 2% agarose;

BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH6.0), 1.34% YNB, 4X 10^-5Biotin, 1% glycerol;

BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH6.0), 1.34% YNB, 4X 10^-5Biotin, 0.5% methanol.

The invention will be further illustrated with reference to specific examples.

Example 1 Synthesis of zearalenone toxin-degrading enzyme H1 Gene

The applicant named the zearalenone toxin-degrading enzyme gene derived from Rhodococcus erythropolis (Rhodococcus erythropolis) H1 whose nucleotide sequence is SEQ ID NO:2 and encoding amino acid sequence is SEQ ID NO: 1. The entire gene synthesis was carried out by Huada Gene Co.

Example 2 screening of zearalenone degrading enzyme H1 mutant

In order to further improve the specific enzyme activity of zearalenone degrading enzyme H1, a large number of mutations are screened for the gene of the enzyme by an directed evolution technology; performing PCR amplification by using a primer 1(F) and a primer 1(R) and a GeneMorph II random mutation PCR kit (Stratagene) by using a zearalenone toxin degrading enzyme H1 as a template;

primer 1 (F): GCGCGAATTCATGACTGAAGAAGGTACTAGATCTG；

Primer 1 (R): TAAAGCGGCCGCTTAATCGTTAACTGGCAAAGTAGCA。

The PCR product is recovered by glue and,EcoRI、Noti, after enzyme digestion treatment, connecting the vector with pET21a vector subjected to the same enzyme digestion, transforming the vector into escherichia coli BL21(DE3), coating the escherichia coli BL21 on an LB + Amp flat plate, and performing inverted culture at 37 ℃; after the transformants appear, the transformants are picked to a 96-well plate one by using toothpicks, 150 ul LB + Amp culture medium containing 0.1mM IPTG is added into each well, the culture is carried out for about 6 h at 37 ℃ and 220rpm, the supernatant is discarded by centrifugation, the thalli are resuspended by using buffer solution, and the walls are broken by repeated freezing and thawing, so that the escherichia coli cell lysate containing zearalenone toxin degrading enzyme is obtained. And then centrifuging to remove thalli, respectively measuring the activity and the protein content of the zearalenone toxin degrading enzyme of the supernatant, and calculating the specific enzyme activity.

The experimental result shows that some mutations have no influence on the specific enzyme activity of zearalenone toxin degrading enzyme H1, and some mutations even make the specific enzyme activity lower. Finally, the applicant obtained a combination of mutation sites with a significant improvement in specific enzymatic activity: A85V single point mutation, A85V/D186K two point mutation.

The zearalenone toxin degrading enzyme mutant containing A85V single-point mutation is named as H1-T1, and the amino acid sequence of the mutant is SEQ ID NO:3, the nucleic acid sequence of one coding gene is SEQ ID NO: 4.

the zearalenone toxin degrading enzyme mutant containing two point mutations of A85V and D186K is named as H1-T2, and the amino acid sequence of the mutant is SEQ ID NO:5, the nucleic acid sequence of one coding gene is SEQ ID NO: 6.

the above nucleotide sequences were synthesized by Huada Gene Co.

H1-T1 and H1-T2 were PCR amplified with primer 1(F) and primer 1(R) under the following conditions: denaturation at 94 deg.C for 5 min; then denaturation at 94 ℃ for 30s, renaturation at 56 ℃ for 30s, extension at 72 ℃ for 1min, and after 35 cycles, heat preservation at 72 ℃ for 10 min. The length of the H1-T1 and H1-T2 genes is the same as that of the H1 gene, and the total length is 809 bp.

Example 3 construction of Pichia pastoris engineering bacteria expressing recombinant zearalenone toxin degrading enzyme

1. Construction of recombinant plasmid

Respectively using restriction endonuclease to obtain zearalenone toxin degrading enzyme gene H1 and mutant genes H1-T1 and H1-T2EcoR I andNoti, carrying out double digestion, wherein 100 mu l of digestion system is as follows: PCR products of zearalenone toxin-degrading enzyme gene H1 (H1-T1, H1-T2) 40. mu.l, 10 XH buffer 10. mu.l, 10 XBA 10. mu.l,EcoR I 5 μl、Not I 5 μl、ddH₂O30. mu.l. After digestion at 37 ℃ for 4 h, the product was recovered by agarose gel electrophoresis.

The expression vector pPIC9K was first treated with restriction enzymeEcoR I A single cleavage was carried out, and 100. mu.l of the cleavage system was as follows: 20. mu.l of expression vector pPIC9K 20, 10 XH buffer 10. mu.l,EcoR I 5 μl、ddH₂O65. mu.l. After digestion at 37 ℃ for 4 h, the product was recovered by agarose gel electrophoresis. Reuse of the recovered fragments with restriction enzymesNotI, performing single enzyme digestion, wherein 100 mu l of enzyme digestion system is as follows: pPIC9K recovered fragment 20. mu.l, 10 XH buffer 10. mu.l, 10 XBSA 10. mu.l, 10 XTUTON 10. mu.l,Not I 5 μl、ddH₂O45. mu.l. After digestion at 37 ℃ for 4 h, the product was recovered by agarose gel electrophoresis.

Will be passedEcoR I andNotthe double-restriction enzyme-digested H1 fragment, H1-T1 fragment and H1-T2 fragment are respectively connected with an expression vector pPIC9K which is subjected to the same restriction enzyme digestion to construct recombinant expression plasmids pPIC9K-H1, pPIC9K-H1-T1 and pPIC 9K-H1-T2. The linking system is as follows: expression vector pPIC9K double enzyme digestion product 5 ul, H1 (H1-T1, H1-T2) gene double enzyme digestion product 3 ul, 10 XT₄ ligase buffer 1 μl、T₄1 μ l of ligase. The ligation was carried out overnight at 22 ℃ and transformed into E.coli DH 5. alpha. and transformants were picked for sequencing verification. And (3) transferring the correct transformant into an LB + Amp liquid culture medium through sequencing verification, carrying out overnight culture at 37 ℃, and upgrading the plasmid to obtain the recombinant yeast expression plasmid pPIC9K-H1 (pPIC 9K-H1-T1, pPIC 9K-H1-T2).

Transformation and screening

Recombinant yeast expression plasmids pPIC9K-H1 and pPIC9K-H1-T1, pPIC9K-H1-T2 respectivelySalI, linearization, purifying a linearization product by using a column purification kit, converting pichia pastoris GS115 by an electroporation method, and coating an MD plate. The colony grown on the MD plate is the pichia pastoris engineering strain, and then YPD plates containing different concentrations of geneticin G418 are coated to screen multi-copy transformants.

Shake flask fermentation verification

Selecting single multi-copy transformants, respectively inoculating into BMGY culture medium, performing shake culture at 30 ℃ and 220rpm for 24 hours, then transferring into BMMY culture medium, performing shake culture at 30 ℃ and 220rpm, and adding 0.5% methanol every 24 hours. After the induction expression is carried out for 4d, the thalli are removed by centrifugation, the activity of the zearalenone toxin degrading enzyme and the protein content of the supernatant are respectively measured, and the specific enzyme activity is calculated.

The result shows that the maximum fermentation enzyme activity of a transformant for recombinantly expressing the wild zearalenone toxin degrading enzyme gene H1 reaches 525U/ml, the protein content is 0.68g/l, and the specific enzyme activity is 772.1U/mg under the condition of a shake flask. The transformant is named as Pichia pastoris H1-45 (Pichia pastoris H1-45）；

The transformant of the recombinant expression zearalenone toxin degrading enzyme mutant gene H1-T1 has the highest fermentation enzyme activity of 865U/ml, the protein content of 0.64g/l and the specific enzyme activity of 1351.6U/mg. The transformant is named as pichia pastoris H1-T1-18 (Pichia pastoris H1-T1-18）；

The transformant of the recombinant expression zearalenone toxin degrading enzyme mutant gene H1-T2 has the highest fermentation enzyme activity of 1135U/ml, the protein content of 0.54g/l and the specific enzyme activity of 2101.9U/mg. The transformant is named as pichia pastoris H1-T2-66 (Pichia pastoris H1-T2-66）。

From the results, compared with the wild type, the mutant genes H1-T1 and H1-T2 provided by the invention are recombined and expressed in pichia pastoris, the specific enzyme activity is respectively improved by 75.1% and 172.2%, and unexpected technical effects are achieved.

Biopsy detection method for zearalenone toxin degrading enzyme

1. Definition of enzyme Activity Unit

The amount of enzyme required to degrade 1pmol ZEN per minute at pH7.0 at 37 ℃ was one enzyme activity unit.

2. Sample processing method

Liquid sample: the supernatant was centrifuged and used directly for the subsequent assay.

3. Experimental procedure for enzyme reactions

TABLE 1 enzymatic reaction procedure

Injection: during the operation of the enzyme reaction test, 45ml of buffer solution (0.02M citric acid-0.04M disodium hydrogen phosphate, pH = 7.0) can be precisely taken and mixed with 2.5ml of ZEN standard stock solution (namely 18: 1), and then 1.9ml of buffer solution can be precisely measured to reduce the test deviation

4. Enzyme activity calculation method

In the formula:

u is enzyme activity, U/ml;

f is the dilution multiple;

C_control: control ZEN concentration, ppb;

C_{test of}: test group ZEN concentration, ppb;

a: sample volume, ml.

Detection of protein content by Coomassie brilliant blue method

1. Reagent

(1) Coomassie brilliant blue G-250 staining solution: dissolving Coomassie brilliant blue G-250100 mg in 50ml 95% ethanol, adding 100ml 85% phosphoric acid, diluting with water to 1L, and using at normal temperature for 1 month;

(2) standard protein solution: measuring the protein content by using bovine serum albumin through a trace Kjeldahl method in advance, and preparing a 1 mg/ml protein standard solution according to the purity of the protein;

(3) preparing a standard stock solution: accurately weighing 0.05g of crystallized bovine serum albumin on an analytical balance, adding a small amount of distilled water into a small beaker, dissolving, transferring into a 50ml volumetric flask, washing residual liquid in the beaker with a small amount of distilled water for several times, pouring the washing liquid into the volumetric flask together, and finally fixing the volume to the scale with the distilled water. A standard stock solution was prepared in which the concentration of bovine serum albumin was 1000. mu.g/ml.

2. And (5) drawing a standard curve.

(1) The 6 test tubes are respectively numbered, the reagents are added according to the following table, and the mixture is uniformly mixed.

Pipe number	1	2	3	4	5	6
							Sample (ml)	0	0.1	0.2	0.3	0.4	0.5
Water (ml)	2.0	1.9	1.8	1.7	1.6	1.5
							Protein content (mg/ml)	0	0.05	0.1	0.15	0.2	0.25

Accurately sucking 2.5ml of Coomassie brilliant blue solution into 6 dry test tubes, accurately sucking 0.1ml of the solution in each tube, correspondingly placing the solution in each numbered test tube, uniformly mixing by vortex, standing at room temperature for 5min, zeroing with test tube No. 1, measuring at 595nm for color comparison, and recording the light absorption value.

(2) Drawing a standard curve: the absorbance values read by the 1-6 tubes were recorded, and a standard curve was drawn with the protein content (μ g) as the abscissa and the absorbance as the ordinate. Note that the cuvette had to be cleaned due to the strong staining ability of coomassie brilliant blue. Cannot be measured with a quartz cup.

3. Determination of samples

Preparation of samples:

(1) liquid sample: diluting a sample to be detected to the protein content of 0.1-0.3mg/ml, and controlling the light absorption value (after blank is subtracted) after blank is removed to be 0.2-0.4;

(2) solid sample: accurately weighing 1.0000g of sample into a 100ml triangular flask, adding 20ml of deionized water by using a pipette, magnetically stirring for 10min, centrifuging at 4000rpm for 10min, taking supernatant, further diluting and determining the protein content, wherein the dilution method refers to liquid samples.

Sample detection:

adding a clean test tube into a Coomassie brilliant blue solution containing 2.5ml, adding a sample to be tested, vortexing, shaking uniformly, standing at room temperature for 5min, taking a blank of a standard curve as a control, measuring absorbance at 595nm by using a micro cuvette with an optical path of 1cm, and obtaining the protein content according to the standard curve.

4. Protein content calculation

Protein content = X dilution fold × standard conversion factor.

X: protein content (mg/ml) determined from standard koji

Reduced value of standard sample: the standard sample was 47mg/ml, and a coefficient was converted from the measured value.

(III) calculation of specific enzyme Activity

"Specific Activity" means: the number of units of enzyme activity per weight of protein is generally expressed as U/mg protein. In general, the higher the specific enzyme activity, the purer the enzyme.

Specific activity calculation formula: specific enzyme activity (U/mg) = enzyme activity (U/mL)/protein content (mg/mL).

Example 4 modification of regulatory Gene of Pichia pastoris H1-T2-66

1. Cloning of acetyl-CoA synthetase C2

Taking genome of Pichia pastoris GS115 as a template, cloning acetyl coenzyme A synthetase C2 gene by PCR reaction, wherein primers and reaction conditions are as follows:

primer 1 (F): GCGCGAATTCATGACTTTTCCAGAGCCAAGAGAACACAAA；

Primer 1 (R): TAAAGCGGCCGCCTACTTCTTGAAGAACTGGTTATCAACAG。

The PCR conditions were: denaturation at 94 deg.C for 5 min; then denaturation at 94 ℃ for 30s, renaturation at 56 ℃ for 30s, extension at 72 ℃ for 2min for 30s, and after 35 cycles, heat preservation at 72 ℃ for 10 min. The total length of the acetyl coenzyme A synthetase C2 gene is 2019bp, and the nucleotide sequence is SEQ ID NO: 7.

construction of expression plasmid for acetyl-CoA synthetase C2 Gene

Restriction enzyme for the cloned acetyl-CoA synthetase C2 GeneEcoR I andNoti, carrying out double digestion, wherein 50 ul of digestion system is as follows: 43. mu.l of acetyl-CoA synthetase C2 gene, 5. mu.l of 10 XFastdigest Buffer,EcoR I 1 μl、NotI1. mu.l. After digestion at 37 ℃ for 2h, the product was recovered by agarose gel electrophoresis.

Will express the carrierRestriction enzyme for pPICZAEcoR I andNoti, carrying out double digestion, wherein 50 ul of digestion system is as follows: the vector pPICZA 43. mu.l, 10 XFastdigest Buffer 5. mu.l,EcoR I 1 μl、NotI1. mu.l. After digestion at 37 ℃ for 2h, the product was recovered by agarose gel electrophoresis.

Will be passedEcoR I andNotthe I double-restriction enzyme acetyl coenzyme A synthetase C2 gene segment is connected with an expression vector pPICZA after the same restriction enzyme, and a recombinant expression plasmid pPICZA-C2 is constructed. The linking system is as follows: 5 mul of expression vector pPICZA double restriction enzyme products, 3 mul of acetyl coenzyme A synthetase C2 gene double restriction enzyme products and 10 XT₄ ligase buffer 1 μl、T₄1 μ l of ligase. The ligation was carried out overnight at 22 ℃ and transformed into E.coli DH 5. alpha. and transformants were picked for sequencing verification. And (3) transferring the transformant which is verified to be correct by sequencing into an LC + Zeocin liquid medium, carrying out overnight culture at 37 ℃, and upgrading the plasmid to obtain the yeast intracellular expression plasmid pPICZA-C2.

The regulatory gene C2 is transferred into pichia pastoris H1-T2-66

The recombinant plasmid pPICZA-C2 was treated with restriction enzymesSacI, linearization, purifying a linearization product by using a column purification kit, transforming a pichia pastoris engineering bacterium H1-T2-66 by an electroporation method, and coating a YPD + Zeocin plate. The colony grown on the YPD + Zeocin plate is the Pichia pastoris engineering strain transformed into C2.

Strain shake flask fermentation screening verification

A plurality of positive transformants are picked and respectively inoculated into a BMGY culture medium, are subjected to shaking culture at 30 ℃ and 220rpm for 24 hours, are then transferred into a BMMY culture medium, are subjected to shaking culture at 30 ℃ and 220rpm, and are added with 0.5 percent of methanol every 24 hours by taking H1-T2-66 strain as a control. After the induction expression is carried out for 4d, the thalli are removed by centrifugation, and the activity of the zearalenone toxin degrading enzyme is measured on the supernatant.

The result shows that the fermentation enzyme activity of the Pichia pastoris H1-T2-66 before modification is 1135U/ml under the condition of shaking the flask; the highest fermentation enzyme activity in the transformant transformed into the C2 gene reaches 1610U/ml, and the transformant is named as pichia pastoris H1-T2-17 (Pichia pastoris H1-T2-17). Thus, the intracellular co-expression of the C2 gene in the pichia pastoris engineering bacteria can obviously improveThe expression of the enzyme activity of the zearalenone toxin degrading enzyme mutant H1-T2 improves the ratio by 41.9 percent, and obtains unexpected technical effect.

The applicant has already applied Pichia pastoris H1-T2-17 (at 12/2/2020)Pichia pastoris H1-T2-17) is preserved in China center for type culture Collection of Wuhan university in Wuhan, China, with the preservation number of CCTCC NO: m2020818.

Sequence listing

<110> Weifang kang Den Biotech Co., Ltd

QINGDAO VLAND BIOTECH GROUP Co.,Ltd.

<120> zearalenone toxin degrading enzyme mutant and production strain thereof

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 328

<212> PRT

<213> Rhodococcus erythropolis (Rhodococcus erythropolis)

<400> 1

Met Thr Glu Glu Gly Thr Arg Ser Glu Ala Ala Asn Ala Ala Thr His

1 5 10 15

Ala Arg Gln Leu Pro Asp Ser Arg Asn Ile Phe Val Ser His Arg Phe

20 25 30

Pro Glu Ser Gln Val Asp Leu Gly Glu Val Val Met Asn Phe Ala Glu

35 40 45

Ala Gly Ser Ala Asp Asn Pro Ala Leu Leu Leu Leu Pro Glu Gln Thr

50 55 60

Gly Ser Trp Trp Ser Tyr Glu Pro Val Met Gly Leu Leu Ala Glu Asn

65 70 75 80

Phe His Val Phe Ala Val Asp Ile Arg Gly Gln Gly Arg Ser Thr Trp

85 90 95

Thr Pro Arg Arg Tyr Ser Leu Asp Asn Phe Gly Asn Asp Leu Val Arg

100 105 110

Phe Ile Ala Leu Val Ile Lys Arg Pro Val Val Val Ala Gly Asn Ser

115 120 125

Ser Gly Gly Leu Leu Ala Ala Trp Leu Ser Ala Tyr Ala Met Pro Gly

130 135 140

Gln Ile Arg Ala Ala Leu Cys Glu Asp Ala Pro Phe Phe Ala Ser Glu

145 150 155 160

Leu Val Pro Ala Tyr Gly His Ser Val Leu Gln Ala Ala Gly Pro Ala

165 170 175

Phe Glu Leu Tyr Arg Asp Phe Leu Gly Asp Gln Trp Ser Ile Gly Asp

180 185 190

Trp Lys Gly Phe Val Glu Ala Ala Lys Ala Ser Pro Ala Lys Ala Met

195 200 205

Gln Leu Phe Pro Thr Pro Asp Glu Ala Pro Gln Asn Leu Lys Glu Tyr

210 215 220

Asp Pro Glu Trp Gly Arg Ala Phe Phe Glu Gly Thr Val Ala Leu His

225 230 235 240

Cys Pro His Asp Arg Met Leu Ser Gln Val Lys Thr Pro Ile Leu Ile

245 250 255

Thr His His Ala Arg Thr Ile Asp Pro Glu Thr Gly Glu Leu Leu Gly

260 265 270

Ala Leu Ser Asp Leu Gln Ala Glu His Ala Gln Asp Ile Ile Arg Ser

275 280 285

Ala Gly Val Arg Val Asp Tyr Gln Ser His Pro Asp Ala Leu His Met

290 295 300

Met His Leu Phe Asp Pro Ala Arg Tyr Ala Glu Ile Leu Thr Ser Trp

305 310 315 320

Ser Ala Thr Leu Pro Val Asn Asp

325

<210> 2

<211> 987

<212> DNA

<213> Rhodococcus erythropolis (Rhodococcus erythropolis)

<400> 2

atgactgaag aaggtactag atctgaagct gctaatgctg ctactcatgc tagacaattg 60

ccagattctc gtaacatctt cgtgtctcat agattcccag agtctcaagt tgatttgggt 120

gaagtcgtca tgaactttgc tgaagctggt tctgctgata acccagcttt gttgttgttg 180

ccagaacaaa ctggttcttg gtggtcttac gaaccagtta tgggtttgtt ggctgagaac 240

tttcatgttt tcgccgtcga tattcgtggt caaggtagat ctacttggac tccaagaaga 300

tactccttgg acaactttgg taacgacttg gttcgtttta tcgctttggt tatcaagcgt 360

ccagttgttg ttgctggtaa ctcttctggt ggtttgttgg ctgcttggtt gtctgcttac 420

gctatgccag gtcaaattag agctgctttg tgtgaagatg ctccattctt tgcttctgaa 480

ttggttccag cttacggtca ttctgttttg caagctgctg gtccagcttt tgaattgtac 540

agagacttct tgggtgatca atggtctatt ggtgattgga agggttttgt tgaagctgct 600

aaggcttctc cagctaaggc tatgcaattg tttccaactc cagatgaagc tccacaaaac 660

ttgaaggaat acgatccaga atggggtaga gctttttttg aaggtaccgt cgctttgcat 720

tgtccacatg atagaatgtt gtcccaggtt aagactccaa tcttgatcac tcatcacgct 780

cgtactattg atccagaaac cggtgaattg ttgggtgctt tgtctgattt gcaagctgaa 840

catgctcagg atatcattag atctgccggt gttagagttg attaccagtc tcatccagat 900

gctttgcata tgatgcattt gtttgaccca gctagatacg ctgaaatttt gacttcttgg 960

tctgctactt tgccagttaa cgattaa 987

<210> 3

<211> 328

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Thr Glu Glu Gly Thr Arg Ser Glu Ala Ala Asn Ala Ala Thr His

1 5 10 15

Ala Arg Gln Leu Pro Asp Ser Arg Asn Ile Phe Val Ser His Arg Phe

20 25 30

Pro Glu Ser Gln Val Asp Leu Gly Glu Val Val Met Asn Phe Ala Glu

35 40 45

Ala Gly Ser Ala Asp Asn Pro Ala Leu Leu Leu Leu Pro Glu Gln Thr

50 55 60

Gly Ser Trp Trp Ser Tyr Glu Pro Val Met Gly Leu Leu Ala Glu Asn

65 70 75 80

Phe His Val Phe Val Val Asp Ile Arg Gly Gln Gly Arg Ser Thr Trp

85 90 95

Thr Pro Arg Arg Tyr Ser Leu Asp Asn Phe Gly Asn Asp Leu Val Arg

100 105 110

Phe Ile Ala Leu Val Ile Lys Arg Pro Val Val Val Ala Gly Asn Ser

115 120 125

Ser Gly Gly Leu Leu Ala Ala Trp Leu Ser Ala Tyr Ala Met Pro Gly

130 135 140

Gln Ile Arg Ala Ala Leu Cys Glu Asp Ala Pro Phe Phe Ala Ser Glu

145 150 155 160

Leu Val Pro Ala Tyr Gly His Ser Val Leu Gln Ala Ala Gly Pro Ala

165 170 175

Phe Glu Leu Tyr Arg Asp Phe Leu Gly Asp Gln Trp Ser Ile Gly Asp

180 185 190

Trp Lys Gly Phe Val Glu Ala Ala Lys Ala Ser Pro Ala Lys Ala Met

195 200 205

Gln Leu Phe Pro Thr Pro Asp Glu Ala Pro Gln Asn Leu Lys Glu Tyr

210 215 220

Asp Pro Glu Trp Gly Arg Ala Phe Phe Glu Gly Thr Val Ala Leu His

225 230 235 240

Cys Pro His Asp Arg Met Leu Ser Gln Val Lys Thr Pro Ile Leu Ile

245 250 255

Thr His His Ala Arg Thr Ile Asp Pro Glu Thr Gly Glu Leu Leu Gly

260 265 270

Ala Leu Ser Asp Leu Gln Ala Glu His Ala Gln Asp Ile Ile Arg Ser

275 280 285

Ala Gly Val Arg Val Asp Tyr Gln Ser His Pro Asp Ala Leu His Met

290 295 300

Met His Leu Phe Asp Pro Ala Arg Tyr Ala Glu Ile Leu Thr Ser Trp

305 310 315 320

Ser Ala Thr Leu Pro Val Asn Asp

325

<210> 4

<211> 987

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgactgaag aaggtactag atctgaagct gctaatgctg ctactcatgc tagacaattg 60

ccagattctc gtaacatctt cgtgtctcat agattcccag agtctcaagt tgatttgggt 120

gaagtcgtca tgaactttgc tgaagctggt tctgctgata acccagcttt gttgttgttg 180

ccagaacaaa ctggttcttg gtggtcttac gaaccagtta tgggtttgtt ggctgagaac 240

tttcatgttt tcgttgtcga tattcgtggt caaggtagat ctacttggac tccaagaaga 300

tactccttgg acaactttgg taacgacttg gttcgtttta tcgctttggt tatcaagcgt 360

ccagttgttg ttgctggtaa ctcttctggt ggtttgttgg ctgcttggtt gtctgcttac 420

gctatgccag gtcaaattag agctgctttg tgtgaagatg ctccattctt tgcttctgaa 480

ttggttccag cttacggtca ttctgttttg caagctgctg gtccagcttt tgaattgtac 540

agagacttct tgggtgatca atggtctatt ggtgattgga agggttttgt tgaagctgct 600

aaggcttctc cagctaaggc tatgcaattg tttccaactc cagatgaagc tccacaaaac 660

ttgaaggaat acgatccaga atggggtaga gctttttttg aaggtaccgt cgctttgcat 720

tgtccacatg atagaatgtt gtcccaggtt aagactccaa tcttgatcac tcatcacgct 780

cgtactattg atccagaaac cggtgaattg ttgggtgctt tgtctgattt gcaagctgaa 840

catgctcagg atatcattag atctgccggt gttagagttg attaccagtc tcatccagat 900

gctttgcata tgatgcattt gtttgaccca gctagatacg ctgaaatttt gacttcttgg 960

tctgctactt tgccagttaa cgattaa 987

<210> 5

<211> 328

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Met Thr Glu Glu Gly Thr Arg Ser Glu Ala Ala Asn Ala Ala Thr His

1 5 10 15

Ala Arg Gln Leu Pro Asp Ser Arg Asn Ile Phe Val Ser His Arg Phe

20 25 30

Pro Glu Ser Gln Val Asp Leu Gly Glu Val Val Met Asn Phe Ala Glu

35 40 45

Ala Gly Ser Ala Asp Asn Pro Ala Leu Leu Leu Leu Pro Glu Gln Thr

50 55 60

Gly Ser Trp Trp Ser Tyr Glu Pro Val Met Gly Leu Leu Ala Glu Asn

65 70 75 80

Phe His Val Phe Val Val Asp Ile Arg Gly Gln Gly Arg Ser Thr Trp

85 90 95

Thr Pro Arg Arg Tyr Ser Leu Asp Asn Phe Gly Asn Asp Leu Val Arg

100 105 110

Phe Ile Ala Leu Val Ile Lys Arg Pro Val Val Val Ala Gly Asn Ser

115 120 125

Ser Gly Gly Leu Leu Ala Ala Trp Leu Ser Ala Tyr Ala Met Pro Gly

130 135 140

Gln Ile Arg Ala Ala Leu Cys Glu Asp Ala Pro Phe Phe Ala Ser Glu

145 150 155 160

Leu Val Pro Ala Tyr Gly His Ser Val Leu Gln Ala Ala Gly Pro Ala

165 170 175

Phe Glu Leu Tyr Arg Asp Phe Leu Gly Lys Gln Trp Ser Ile Gly Asp

180 185 190

Trp Lys Gly Phe Val Glu Ala Ala Lys Ala Ser Pro Ala Lys Ala Met

195 200 205

Gln Leu Phe Pro Thr Pro Asp Glu Ala Pro Gln Asn Leu Lys Glu Tyr

210 215 220

Asp Pro Glu Trp Gly Arg Ala Phe Phe Glu Gly Thr Val Ala Leu His

225 230 235 240

Cys Pro His Asp Arg Met Leu Ser Gln Val Lys Thr Pro Ile Leu Ile

245 250 255

Thr His His Ala Arg Thr Ile Asp Pro Glu Thr Gly Glu Leu Leu Gly

260 265 270

Ala Leu Ser Asp Leu Gln Ala Glu His Ala Gln Asp Ile Ile Arg Ser

275 280 285

Ala Gly Val Arg Val Asp Tyr Gln Ser His Pro Asp Ala Leu His Met

290 295 300

Met His Leu Phe Asp Pro Ala Arg Tyr Ala Glu Ile Leu Thr Ser Trp

305 310 315 320

Ser Ala Thr Leu Pro Val Asn Asp

325

<210> 6

<211> 987

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgactgaag aaggtactag atctgaagct gctaatgctg ctactcatgc tagacaattg 60

ccagattctc gtaacatctt cgtgtctcat agattcccag agtctcaagt tgatttgggt 120

gaagtcgtca tgaactttgc tgaagctggt tctgctgata acccagcttt gttgttgttg 180

ccagaacaaa ctggttcttg gtggtcttac gaaccagtta tgggtttgtt ggctgagaac 240

tttcatgttt tcgttgtcga tattcgtggt caaggtagat ctacttggac tccaagaaga 300

tactccttgg acaactttgg taacgacttg gttcgtttta tcgctttggt tatcaagcgt 360

ccagttgttg ttgctggtaa ctcttctggt ggtttgttgg ctgcttggtt gtctgcttac 420

gctatgccag gtcaaattag agctgctttg tgtgaagatg ctccattctt tgcttctgaa 480

ttggttccag cttacggtca ttctgttttg caagctgctg gtccagcttt tgaattgtac 540

agagacttct tgggtaaaca atggtctatt ggtgattgga agggttttgt tgaagctgct 600

aaggcttctc cagctaaggc tatgcaattg tttccaactc cagatgaagc tccacaaaac 660

ttgaaggaat acgatccaga atggggtaga gctttttttg aaggtaccgt cgctttgcat 720

tgtccacatg atagaatgtt gtcccaggtt aagactccaa tcttgatcac tcatcacgct 780

cgtactattg atccagaaac cggtgaattg ttgggtgctt tgtctgattt gcaagctgaa 840

catgctcagg atatcattag atctgccggt gttagagttg attaccagtc tcatccagat 900

gctttgcata tgatgcattt gtttgaccca gctagatacg ctgaaatttt gacttcttgg 960

tctgctactt tgccagttaa cgattaa 987

<210> 7

<211> 2019

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atgacttttc cagagccaag agaacacaaa gtggtgcacg aagccaacgg cgtaagggct 60

atcaaaaccc ctcaatcatt ttatgacaag caacctgtta agtcattgga ggcattggaa 120

cattatcaag agctgtacca gaagtccatc gaggacccag aggaattctt cggccaaatg 180

gcaaagcagt ttctagattg ggacaaagac tttggtaagg tctcctctgg atctttgaaa 240

gaaggtgatg ctgcgtggtt ccttggtgga gagctgaatg cttcgtacaa ctgtgttgac 300

cgacatgctt tttcgcaccc tgatcgtccc gccgtaattt tcgaagcgga cgaggaatct 360

gaatctcgaa caataactta tgcagaactt ctacgtgagg tctctcgtgt tgcaggagta 420

ctgcagagct ggggtgtacg caaaggtgac actgtcgcaa tctacttgcc catgactacc 480

gaggccattg tggccatgct ggcagtggca cgtctgggtg cagtgcactc cgttatcttt 540

tctggatttt cgtcaggatc tatccgggac agagttaacg atgctggatc taaggcaatt 600

attacctgtg atgagggacg ccgtgggggt cgtattgtga acaataagaa aattgtcgat 660

gccgctgttg acagctgccc cacagtggaa aaaatcctgg tttataagag gactggtaac 720

ccagaaatca agatggtaga aggaagagac ttctggtggc aggaagaggt tgagaaattc 780

cctggttaca ttgcccctgt ccctgtaaac tcggaggacc cactatttct tttgtatact 840

tcgggatcta ctggttctcc caaaggtgtg gtacactcca caggtggtta tttgctggga 900

gcagcattga caactcgtta tgtgtttgat gtccaggatg aggatattat atttactgct 960

ggtgacgtcg gatggattac tggtcacaca tactcgttgt atggaccact tgttctgggt 1020

gttccaacca ttgtttttga gggaactcct gtctaccctg actacggaag attgtggaag 1080

atttgcgcca aacataaagc cacacacttt tacatcgctc ctactgctct tcgtcttttg 1140

aaaaaggctg gtgaagaaga aattaaaaag tacgacttgt ctagacttcg tactttagga 1200

tctgttggtg aaccaattgc ccccgaattg tgggagtggt acaatgagaa aatcggaaac 1260

ggaaactgtc atattgctga tacttactgg cagactgaat ctggttctca tttgattgct 1320

ccattagcag gtgccgttcc ccaaaagccg ggtgcagcta ctgttccttt ctttggtatt 1380

gatgcttgta tcattgaccc tgtttctggt aaggaacttg aaggcaacga tgtggaaggt 1440

gttttagctg tcaagtccac ttggccatca atggctcgta cagtctggag aaaccacgct 1500

aaatacctcg acacatatat gcgtccttat ccaggctact actttactgg cgatggtgcc 1560

ggtagagatc acgatggtta ttactggatc cgtggtcgtg ttgacgatgt tgtcaatgta 1620

tctggccacc gtttatccac ttctgaaatt gaaagtgctt tactggaaaa tggcaaagtt 1680

gctgaagctg ctgtgattgg tatttccgat gagctaactg gtcaagctgt tattgctttt 1740

gtcgccttga aagatgccac tgactctgag aatttagacg ctctcagacg tgccttagtc 1800

ttgcatgttc gtggagaaat tggtccattt gcagctccta agtccgtgat tgtggttgat 1860

gacttgccta agacccgatc aggtaagatc atgcgtagag ttttaagaaa gatttcttgc 1920

catgaagctg atcaattggg tgatatgtct actttggcca atcctgaatc ggtagactct 1980

ataatcggag ctgttgataa ccagttcttc aagaagtag 2019

Claims

1. A zearalenone toxin degrading enzyme is characterized in that the amino acid sequence of the zearalenone toxin degrading enzyme is SEQ ID NO. 1.

2. A zearalenone toxin degrading enzyme mutant is characterized in that the 85 th amino acid of the zearalenone toxin degrading enzyme with an amino acid sequence of SEQ ID NO. 1 is changed from Ala to Val.

3. The mutant of claim 2, wherein the amino acid sequence of the mutant is SEQ ID No. 3 and the coding nucleotide sequence is SEQ ID No. 4.

4. A zearalenone toxin degrading enzyme mutant is characterized in that the 186 th amino acid of the zearalenone toxin degrading enzyme mutant with the amino acid sequence of SEQ ID NO. 3 is changed from Asp to Lys.

5. The mutant of claim 4, wherein the amino acid sequence of the mutant is SEQ ID NO. 5 and the coding nucleotide sequence is SEQ ID NO. 6.

6. A recombinant expression vector carrying a nucleic acid sequence having the coding sequence of SEQ ID NO:4 or SEQ ID NO:6 of zearalenone toxin-degrading enzyme mutant genes.

7. A kind of Pichia yeast (Pichia pastoris) Wherein the Pichia pastoris comprises the recombinant expression vector of claim 6.

8. The pichia pastoris of claim 7, further comprising an acetyl-coa synthetase C2 gene.

9. The pichia pastoris of claim 8, wherein the coding nucleotide sequence of the acetyl-coa synthetase C2 gene is SEQ ID NO: 7.

10. the pichia pastoris of claim 9, wherein the pichia pastoris has a accession number of CCTCC NO: m2020818.