CN112725294B - Aflatoxin degrading enzyme mutant and high-yield strain thereof - Google Patents

Abstract

The invention relates to the technical field of genetic engineering, and particularly provides an aflatoxin degradation enzyme mutant and a production strain of the aflatoxin degradation enzyme. Compared with the wild type, the specific enzyme activity of the mutant is respectively improved by 97.2 percent and 108.5 percent, and the effect is obvious. The pichia pastoris strain provided by the invention can be widely applied to the production of aflatoxin degradation enzyme, and is beneficial to reducing the production cost of the enzyme, thereby promoting the wide application of the pichia pastoris strain in the field of feeds.

Description

Aflatoxin degrading enzyme mutant and high-yield strain thereof

Technical Field

The invention belongs to the technical field of genetic engineering and microbial modification, and particularly relates to an aflatoxin degradation enzyme mutant and a high-yield strain thereof.

Background

Mycotoxins (mycotoxins) are toxic secondary metabolites produced by mold during growth, and mainly include Aflatoxins (AF), trichothecenes (trichothecenes, such as T-2 toxin, neosolanum solani-cenol NEO and vomitoxin DON), zearalenone (zenaloenone, ZEN), ochratoxin a (OTA), and fumonisins (fumonisins). The raw materials such as grains and the like are polluted by the mould in the field, if the environmental temperature and the humidity are proper in the processes of transportation, processing and storage, the mould can continue to grow, and the toxin content can be increased successively. According to the estimation of the Food and Agriculture Organization (FAO) of the United nations, 25% of grains are polluted by mycotoxin every year all over the world, and 2% of grains cannot be eaten on average; in addition, the diseases and death caused by animal poisoning due to toxin pollution cause huge economic loss to the food industry and the animal husbandry.

Among mycotoxins, aflatoxin is the most toxic one, and has the effects of suppressing immunity, inducing mutation, and carcinogenesis. The aflatoxin is a secondary metabolite mainly produced by a plurality of fungi such as aspergillus flavus, aspergillus parasiticus and the like, contains a plurality of derivatives, and is separated and identified at present ₁ （AFB ₁ ) Aflatoxin B ₂ （AFB ₂ ) Aflatoxin G ₁ (AFG ₁ ) Aflatoxin G ₂ (AFG ₂ ) Aflatoxins M ₁ (AFM ₁ ) Aflatoxin M ₂ (AFM ₂ ) Aflatoxins P ₁ (AFP ₁ ) Aflatoxins Q ₁ (AFQ ₁ ) Aflatoxin H ₁ (AFH ₁ ) Aflatoxins GM (AFGM), aflatoxins B _2a (AFB _2a ) And toxol, and the like.

With the knowledge of the hazard of aflatoxin, people hope to effectively eliminate the adverse effect of aflatoxin. At present, physical methods, chemical methods and biological methods are the main methods for eliminating aflatoxin pollution. The physical method for removing aflatoxin mainly comprises the following steps: adsorption, heating, radiation and extraction. The main principle of removing the toxicity of aflatoxin by a chemical method is to utilize a chemical reagent to destroy the toxic structure of aflatoxin, and the chemical methods reported include alkaline electrolyte, ozone, electrolytic sodium chloride, citric acid and the like. The biological degradation of aflatoxin mainly means that metabolites produced by microorganisms destroy the toxic structure of aflatoxin, and the produced degradation products are low-toxic or non-toxic. And such biodegradation is generally considered to be an enzymatic action. Microorganisms having such an action function are mainly classified into two types: fungi and bacteria.

For example, Doyle et al found that Aspergillus parasiticus (Aspergillus parasiticus) is capable of producing lactoperoxidase to degrade aflatoxins. Shantha et al extracted a thermostable enzyme from Phoma spThe enzyme can degrade 99% of AFB ₁ . Zjatic et al studied the biodegradation of aflatoxins by white rot fungi (Trametes versicolor). Extraction of 80% aflatoxin B in bioactive substance degradable sample from Armillaria tabescens (Armillaria tabescens) ₁ The active substance is then proved to be an intracellular enzyme. 4 strains of strain selected by Teniola et al had degraded AFB ₁ Acting bacteria and it is proved that the cause of aflatoxin degradation is enzymatic action. Sunpenium and the like are screened from peanut soil and peanut meal to Bacillus megaterium (Bacillus megaterium), and fermentation supernatant of the Bacillus megaterium can degrade 78.55% of aflatoxin in a sample.

By combining the methods, the physical method and the chemical method damage the quality and the nutrient content of the product to different degrees, and byproducts and treatment agent residues are easy to generate, thereby causing harm to people and animals. Compared with a physical method and a chemical method, the biological method mainly utilizes the metabolism of microorganisms to produce enzyme to degrade aflatoxin. The enzyme method has the advantages of mild treatment conditions, high product quality, strong specificity and the like. Therefore, the enzymatic degradation of aflatoxin is a hot spot of current research.

Disclosure of Invention

The invention aims to provide an aflatoxin degradation enzyme mutant and a production strain of the aflatoxin degradation enzyme. The specific enzyme activity of the mutant is obviously improved, the production cost of the mutant is favorably reduced, and the popularization and the application of the mutant in the field of feed are promoted.

The invention provides an aflatoxin degradation enzyme, the amino acid sequence of which is SEQ ID NO. 1.

One coding nucleotide sequence of the aflatoxin degrading enzyme is SEQ ID NO. 2.

The invention provides an aflatoxin degradation enzyme mutant, which is characterized in that the 93 th amino acid of the aflatoxin degradation enzyme with an amino acid sequence of SEQ ID NO. 1 is changed from Arg to Val.

The amino acid sequence of the mutant is SEQ ID NO. 3, and one coding nucleotide sequence of the mutant is SEQ ID NO. 4.

The invention also provides an aflatoxin degradation enzyme mutant, which has the amino acid sequence of SEQ ID NO. 3, wherein the 206 th amino acid of the aflatoxin degradation enzyme mutant is changed from Ala into Phe.

The amino acid sequence of the mutant is SEQ ID NO. 5, and one coding nucleotide sequence of the mutant is SEQ ID NO. 6.

The invention also provides a polypeptide carrying the coding sequence of SEQ ID NO:4 or SEQ ID NO:6, and (3) a recombinant expression vector of the aflatoxin degradation enzyme mutant gene.

The invention also provides a pichia pastorisPichia pastoris) Comprising the above recombinant expression vector.

The plasmid is transferred into pichia pastoris, and the specific enzyme activity level of the recombinant expressed aflatoxin degradation enzyme mutant is obviously improved.

The pichia pastoris also comprises an acetyl coenzyme A synthetase C2 gene.

The coding nucleotide sequence of the acetyl coenzyme A synthetase C2 gene is SEQ ID NO: 7.

the acetyl coenzyme A synthetase C2 gene is transferred into pichia pastoris, and the enzyme activity level of the recombinant expressed aflatoxin degradation enzyme mutant is obviously improved.

The pichia is named as pichia Huang2-X2-43 (Pichia pastoris Huang 2-X2-43), which has been preserved in China center for type culture Collection of Wuhan university in Wuhan, China in 2020, 12, month 2, with the preservation number CCTCC NO: m2020820.

Compared with the wild type, the aflatoxin degrading enzyme mutants HUANG1-X1 and HUANG1-X2 provided by the invention are recombined and expressed in pichia pastoris, the specific enzyme activity is respectively improved by 97.2% and 108.5%, and unexpected technical effects are achieved.

In addition, the enzyme activity of the aflatoxin degradation enzyme mutant can be obviously improved by co-expressing the acetyl coenzyme A synthetase C2 gene in cells in pichia pastoris engineering bacteria. The highest fermentation enzyme activity of the modified Pichia pastoris Huang2-X2-43 reaches 331U/ml, which is improved by 63% compared with that before modification. The pichia pastoris strain can be widely applied to the production of aflatoxin degradation enzyme, and is beneficial to reducing the production cost of the enzyme, so that the wide application of the pichia pastoris strain in the field of feeds is promoted.

Detailed Description

The present invention uses conventional techniques and methods used IN the fields of genetic engineering and MOLECULAR BIOLOGY, such as the methods described IN MOLECULAR CLONING, A LABORATORY MANUAL, 3nd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can adopt other conventional methods, experimental schemes and reagents in the field on the basis of the technical scheme described in the invention, and the invention is not limited to the specific embodiment of the invention.

Strain and carrier: coli DH5 alpha deposited by the same company, Pichia pastoris GS115, vector pPIC9k, pPICZA, Amp, G418, Zeocin were purchased from Invitrogen.

Enzyme and kit: DNA polymerase was purchased from Takara, T4 ligase, restriction enzyme from Fermentas, plasmid extraction kit and gel purification recovery kit from Omega, GeneMorph II random mutagenesis kit from Beijing Bomais Biotech, Inc., and Aflatoxin degrading enzyme detection kit RIDASCREEN Aflatoxin B130/15R 1211 from R-Biopharm.

The formula of the culture medium is as follows:

coli medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, ph 7.0;

LB + Amp medium: adding 100 mu g/mL ampicillin into LB culture medium;

yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;

YPD + Zeocin medium: adding 100 mu g/ml Zeocin into YPD culture medium;

yeast screening medium (MD medium): 1.34% YNB, 4X 10 ^-5 Biotin, 1% glycerol, 2% agarose;

BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH6.0), 1.34% YNB, 4X 10 ^-5 Biotin, 1% glycerol;

BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH6.0), 1.34% YNB, 4X 10 ^-5 Biotin, 0.5% methanol.

Example 1 Gene Synthesis of Aflatoxin-degrading enzyme HUANG2

The aflatoxin-degrading enzyme gene derived from Bacillus amyloliquefaciens (Bacillus amyloliquefaciens) is named HUANG2, the nucleotide sequence of which is SEQ ID NO. 2, and the coding amino acid sequence of which is SEQ ID NO. 1. The entire gene synthesis was carried out by Huada Gene Co.

Example 2 screening of Aflatoxin degrading enzyme HUANG2 mutant

In order to further improve the specific activity of the aflatoxin degradation enzyme HUANG2, a large number of mutations are screened for the gene of the aflatoxin degradation enzyme by a directed evolution technology. The aflatoxin-degrading enzyme HUANG2 was used as a template, and PCR amplification was carried out using GeneMorph II random mutation PCR kit (Stratagene) using primer 1(F) and primer 1 (R).

Primer 1 (F): GCGCGAATTCATGAAACTGGCCTTAGATCCATCCA；

Primer 1 (R): TAAAGCGGCCGCTTATGCCATGCCTAATTCTTCCTTT。

The PCR product is recovered by glue and then,EcoRI、Noti, after enzyme digestion treatment, connecting the vector with pET21a vector subjected to the same enzyme digestion, transforming the vector into escherichia coli BL21(DE3), coating the escherichia coli BL21 on an LB + Amp flat plate, and performing inverted culture at 37 ℃; after the transformants appear, the transformants are picked to a 96-well plate one by using toothpicks, 150 ul LB + Amp culture medium containing 0.1mM IPTG is added into each well, the culture is carried out for about 6 h at 37 ℃ and 220rpm, the supernatant is discarded by centrifugation, the thalli are resuspended by using buffer solution, and the walls are broken by repeated freeze thawing, so as to obtain the escherichia coli cell lysate containing the aflatoxin degradation enzyme. And then centrifuging to remove thalli, respectively measuring the activity and the protein content of the aflatoxin degradation enzyme of the supernatant, and calculating the specific enzyme activity.

The experimental result shows that some mutations have no influence on the specific enzyme activity of the aflatoxin degradation enzyme HUANG2, and some mutations even make the specific enzyme activity lower. Finally, the applicant screens and obtains mutation sites and combinations capable of obviously improving the specific enzyme activity of the aflatoxin degradation enzyme HUANG 2: R93V single point mutation, R93V/A206F two point mutation.

The aflatoxin degradation enzyme mutant containing R93V single-point mutation is named as HUANG2-X1, and the amino acid sequence of the mutant is SEQ ID NO:3, the nucleic acid sequence of one coding gene is SEQ ID NO: 4.

the aflatoxin degradation enzyme mutant containing two point mutations of R93V and A206F is named as HUANG2-X2, and the amino acid sequence of the mutant is SEQ ID NO:5, the nucleic acid sequence of one coding gene is SEQ ID NO: 6.

the above nucleotide sequences were synthesized by Huada Gene Co.

The two mutants were subjected to PCR amplification using primer 1(F) and primer 1(R) under the following conditions: denaturation at 94 deg.C for 5 min; then denaturation at 94 ℃ for 30s, renaturation at 56 ℃ for 30s, extension at 72 ℃ for 1min, and after 35 cycles, heat preservation at 72 ℃ for 10 min. The length of the mutant HUANG2-X1 and HUANG2-X2 genes is the same as that of the wild-type HUANG2 gene, and the total length is about 870 bp.

Example 3 construction of Pichia pastoris engineering bacteria expressing recombinant Aflatoxin degrading enzymes

1. Construction of recombinant plasmid

Respectively using restriction endonuclease to obtain aflatoxin degradation enzyme gene HUANG2 and mutant genes HUANG2-X1 and HUANG2-X2EcoR I andNoti, carrying out double digestion, wherein 100 mu l of digestion system is as follows: 40. mu.l of PCR product of aflatoxin-degrading enzyme gene HUANG2 (HUANG 2-X1, HUANG 2-X2), 10. mu.l of 10 XHbuffer, 10. mu.l of 10 XBA, etc,EcoR I 5 μl、Not I 5 μl、ddH ₂ O30. mu.l. After digestion at 37 ℃ for 4 h, the product was recovered by agarose gel electrophoresis.

The expression vector pPIC9K was first treated with restriction enzymeEcoR I A single digestion was carried out, and 100. mu.l of the digestion system was as follows: 20. mu.l of expression vector pPIC9K 20, 10 XH buffer 10. mu.l,EcoR I 5 μl、ddH ₂ O65. mu.l. After digestion at 37 ℃ for 4 h, the product was recovered by agarose gel electrophoresis. Reuse of the recovered fragments with restriction enzymesNotI, performing single enzyme digestion, wherein 100 mu l of enzyme digestion system is as follows: mu.l of the pPIC9K recovered fragment, 10. mu.l of 10 XH buffer, 10. mu.l of 10 XBSA 10. mu.l of 10 XTuton 10. mu.l,Not I 5 μl、ddH ₂ And O45 mu.l. After digestion at 37 ℃ for 4 h, the product was recovered by agarose gel electrophoresis.

Will be passedEcoR I andNotthe double-restriction enzyme-digested HUANG2 fragment, HUANG2-X1 fragment and HUANG2-X2 fragment are respectively connected with an expression vector pPIC9K which is subjected to the same restriction enzyme digestion to construct recombinant expression plasmids pPIC9K-HUANG2, pPIC9K-HUANG2-X1 and pPIC9K-HUANG 2-X2. The linking system is as follows: expression vector pPIC9K double enzyme digestion product 5 ul, HUANG2 (HUANG 2-X1, HUANG 2-X2) gene double enzyme digestion product 3 ul, 10 XT ₄ ligase buffer 1 μl、T ₄ 1 μ l of ligase. The ligation was carried out overnight at 22 ℃ and transformed into E.coli DH 5. alpha. and transformants were picked for sequencing verification. And (3) transferring the transformants which are verified to be correct by sequencing into an LB + Amp liquid culture medium, culturing overnight at 37 ℃, and upgrading the plasmids to obtain recombinant yeast expression plasmids pPIC9K-HUANG2 (pPIC 9K-HUANG2-X1, pPIC9K-HUANG 2-X2).

Transformation and screening

The recombinant yeast expression plasmids pPIC9K-HUANG2, pPIC9K-HUANG2-X1 and pPIC9K-HUANG2-X2 were used respectivelySalI, linearization, purifying a linearization product by using a column purification kit, converting pichia pastoris GS115 by an electroporation method, and coating an MD plate. The colony grown on the MD plate is the pichia pastoris engineering strain, and then YPD plates containing different concentrations of geneticin G418 are coated to screen multi-copy transformants.

Shake flask fermentation verification

Selecting single multi-copy transformants, respectively inoculating into BMGY culture medium, performing shake culture at 30 ℃ and 220rpm for 24 hours, then transferring into BMMY culture medium, performing shake culture at 30 ℃ and 220rpm, and adding 0.5% methanol every 24 hours. After the induction expression is carried out for 4 days, the thalli are removed by centrifugation, the activity of the aflatoxin degradation enzyme and the protein content of the supernatant are respectively measured, and the specific enzyme activity is calculated.

The result shows that the maximum fermentation enzyme activity of a transformant for recombinant expression of the wild aflatoxin degradation enzyme gene HUANG2 reaches 105U/ml, the protein content is 0.31g/l, and the specific enzyme activity is 338.7U/mg under the condition of a shake flask. The transformant was named Pichia pastoris HUANG2-21 (Pichia pastoris HUANG2-21）；

The highest fermentation enzyme activity of a transformant for recombinantly expressing the aflatoxin degradation enzyme mutant gene HUANG2-X1 reaches 187U/ml, the protein content is 0.28g/l, and the specific enzyme activity is 667.9U/mg. The transformant was named Pichia pastoris HUANG2-X1-44 (Pichia pastoris HUANG2-X1-44）；

The maximum fermentation enzyme activity of a transformant for recombinant expression of the aflatoxin degrading enzyme mutant gene HUANG2-X2 reaches 226U/ml, the protein content is 0.32g/l, and the specific enzyme activity is 706.3U/mg. The transformant was named Pichia pastoris HUANG2-X2-89 (Pichia pastoris HUANG2-X2-89）；

From the results, compared with the wild type, the mutant genes HUANG1-X1 and HUANG1-X2 provided by the invention are recombined and expressed in pichia pastoris, so that the specific enzyme activities are respectively improved by 97.2% and 108.5%, and unexpected technical effects are achieved.

Aflatoxin degrading enzyme biopsy detection method

1. Definition of enzyme Activity Unit

The amount of enzyme required to degrade 1 pmol AFB1 per minute at pH6.0 and 30 ℃ was one enzyme activity unit (U/g or U/ml).

2. Sample processing method

Liquid sample: the supernatant was centrifuged and used directly for the subsequent assay.

3. Experimental procedure for enzyme reactions

TABLE 1 enzymatic reaction procedure

In the enzyme reaction test operation, 45ml of buffer solution (0.02M citric acid-0.04M disodium hydrogen phosphate, pH6.0) and 2.5ml of AFB1 standard stock solution (2 ug/ml) are precisely taken and mixed uniformly (18: 1), and then 1.9ml is precisely measured to reduce the test deviation.

4. Enzyme activity calculation method

In the formula:

u is enzyme activity, U/ml;

f is the dilution multiple;

c, comparison: control AFB1 concentration, ppb;

c, test: test group AFB1 concentration, ppb;

v: sample volume, ml.

Detection of protein content by Coomassie brilliant blue method

1. Reagent

(1) Coomassie brilliant blue G-250 staining solution: dissolving Coomassie brilliant blue G-250100 mg in 50ml 95% ethanol, adding 100ml 85% phosphoric acid, diluting with water to 1L, and using at normal temperature for 1 month;

(2) standard protein solution: measuring the protein content by using bovine serum albumin through a trace Kjeldahl method in advance, and preparing a 1 mg/ml protein standard solution according to the purity of the protein;

(3) preparing a standard stock solution: accurately weighing 0.05g of crystallized bovine serum albumin on an analytical balance, adding a small amount of distilled water into a small beaker, dissolving, transferring into a 50ml volumetric flask, washing residual liquid in the beaker with a small amount of distilled water for several times, pouring the washing liquid into the volumetric flask together, and finally fixing the volume to the scale with the distilled water. A standard stock solution was prepared in which the concentration of bovine serum albumin was 1000. mu.g/ml.

2. And (5) drawing a standard curve.

(1) The 6 test tubes are respectively numbered, the reagents are added according to the following table, and the mixture is uniformly mixed.

Pipe number	1	2	3	4	5	6
							Sample (ml)	0	0.1	0.2	0.3	0.4	0.5
Water (ml)	2.0	1.9	1.8	1.7	1.6	1.5
							Protein content (mg/ml)	0	0.05	0.1	0.15	0.2	0.25

(2) Accurately sucking 2.5ml of Coomassie brilliant blue solution into 6 dry test tubes, accurately sucking 0.1ml of the solution in each tube, correspondingly placing the solution in each numbered test tube, uniformly mixing by vortex, standing at room temperature for 5min, zeroing with test tube No. 1, measuring at 595nm for color comparison, and recording the light absorption value.

(3) Drawing a standard curve: the absorbance values read by the 1-6 tubes were recorded, and a standard curve was drawn with the protein content (μ g) as the abscissa and the absorbance as the ordinate. Note that the cuvette had to be cleaned due to the strong staining ability of coomassie brilliant blue. Cannot be measured with a quartz cup.

3. Determination of samples

(1) Preparation of samples:

diluting a sample to be detected to the protein content of 0.1-0.3mg/ml, and controlling the light absorption value (after blank is subtracted) after blank is removed to be 0.2-0.4;

(2) sample detection:

adding a clean test tube into a Coomassie brilliant blue solution containing 2.5ml, adding a sample to be tested, vortexing, shaking uniformly, standing at room temperature for 5min, taking a blank of a standard curve as a control, measuring absorbance at 595nm by using a micro cuvette with an optical path of 1cm, and obtaining the protein content according to the standard curve.

4. Protein content calculation

Protein content = X dilution fold × standard conversion factor.

X: protein content (mg/ml) determined from the standard.

Reduced value of standard sample: the standard sample was 47mg/ml, and a coefficient was converted from the measured value.

(III) calculation of specific enzyme Activity

"Specific Activity" means: the number of units of enzyme activity per weight of protein is generally expressed as U/mg protein. In general, the higher the specific enzyme activity, the more pure the enzyme.

Specific activity calculation formula: specific enzyme activity (U/mg) = enzyme activity (U/mL)/protein content (mg/mL).

Example 4 modification of regulatory Gene of Pichia pastoris HUANG2-X2-89

1. Cloning of acetyl-CoA synthetase C2

Taking genome of Pichia pastoris GS115 as a template, cloning acetyl coenzyme A synthetase C2 gene by PCR reaction, wherein primers and reaction conditions are as follows:

primer 1 (F): GCGCGAATTCATGACTTTTCCAGAGCCAAGAGAACACAAA；

Primer 1 (R): TAAAGCGGCCGCCTACTTCTTGAAGAACTGGTTATCAACAG。

The PCR conditions were: denaturation at 94 deg.C for 5 min; then denaturation at 94 ℃ for 30s, renaturation at 56 ℃ for 30s, extension at 72 ℃ for 2min for 30s, and after 35 cycles, heat preservation at 72 ℃ for 10 min. The total length of the acetyl coenzyme A synthetase C2 gene is 2019bp, and the nucleotide sequence is SEQ ID NO: 7.

construction of expression plasmid for acetyl-CoA synthetase C2 Gene

Restriction enzyme for the cloned acetyl-CoA synthetase C2 GeneEcoR I andNoti, carrying out double digestion, wherein 50 mu l of digestion system is as follows: 43. mu.l of acetyl-CoA synthetase C2 gene, 5. mu.l of 10 XFastdigest Buffer,EcoR I 1 μl、NotI1. mu.l. After digestion at 37 ℃ for 2h, the product was recovered by agarose gel electrophoresis.

Restriction enzyme for expression vector pPICZAEcoR I andNoti, carrying out double digestion, wherein 50 ul of digestion system is as follows: the vector pPICZA 43. mu.l, 10 XFastdigest Buffer 5. mu.l,EcoR I 1 μl、NotI1. mu.l. After digestion at 37 ℃ for 2h, the product was recovered by agarose gel electrophoresis.

Will be passed throughEcoR I andNotthe I double enzyme-digested acetyl coenzyme A synthetase C2 gene fragment is connected with an expression vector pPICZA subjected to the same enzyme digestion to construct a recombinant expression plasmid pPICZA-C2. The linking system is as follows: 5 mul of expression vector pPICZA double restriction enzyme products, 3 mul of acetyl coenzyme A synthetase C2 gene double restriction enzyme products and 10 XT ₄ ligase buffer 1 μl、T ₄ 1 μ l of ligase. The ligation was carried out overnight at 22 ℃ and transformed into E.coli DH 5. alpha. and transformants were picked for sequencing verification. And (3) transferring the transformant which is verified to be correct by sequencing into an LC + Zeocin liquid medium, carrying out overnight culture at 37 ℃, and upgrading the plasmid to obtain the yeast intracellular expression plasmid pPICZA-C2.

The regulatory gene C2 is transferred into pichia pastoris HUANG2-X2-89

The recombinant plasmid pPICZA-C2 was treated with restriction enzymesSacI linearization, purification of linearization product with column purification kit, transformation of Pichia pastoris HUANG2-X2-89 by electroporation, and coating YPD + Zeocin plate. Growing on YPD + Zeocin plateThe bacterial colony is the pichia pastoris engineering strain transformed into C2.

Strain shake flask fermentation screening verification

A plurality of positive transformants were picked and inoculated into BMGY medium respectively, after shaking culture at 30 ℃ and 220rpm for 24 hours, transferred into BMMY medium, and shaking culture at 30 ℃ and 220rpm was carried out, using HUANG2-X2-89 strain as a control, and 0.5% methanol was added every 24 hours. After the induction expression is carried out for 4 days, the thalli are removed by centrifugation, and the activity of the aflatoxin degradation enzyme is measured on the supernatant.

The result shows that the fermentation enzyme activity of the Pichia pastoris HUANG2-X2-89 before modification is 203U/ml under the condition of a shake flask; the highest fermentation enzyme activity in the transformant transferred into the C2 gene reaches 331U/ml, and the transformant is named as pichia pastoris Huang2-X2-43 (C2)Pichia pastoris Huang 2-X2-43). Therefore, the intracellular co-expression of the C2 gene in the pichia pastoris engineering bacteria can obviously improve the enzyme activity of the aflatoxin degradation enzyme mutant HUANG2-X2, the improvement proportion reaches 63 percent, and unexpected technical effects are achieved.

The applicant has already applied Pichia pastoris Huang2-X2-43 (at 12/2/2020;)Pichia pastoris Huang 2-X2-43) is preserved in China center for type culture Collection of Wuhan university in Wuhan, China, with the preservation number of CCTCC NO: m2020820.

Sequence listing

<110> Weifang kang Den Biotech Co., Ltd

QINGDAO VLAND BIOTECH GROUP Co.,Ltd.

<120> aflatoxin degrading enzyme mutant and high-yield strain thereof

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 289

<212> PRT

<213> Bacillus amyloliquefaciens (Bacillus amyloliquefaciens)

<400> 1

Met Lys Leu Ala Leu Asp Pro Ser Met Tyr Arg Asp Asp Leu Thr Leu

1 5 10 15

Glu Glu Met Val Tyr Lys Thr Ala Glu Leu Gly Tyr Glu Tyr Ile Glu

20 25 30

Leu Ser Pro Arg Glu Asp Phe Cys Pro Phe Tyr Lys Tyr Pro Lys Val

35 40 45

Asp Ser Ala Lys Ile Lys Gln Leu Lys Arg Leu Leu Lys Asp Thr Gly

50 55 60

Val Lys Leu Ser Ser Leu Leu Pro Leu Tyr His Trp Ala Gly Pro Asp

65 70 75 80

Glu Asp Arg Arg Gln Ala Ala Val Arg Asn Trp Lys Arg Ala Ile Glu

85 90 95

Ile Ala Val Glu Leu Glu Val Asp Leu Met Asn Ser Glu Phe Ser Gly

100 105 110

Ser Lys Tyr Asp Pro Leu Thr Ser Glu Glu Lys Phe Ile Lys Ser Met

115 120 125

Asp Glu Leu Leu Pro Val Phe Glu Lys Glu Gly Val Lys Leu Asn Leu

130 135 140

Gln Ala His Pro Tyr Asp Phe Ile Glu Thr His Lys Gly Ala Met Asp

145 150 155 160

Met Ile Arg Ala Leu Asp Lys Asp Trp Ile Asn Leu Val Tyr Ser Thr

165 170 175

Ala His Thr Phe Phe Tyr Asp Asp Gly Lys Gly Asp Ile Ala Thr Met

180 185 190

Phe Asp Glu Ala Gly Asp Arg Leu Thr His Val Leu Phe Ala Asp Thr

195 200 205

Phe Asn His Lys Ala Ala His Gly Leu Arg Tyr Ile Val Asn Pro Pro

210 215 220

Asp Ala Lys Val Thr Val His Gln His Leu Asp Ile Gly Gln Gly Glu

225 230 235 240

Val Asp Phe Glu Thr Ile Phe Arg Lys Met Arg Glu Met Lys Phe Asp

245 250 255

Gly Ile Ala Thr Asn Ala Val Phe Ala Trp Val Gly Glu Arg Ala Asp

260 265 270

Glu Ser Ser Arg Thr Thr Leu Lys Lys Leu Lys Glu Glu Leu Gly Met

275 280 285

Ala

<210> 2

<211> 870

<212> DNA

<213> Bacillus amyloliquefaciens (Bacillus amyloliquefaciens)

<400> 2

atgaaactgg ccttagatcc atccatgtac cgtgatgatt taacgttaga ggaaatggtc 60

tataaaacgg cggagctcgg atatgaatat atcgaattgt ccccgcgcga ggatttttgt 120

cctttctaca aatatccgaa agtcgattca gcaaaaatca aacaattgaa gcgcctttta 180

aaggatacag gtgtgaagct gtcctctctt cttccgcttt accactgggc gggtcctgat 240

gaagaccgcc gacaggccgc cgtgcgcaac tggaaacggg cgatcgaaat tgcggttgaa 300

cttgaagtgg atttgatgaa cagtgaattc agcggttcaa aatatgatcc tttgacaagt 360

gaagaaaaat ttatcaaatc catggatgaa ctgctgcccg tttttgaaaa agaaggcgtt 420

aaactcaatc ttcaggctca cccatacgat tttatcgaaa cgcacaaagg cgcgatggat 480

atgatccgcg cgcttgacaa ggattggatc aatcttgtct actcgactgc gcatacgttc 540

ttctatgatg acggaaaagg cgatattgcg accatgtttg atgaagccgg cgaccgcctt 600

acacatgttt tatttgcaga tacttttaat cataaagcgg cgcacggcct gcgttacatc 660

gtcaacccgc ctgatgcgaa agtaacggtt caccagcatt tggacatcgg tcaaggcgag 720

gttgattttg agacgatttt cagaaagatg agagagatga aattcgacgg aattgcgacg 780

aacgccgttt ttgcttgggt cggcgaaaga gcggatgaat caagccggac cacgcttaag 840

aaattaaagg aagaattagg catggcataa 870

<210> 3

<211> 289

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Lys Leu Ala Leu Asp Pro Ser Met Tyr Arg Asp Asp Leu Thr Leu

1 5 10 15

Glu Glu Met Val Tyr Lys Thr Ala Glu Leu Gly Tyr Glu Tyr Ile Glu

20 25 30

Leu Ser Pro Arg Glu Asp Phe Cys Pro Phe Tyr Lys Tyr Pro Lys Val

35 40 45

Asp Ser Ala Lys Ile Lys Gln Leu Lys Arg Leu Leu Lys Asp Thr Gly

50 55 60

Val Lys Leu Ser Ser Leu Leu Pro Leu Tyr His Trp Ala Gly Pro Asp

65 70 75 80

Glu Asp Arg Arg Gln Ala Ala Val Arg Asn Trp Lys Val Ala Ile Glu

85 90 95

Ile Ala Val Glu Leu Glu Val Asp Leu Met Asn Ser Glu Phe Ser Gly

100 105 110

Ser Lys Tyr Asp Pro Leu Thr Ser Glu Glu Lys Phe Ile Lys Ser Met

115 120 125

Asp Glu Leu Leu Pro Val Phe Glu Lys Glu Gly Val Lys Leu Asn Leu

130 135 140

Gln Ala His Pro Tyr Asp Phe Ile Glu Thr His Lys Gly Ala Met Asp

145 150 155 160

Met Ile Arg Ala Leu Asp Lys Asp Trp Ile Asn Leu Val Tyr Ser Thr

165 170 175

Ala His Thr Phe Phe Tyr Asp Asp Gly Lys Gly Asp Ile Ala Thr Met

180 185 190

Phe Asp Glu Ala Gly Asp Arg Leu Thr His Val Leu Phe Ala Asp Thr

195 200 205

Phe Asn His Lys Ala Ala His Gly Leu Arg Tyr Ile Val Asn Pro Pro

210 215 220

Asp Ala Lys Val Thr Val His Gln His Leu Asp Ile Gly Gln Gly Glu

225 230 235 240

Val Asp Phe Glu Thr Ile Phe Arg Lys Met Arg Glu Met Lys Phe Asp

245 250 255

Gly Ile Ala Thr Asn Ala Val Phe Ala Trp Val Gly Glu Arg Ala Asp

260 265 270

Glu Ser Ser Arg Thr Thr Leu Lys Lys Leu Lys Glu Glu Leu Gly Met

275 280 285

Ala

<210> 4

<211> 870

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgaaactgg ccttagatcc atccatgtac cgtgatgatt taacgttaga ggaaatggtc 60

tataaaacgg cggagctcgg atatgaatat atcgaattgt ccccgcgcga ggatttttgt 120

cctttctaca aatatccgaa agtcgattca gcaaaaatca aacaattgaa gcgcctttta 180

aaggatacag gtgtgaagct gtcctctctt cttccgcttt accactgggc gggtcctgat 240

gaagaccgcc gacaggccgc cgtgcgcaac tggaaagttg cgatcgaaat tgcggttgaa 300

cttgaagtgg atttgatgaa cagtgaattc agcggttcaa aatatgatcc tttgacaagt 360

gaagaaaaat ttatcaaatc catggatgaa ctgctgcccg tttttgaaaa agaaggcgtt 420

aaactcaatc ttcaggctca cccatacgat tttatcgaaa cgcacaaagg cgcgatggat 480

atgatccgcg cgcttgacaa ggattggatc aatcttgtct actcgactgc gcatacgttc 540

ttctatgatg acggaaaagg cgatattgcg accatgtttg atgaagccgg cgaccgcctt 600

acacatgttt tatttgcaga tacttttaat cataaagcgg cgcacggcct gcgttacatc 660

gtcaacccgc ctgatgcgaa agtaacggtt caccagcatt tggacatcgg tcaaggcgag 720

gttgattttg agacgatttt cagaaagatg agagagatga aattcgacgg aattgcgacg 780

aacgccgttt ttgcttgggt cggcgaaaga gcggatgaat caagccggac cacgcttaag 840

aaattaaagg aagaattagg catggcataa 870

<210> 5

<211> 289

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Met Lys Leu Ala Leu Asp Pro Ser Met Tyr Arg Asp Asp Leu Thr Leu

1 5 10 15

Glu Glu Met Val Tyr Lys Thr Ala Glu Leu Gly Tyr Glu Tyr Ile Glu

20 25 30

Leu Ser Pro Arg Glu Asp Phe Cys Pro Phe Tyr Lys Tyr Pro Lys Val

35 40 45

Asp Ser Ala Lys Ile Lys Gln Leu Lys Arg Leu Leu Lys Asp Thr Gly

50 55 60

Val Lys Leu Ser Ser Leu Leu Pro Leu Tyr His Trp Ala Gly Pro Asp

65 70 75 80

Glu Asp Arg Arg Gln Ala Ala Val Arg Asn Trp Lys Val Ala Ile Glu

85 90 95

Ile Ala Val Glu Leu Glu Val Asp Leu Met Asn Ser Glu Phe Ser Gly

100 105 110

Ser Lys Tyr Asp Pro Leu Thr Ser Glu Glu Lys Phe Ile Lys Ser Met

115 120 125

Asp Glu Leu Leu Pro Val Phe Glu Lys Glu Gly Val Lys Leu Asn Leu

130 135 140

Gln Ala His Pro Tyr Asp Phe Ile Glu Thr His Lys Gly Ala Met Asp

145 150 155 160

Met Ile Arg Ala Leu Asp Lys Asp Trp Ile Asn Leu Val Tyr Ser Thr

165 170 175

Ala His Thr Phe Phe Tyr Asp Asp Gly Lys Gly Asp Ile Ala Thr Met

180 185 190

Phe Asp Glu Ala Gly Asp Arg Leu Thr His Val Leu Phe Phe Asp Thr

195 200 205

Phe Asn His Lys Ala Ala His Gly Leu Arg Tyr Ile Val Asn Pro Pro

210 215 220

Asp Ala Lys Val Thr Val His Gln His Leu Asp Ile Gly Gln Gly Glu

225 230 235 240

Val Asp Phe Glu Thr Ile Phe Arg Lys Met Arg Glu Met Lys Phe Asp

245 250 255

Gly Ile Ala Thr Asn Ala Val Phe Ala Trp Val Gly Glu Arg Ala Asp

260 265 270

Glu Ser Ser Arg Thr Thr Leu Lys Lys Leu Lys Glu Glu Leu Gly Met

275 280 285

Ala

<210> 6

<211> 870

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgaaactgg ccttagatcc atccatgtac cgtgatgatt taacgttaga ggaaatggtc 60

tataaaacgg cggagctcgg atatgaatat atcgaattgt ccccgcgcga ggatttttgt 120

cctttctaca aatatccgaa agtcgattca gcaaaaatca aacaattgaa gcgcctttta 180

aaggatacag gtgtgaagct gtcctctctt cttccgcttt accactgggc gggtcctgat 240

gaagaccgcc gacaggccgc cgtgcgcaac tggaaagttg cgatcgaaat tgcggttgaa 300

cttgaagtgg atttgatgaa cagtgaattc agcggttcaa aatatgatcc tttgacaagt 360

gaagaaaaat ttatcaaatc catggatgaa ctgctgcccg tttttgaaaa agaaggcgtt 420

aaactcaatc ttcaggctca cccatacgat tttatcgaaa cgcacaaagg cgcgatggat 480

atgatccgcg cgcttgacaa ggattggatc aatcttgtct actcgactgc gcatacgttc 540

ttctatgatg acggaaaagg cgatattgcg accatgtttg atgaagccgg cgaccgcctt 600

acacatgttt tattttttga tacttttaat cataaagcgg cgcacggcct gcgttacatc 660

gtcaacccgc ctgatgcgaa agtaacggtt caccagcatt tggacatcgg tcaaggcgag 720

gttgattttg agacgatttt cagaaagatg agagagatga aattcgacgg aattgcgacg 780

aacgccgttt ttgcttgggt cggcgaaaga gcggatgaat caagccggac cacgcttaag 840

aaattaaagg aagaattagg catggcataa 870

<210> 7

<211> 2019

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atgacttttc cagagccaag agaacacaaa gtggtgcacg aagccaacgg cgtaagggct 60

atcaaaaccc ctcaatcatt ttatgacaag caacctgtta agtcattgga ggcattggaa 120

cattatcaag agctgtacca gaagtccatc gaggacccag aggaattctt cggccaaatg 180

gcaaagcagt ttctagattg ggacaaagac tttggtaagg tctcctctgg atctttgaaa 240

gaaggtgatg ctgcgtggtt ccttggtgga gagctgaatg cttcgtacaa ctgtgttgac 300

cgacatgctt tttcgcaccc tgatcgtccc gccgtaattt tcgaagcgga cgaggaatct 360

gaatctcgaa caataactta tgcagaactt ctacgtgagg tctctcgtgt tgcaggagta 420

ctgcagagct ggggtgtacg caaaggtgac actgtcgcaa tctacttgcc catgactacc 480

gaggccattg tggccatgct ggcagtggca cgtctgggtg cagtgcactc cgttatcttt 540

tctggatttt cgtcaggatc tatccgggac agagttaacg atgctggatc taaggcaatt 600

attacctgtg atgagggacg ccgtgggggt cgtattgtga acaataagaa aattgtcgat 660

gccgctgttg acagctgccc cacagtggaa aaaatcctgg tttataagag gactggtaac 720

ccagaaatca agatggtaga aggaagagac ttctggtggc aggaagaggt tgagaaattc 780

cctggttaca ttgcccctgt ccctgtaaac tcggaggacc cactatttct tttgtatact 840

tcgggatcta ctggttctcc caaaggtgtg gtacactcca caggtggtta tttgctggga 900

gcagcattga caactcgtta tgtgtttgat gtccaggatg aggatattat atttactgct 960

ggtgacgtcg gatggattac tggtcacaca tactcgttgt atggaccact tgttctgggt 1020

gttccaacca ttgtttttga gggaactcct gtctaccctg actacggaag attgtggaag 1080

atttgcgcca aacataaagc cacacacttt tacatcgctc ctactgctct tcgtcttttg 1140

aaaaaggctg gtgaagaaga aattaaaaag tacgacttgt ctagacttcg tactttagga 1200

tctgttggtg aaccaattgc ccccgaattg tgggagtggt acaatgagaa aatcggaaac 1260

ggaaactgtc atattgctga tacttactgg cagactgaat ctggttctca tttgattgct 1320

ccattagcag gtgccgttcc ccaaaagccg ggtgcagcta ctgttccttt ctttggtatt 1380

gatgcttgta tcattgaccc tgtttctggt aaggaacttg aaggcaacga tgtggaaggt 1440

gttttagctg tcaagtccac ttggccatca atggctcgta cagtctggag aaaccacgct 1500

aaatacctcg acacatatat gcgtccttat ccaggctact actttactgg cgatggtgcc 1560

ggtagagatc acgatggtta ttactggatc cgtggtcgtg ttgacgatgt tgtcaatgta 1620

tctggccacc gtttatccac ttctgaaatt gaaagtgctt tactggaaaa tggcaaagtt 1680

gctgaagctg ctgtgattgg tatttccgat gagctaactg gtcaagctgt tattgctttt 1740

gtcgccttga aagatgccac tgactctgag aatttagacg ctctcagacg tgccttagtc 1800

ttgcatgttc gtggagaaat tggtccattt gcagctccta agtccgtgat tgtggttgat 1860

gacttgccta agacccgatc aggtaagatc atgcgtagag ttttaagaaa gatttcttgc 1920

catgaagctg atcaattggg tgatatgtct actttggcca atcctgaatc ggtagactct 1980

ataatcggag ctgttgataa ccagttcttc aagaagtag 2019

Claims (7)

1. The aflatoxin degrading enzyme mutant is characterized in that the 93 rd amino acid of the aflatoxin degrading enzyme with an amino acid sequence of SEQ ID NO. 1 is changed from Arg to Val.

2. An aflatoxin-degrading enzyme mutant characterized in that the amino acid at position 206 of the aflatoxin-degrading enzyme mutant of claim 1 is changed from Ala to Phe.

3. A recombinant expression vector carrying a nucleic acid sequence having the coding sequence of SEQ ID NO:4 or SEQ ID NO:6 of the mutant gene of the aflatoxin degradation enzyme.

4. A kind of Pichia yeast (Pichia pastoris) Wherein the Pichia pastoris comprises the recombinant expression vector of claim 3.

5. The Pichia pastoris of claim 4, further comprising an acetyl-CoA synthetase C2 gene.

6. The pichia pastoris of claim 5, wherein the coding nucleotide sequence of the acetyl-coa synthetase C2 gene is SEQ ID NO: 7.

7. the pichia pastoris of claim 6, wherein the pichia pastoris has a accession number of CCTCC NO: m2020820.