CN112760275B

CN112760275B - Recombinant bacterium for producing porphyrin compound and method for producing porphyrin compound

Info

Publication number: CN112760275B
Application number: CN201910999107.4A
Authority: CN
Inventors: 张璐; 张立新; 谭高翼; 陈海红; 朱国良; 王科峰; 李川; 周立铭; 石桐; 刘乐诗
Original assignee: East China University of Science and Technology
Current assignee: East China University of Science and Technology
Priority date: 2019-10-21
Filing date: 2019-10-21
Publication date: 2023-06-06
Anticipated expiration: 2039-10-21
Also published as: CN112760275A

Abstract

The invention relates to a recombinant bacterium for producing porphyrin compounds and a method for producing porphyrin compounds by using the recombinant bacterium. Compared with the original strain, the recombinant strain provided by the invention comprises a regulator FnrL with reduced regulation capability and has a haemoglobin synthase AhbD expression cassette. The recombinant bacterium provided by the invention not only can be used for producing porphyrin compounds, but also can be used for discharging the produced porphyrin compounds to fermentation liquor, so that the porphyrin compounds can be obtained more conveniently.

Description

Recombinant bacterium for producing porphyrin compound and method for producing porphyrin compound

Technical Field

The invention relates to a genetically engineered bacterium, in particular to a recombinant bacterium for producing porphyrin compounds and application thereof.

Background

Erythrocytes have an indispensable role in maintaining human body functions. Hemoglobin in erythrocytes is a protein that transports oxygen within erythrocytes, formed by the binding of heme to globulin. Heme has four subunits, each of which is capable of binding to a molecule of oxygen, thereby transporting the oxygen throughout the body. Therefore, heme is also an indispensable substance for the human body. When the human body lacks heme, a disease is caused-porphyria. Porphyrias are caused by abnormal production and excretion of porphyrins due to defects in various specific enzymes in the heme synthesis pathway. Once the disease has developed, it is repeated, and intravenous heme is required to relieve symptoms during the acute attack period. Small, prophylactic doses of heme can also reduce the levels of porphyrin precursors in plasma, thereby improving the frequency and severity of acute episodes.

Porphyrin compounds and heme can be used as iron supplement for human body besides relieving porphyrin diseases. It can be seen that porphyrin compounds and heme are widely used in medical care, food pigment and other fields, and the application market is wide. However, the production of the compound mainly originates from animal tissues and blood, and the problems of limited raw material supply, complicated extraction process, high cost and low productivity are caused, and the current epidemic situation of African swine fever is seriously spread, so that the biological safety of the compound is still to be inspected.

A detailed study of a global regulator, fnrL, in rhodobacter gelatinosum (Rubrivivax gelatinosus) was disclosed by Soufian oucha et al (Soufian oucha et al Global Regulation of Photosynthesis and Respiration by FnrL, THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL.282, no.10, pages 7690-7699, 3-9 days 2007). FnrL as a regulator capable of sensing oxygen concentration controls a range of gene expression (i.e., different genes are selectively expressed under anaerobic or aerobic conditions), and the expression of these genes is related to synthesis of heme, chlorophyll and VB 12. The fnrL gene is found in many photosynthetic bacteria in many species, such as E.coli (E.coli), brucella melitensis (Burkholderia pseudomallei), and rhodobacter capsulatus (Rhodobacter capsulatus). In 2018, sang Yup Lee group successfully produced heme in E.coli by metabolic pathway optimization and fermentation process optimization (Xin Rui Zhao et al Metabolic engineering of Escherichia coli for secretory production of free haem, nature Catalysis,

VOL

1, 2018, 9 months, 720-728).

However, there is still a need in the art for genetically engineered strains capable of producing porphyrins, in particular for genetically engineered strains capable of producing heme, to provide more pathways for the production of porphyrins.

Disclosure of Invention

In order to solve the technical problems, the inventor obtains recombinant bacteria capable of producing porphyrin compounds through genetic engineering, and the recombinant bacteria not only can produce porphyrin compounds, but also can discharge the produced porphyrin compounds to fermentation liquor, so that the porphyrin compounds can be obtained more conveniently.

In a first aspect of the invention, the invention provides recombinant bacteria that produce porphyrins. In the present invention, the recombinant strain producing porphyrin compound contains a regulator FnrL with reduced regulatory ability as compared with the original strain, and has an introduced expression cassette encoding heme synthase (AhbD).

In the present invention, the recombinant bacteria are selected from photosynthetic bacteria, paracoccus denitrificans (Paracoccus denitrificans), bacillus subtilis (Bacillus subtilis), agrobacterium tumefaciens (Agrobacterium tumefaciens), rhizobium mesorhizogenes (Rhizobium mesoamericanum), methanobacillus barker (Methanosarcina barkeri str. Fusaro). Preferably, the photosynthetic bacteria are selected from purple non-sulphur photosynthetic bacteria. For example, the photosynthetic bacteria are selected from rhodobacter sphaeroides (Rhodobacter sphaeroides), rhodobacter capsulatus (Rhodobacter capsulatus), rhodobacter azotemlobus (Rhodobacter azotoformans), or rhodobacter gelatinosum (Rubrivivax gelatinosus).

In the case where the recombinant bacterium is rhodobacter sphaeroides, the recombinant bacterium has a knockout of a gene (FnrL gene) encoding FnrL (the amino acid sequence shown by SEQ ID NO: 1).

In some embodiments, the recombinant bacterium has an expression cassette encoding AhbD (e.g., the amino acid sequence set forth by SEQ ID NO: 3).

In a second aspect of the present invention, there is provided a method for producing the recombinant bacterium according to the first aspect, the method comprising: reducing the regulatory capacity of a regulator FnrL in a starting strain, and introducing an expression cassette encoding heme synthase AhbD into the starting strain.

In a third aspect of the invention, the invention provides a process for the production of a porphyrin-like compound, comprising fermenting a recombinant bacterium as described above, thereby obtaining the porphyrin-like compound.

In a fourth aspect of the invention, the use of a recombinant bacterium as described hereinbefore for the preparation of a porphyrin-like compound.

In a fifth aspect of the invention, the invention provides a live bacterial preparation comprising the recombinant bacterium of the invention.

Advantageous effects

The invention successfully utilizes microorganisms to produce various precursors of heme and heme, namely various porphyrin compounds, effectively avoids using raw materials of animal or plant sources, improves the biosafety performance of heme and other porphyrin compounds, and effectively reduces the production cost. In addition, the recombinant bacterium disclosed by the invention can actively excrete the generated porphyrin compound. Compared with other reported porphyrin compounds synthesized in recombinant strains and the exogenesis way, the recombinant strain provided by the invention has better stability.

Drawings

FIG. 1 shows the synthesis pathway of heme in organisms.

FIG. 2 shows the binder verification results. Three groups are all blank controls without adding any nucleic acid templates; the genome control uses rhodobacter sphaeroides genome as a template; plasmid control uses pK18-fnrL recombinant plasmid as a template; 1-1, 1-2, 3 are four binders. Group 1: the primers are all upstream primers of the left homologous arm and downstream primers of the right homologous arm of the fnrL gene. Group 2: the upstream primer is located on the rhodobacter sphaeroides genome, and the downstream primer is located on the inserted resistance gene amp ^R And (3) the middle. Group 3: the upstream primer is located on the target gene fnrL to be knocked out, and the downstream primer is located on the rhodobacter sphaeroides genome.

FIG. 3 shows the binder verification results. In the two groups, blank control is that no template is added; the genome control uses rhodobacter sphaeroides genome as a template; plasmid control uses pK18-fnrL recombinant plasmid as a template; 1-1, 1-2, 3 are four binders. Group 3: all take sacB genes on suicide plasmids as primers designed by templates. Group 4: all by kana on suicide plasmid ^R The gene is a primer designed by a template.

FIG. 4 shows the results of a full spectrum scan of the RSI-. DELTA.fnrL broth supernatant. Wherein, 1mL fermentation liquid of a control group and an experimental group fermented for 48 hours is taken and centrifuged for 1min, supernatant is taken and subjected to full spectrum scanning by an enzyme-labeled instrument in a 96-well plate, the lower curve represents a control strain-wild rhodobacter sphaeroides 2.4.1, and the upper curve represents RSI-delta fnrL.

FIG. 5 shows the low resolution LC-MS detection results of RSI- ΔfnrL fermentation broth. The supernatant of the fermentation broth was filtered through a 0.22 μm filter membrane, and the filtrate was subjected to LC-MS detection, wherein Ind represents a control strain-wild type rhodobacter sphaeroides 2.4.1, and Ind-. DELTA.FnrL represents RSI-. DELTA.fnrL. The knockout strain RSI- Δfnrl produced two distinct peaks.

FIG. 6 shows the mass spectrum corresponding to peak 1 in FIG. 5. The mass fraction of the ion source is 707 according to the positive and negative ion sources of the mass spectrum, and the ion source is compared with intermediates in porphyrin pathways to judge the ion source as Fe-fecal porphyrin III (C) ₃₆ H ₃₆ FeN ₄ O ₈ )。

FIG. 7 shows the mass spectrum corresponding to peak 2 in FIG. 5. The mass fraction of the porphyrin is 654 according to the positive and negative ion source peaks of the mass spectrum, and the porphyrin is compared with the intermediate in the porphyrin pathway, and the porphyrin is judged to be coproporphyrin III (C) ₃₆ H ₃₈ N ₄ O ₈ )。

FIG. 8 shows the results of HR-MS detection. The RSI-DeltafnrL fermentation broth is concentrated, a concentrated sample is taken for HR-MS detection, and the sample has two obvious absorption peaks at 390nm, wherein 1 is the absorption peak at 388nm, and 2 is the absorption peak at 389 nm. Ion chromatograms were extracted between MS 654.5-655.5 and 707.5-708.5, respectively.

FIG. 9 is a mass spectrum corresponding to peak 2 in the HR-MS of FIG. 8. Comparing the extracted ion chromatograms by using HR-MS analysis software, wherein the absorption intensity of the peak 2 reaches 2.37E9, the molecular weight is 655.26074, and the chemical structural formula comparison is C ₃₆ H ₃₉ O ₈ N ₄ And Coproporphyrin III (C) ₃₆ H ₃₈ N ₄ O ₈ ) And consistent.

FIG. 10 is a mass spectrum corresponding to peak 1 in the HR-MS of FIG. 8. Comparing the extracted ion chromatograms by using HR-MS analysis software, wherein the absorption intensity of peak 1 reaches 2.99E8, the molecular weight is 708.17133, and the chemical structural formula comparison is C ₃₆ H ₃₆ O ₈ N ₄ Fe, fe-Coproporphyrin III (C) ₃₆ H ₃₆ FeN ₄ O ₈ ) And consistent.

Fig. 11 shows HPLC retention time comparison results of heme standard with RSI-ahbD whole cell extract.

Fig. 12A and 12B show the ion extraction peak of the heme standard and the ion extraction peak of RSI-ahbD, respectively.

Detailed Description

The present invention will be described in detail hereinafter.

In vivo, the heme synthesis pathway starts with 5-aminolevulinic acid (5-aminolevulinic acid, ALA) (see FIG. 1), which is catalyzed by glutamyl t-RNA synthetase (HemA, encoded by hemA) with glycine and succinyl COA as substrates. ALA is a key precursor to the heme synthesis pathway. ALA generates porphobilinogen under the catalysis of ALA dehydratase (hemB, encoded by gene hemB), then generates hydroxymethyl bilinogen under the action of hydroxymethyl bilinogen synthase (hemC, encoded by gene hemC), generates tetrapyrrole ring-containing uroporphyrinogen III under the catalysis of uroporphyrinogen III synthase (hemD, encoded by gene hemD), generates protoporphyrinogen IX under the catalysis of uroporphyrinogen III decarboxylase (hemE, encoded by gene hemE) and coproporphyrinogen III oxidase (hemF, encoded by gene hemF; under anaerobic condition, hemN, encoded by gene hemN), generates protoporphyrinogen IX under the catalysis of respiratory chain coenzyme Q-coupled protoporphyrinogen oxidase (hemG, encoded by gene hemG); protoporphyrin IX chelates iron ions into the protoporphyrin ring to form heme under the action of a ferrous chelate enzyme (hemH, encoded by the gene hemH).

It can be seen that the regulation mechanism of the heme synthesis pathway in organisms is complex, and that the transcriptional expression of both the gene hemA, hemB, hemC, hemE, hemN, hemH and bchE (encoding anaerobic magnesium-protoporphyrin IX monomethyl cyclase, anaerobic magnesium-protoporphyrin IX monomethyl ester cyclase for chlorophyll production from protoporphyrin IX) involved in this pathway is comprehensively regulated by the regulator FnrL (also known as transcription factor FnrL or global regulator FnrL), of which hemN and bchE are two key points of regulation.

The inventors have found that when the regulatory capacity of the regulator FnrL in a host cell is reduced, porphyrin compounds can be accumulated in the host cell; further introduction of heme synthase allows the host cell to directly produce heme, thereby obtaining recombinant bacteria capable of directly producing porphyrins (especially heme). Surprisingly, the recombinant bacteria of the present invention secrete the resulting porphyrin-like compounds (e.g., heme) out of the cell.

Without being limited by any theory, the inventor finds that the down-regulation of the expression of the global regulatory factor FnrL leads to the limitation of the expression of HemN, the blockage of the original passage, the catalytic generation of coproporphyrinogen III by coproporphyrinogen oxidase (hemY, encoded by gene hemY), and the chelation of iron ions into coproporphyrin III by ferrochelatase (hemH, encoded by gene hemH) to generate Fe-coproporphyrin III; further, fe-coproporphyrin III was decarboxylated by exogenously introduced heme synthase (AhbD) to heme (FIG. 1).

Thus, in one aspect, the invention provides recombinant bacteria for the production of porphyrins, which have a regulator FnrL with reduced regulatory capacity compared to the starting strain, and which have an introduced expression cassette encoding a heme synthase.

In the present invention, the term "porphyrin-based compound" used herein refers to a class of macromolecular heterocyclic compounds formed by interconnecting α -carbon atoms of four pyrrole subunits via a methine bridge (=ch-). The parent compound is porphine, and the porphine with substituent is called porphyrin. Porphyrin exists in nature in a form that coordinates with metal ions, such as iron, to produce heme. In some embodiments of the invention, the porphyrin-like compounds are primarily endogenous porphyrin-like compounds in the organism, e.g., porphyrin-like compounds involved in the heme synthesis pathway (e.g., uroporphyrinogen III, coproporphyrinogen III, protoporphyrinogen IX, protoporphyrin IX, coproporphyrin III, fe-coproporphyrin III, heme). For example, in purple non-sulfur bacteria, the porphyrin-like compounds include uroporphyrinogen III, coproporphyrinogen III, protoporphyrinogen IX, protoporphyrin IX, coproporphyrin III, fe-coproporphyrin III, heme. In some preferred embodiments, the porphyrin-based compounds are porphyrin compounds related to heme synthesis, including heme, coproporphyrin III, and Fe-coproporphyrin III.

In the present invention, the starting strain is selected from strains (e.g., bacterial strains) having a tetrapyrrole compound synthesis pathway and having a regulator FnrL or a regulator having a similar function to FnrL. In some embodiments of the invention, the starting strain may be selected from photosynthetic bacteria, paracoccus denitrificans, bacillus subtilis, agrobacterium tumefaciens, rhizobium mesorhizogenes, methanobacterium barker. Preferably, the photosynthetic bacteria are selected from the group consisting of purple sulfur photosynthetic bacteria and purple non-sulfur photosynthetic bacteria. For example, the purple sulfur bacteria may be selected from the group consisting of a sulfur pod (thiocapsule) and a chromogenic bacteria (Chromatinum). For example, the purple non-sulfur bacteria may be selected from Rhodospirillum (Rhodospirillum) and Rhodobacter (Rhodobacter). For example, the photosynthetic bacteria are selected from rhodobacter sphaeroides, rhodobacter capsulatus, rhodobacter azotoformans, or rhodobacter gelatinosum. In embodiments of the invention, the starting strain may be a wild-type strain, a genetically engineered strain and/or a chemically mutagenized strain.

In some embodiments of the invention, the starting strain may be a wild-type strain, a genetically engineered strain, and/or a chemically mutagenized strain of a bacterium selected from the group consisting of: photosynthetic bacteria, paracoccus denitrificans, bacillus subtilis, agrobacterium tumefaciens, rhizobium mesorhizobium, and Methanobacterium barker. Preferably, the photosynthetic bacteria are selected from purple non-sulphur photosynthetic bacteria. For example, the photosynthetic bacteria are selected from rhodobacter sphaeroides, rhodobacter capsulatus, rhodobacter azotoformans, or rhodobacter gelatinosum. In a preferred embodiment, the starting strain is selected from the group consisting of purple non-sulfur bacteria, such as rhodobacter sphaeroides.

In the present invention, the regulator FnrL includes the regulator FnrL itself; and modulators capable of overall regulation of genes hemA, hemB, hemC, hemE, hemN, hemH and bchE (particularly hemN and bchE) or genes with equivalent function (e.g., crpK: crp family proteins involved in regulating photosynthesis and maintaining iron homeostasis; crpK and FnrL have similar DNA binding determinants; saheed Imam et al Global Analysis of Photosynthesis Transcriptional Regulatory Networks, 12 months 2014,

volume

10, 12, e 1004837).

In some embodiments, the starting strain is a wild-type strain, a genetically engineered strain, and/or a chemically mutagenized strain of rhodobacter sphaeroides. In the case where the starting strain is rhodobacter sphaeroides, the regulator FnrL has the amino acid sequence as set forth in SEQ ID NO:1, and a polypeptide comprising the amino acid sequence of 1.

In a specific embodiment, the recombinant bacterium of the invention comprises a regulator FnrL having a modification comprising substitution, insertion and/or deletion of one or more amino acid residues in the amino acid sequence of the regulator FnrL, compared to the starting strain, such that the regulatory capacity or the expression level of the regulator FnrL is reduced.

In some embodiments, the recombinant bacterium has a deletion of a portion or all of the amino acid residues of the regulator FnrL, e.g., 1% -100% of the amino acid residues, e.g., 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97%, 99% or more or 100% of the amino acid residues (i.e., in the absence of the regulator FnrL) as compared to the starting strain; alternatively, a deletion of 1 or more amino acids, for example, a deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 60, 70, 80, 100, 200 or more or all amino acid residues. In further embodiments, the recombinant strain has one or more amino acid substitutions or insertions that reduce the regulatory capacity of FnrL compared to the original strain.

In a specific embodiment, the recombinant bacterium of the present invention comprises an fnrL gene having a modification comprising substitution, insertion and/or deletion of one or more bases in the nucleotide sequence of the fnrL gene, as compared to the starting strain, such that the regulatory capacity or expression level of the regulator fnrL is reduced.

In some embodiments, the recombinant bacterium has a deletion of a portion or all of the bases of the fnrL gene, e.g., a deletion of 1% -100% of the bases, e.g., a deletion of 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97%, 99% or more or 100% of the bases (i.e., in the absence of the fnrL gene) compared to the starting strain; alternatively, a deletion of 1 or more bases, for example, a deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 60, 70 or more or all bases. In further embodiments, the recombinant strain has one or more base substitutions or insertions that reduce the regulatory capacity of FnrL compared to the initial strain.

In a specific embodiment, the recombinant bacterium of the present invention comprises an element that modulates fnrL gene expression with a modification comprising substitution, insertion and/or deletion of one or more bases in the regulatory element of fnrL gene expression, as compared to the starting strain, such that the regulatory capacity or expression level of the regulator fnrL is reduced.

In some embodiments, the recombinant strain has a complete knockout of the gene encoding the regulator FnrL (the FnrL gene) compared to the starting strain. In one embodiment, where the recombinant bacterium is rhodobacter sphaeroides, the recombinant bacterium has a nucleotide sequence encoding a nucleotide sequence represented by SEQ ID NO:1 (e.g., a polynucleotide sequence set forth in SEQ ID NO: 2). In some embodiments of the invention, the recombinant bacterium may have a knockout of one allele of the gene encoding the regulator FnrL as compared to the starting strain. In the present invention, a recombinant bacterium having one allele of the regulator FnrL knocked out may be referred to as a heterozygous recombinant bacterium, and correspondingly, a recombinant bacterium having two allele of the regulator FnrL knocked out may be referred to as a homozygous recombinant bacterium.

In some embodiments of the invention, the recombinant bacterium has a reduced level of regulator FnrL-modulating capacity compared to the starting strain. In the present invention, the regulatory capacity of the regulator FnrL in the recombinant strain is reduced compared to the regulatory capacity of the regulator FnrL in the starting strain. In some embodiments, the regulatory capacity of the regulator FnrL in the recombinant strain is reduced by at least 10%, such as by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including a reduction of 100% (e.g., relative to the lack level of the starting strain), or by any amount between 10% and 100% relative to the level of the starting strain, as compared to the regulatory capacity of the regulator FnrL in the starting strain.

In some embodiments of the invention, the recombinant strain has a reduced level of expression of the regulator FnrL compared to the starting strain. In the present invention, the expression level of the regulator FnrL in the recombinant strain is reduced compared to the expression level of the regulator FnrL in the starting strain. In some embodiments, the expression level of the regulator FnrL in the recombinant strain is reduced by at least 10%, such as by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including a reduction of 100% (e.g., relative to the absence level of the starting strain), or by any amount between 10% and 100% relative to the level of the starting strain, as compared to the expression level of the regulator FnrL in the starting strain.

Heme synthase AhbD belongs to the SAM radical enzyme family, comprising two [4Fe-4S ] clusters. In the heme biosynthetic pathway that occurs in sulfate-reducing bacteria and archaea, ahbD catalyzes the oxidative decarboxylation of the two propionic acid side chains at C3 and C8 positions on Fe-coproporphyrin iii to the corresponding vinyl groups of heme.

In some embodiments, the expression cassette encoding AhbD is a nucleic acid element capable of expressing the protein of interest AhbD in a host cell (i.e., a recombinant or starting strain in the present invention). In particular, the expression cassette encoding AhbD comprises a polynucleotide sequence encoding AhbD. In some embodiments, the AhbD may be naturally expressed AhbD, synthetic AhbD, or the like. For example, the AhbD may be derived from Methanosarcina barkeri Fusaro (NCBI number: mba-A1458, which has the amino acid sequence shown by SEQ ID NO:3, e.g., may be encoded by the polynucleotide sequence shown by SEQ ID NO: 4).

According to a particularly preferred embodiment of the invention, the coding sequence of the wild-type AhbD may be replaced by a polynucleotide sequence consisting of preferred codons of the host cell in order to increase the expression efficiency in the host cell.

According to a preferred embodiment of the invention, in the case where the recombinant bacterium is rhodobacter sphaeroides, the coding sequence of the wild-type AhbD (SEQ ID NO: 4) is replaced by a polynucleotide sequence consisting of the rhodobacter sphaeroides preferred codons (SEQ ID NO: 5).

The nucleotide sequence is not limited to these polynucleotide sequences as long as it encodes a polypeptide having AhbD enzyme activity.

According to another preferred embodiment of the present invention, the polynucleotide sequence encoding AhbD may be the following: and the sequence shown in SEQ ID NO:4 or SEQ ID NO:5 and a heme synthase coding sequence which hybridizes under stringent conditions and has the desired activity described above. Here, stringent conditions refer to conditions under which so-called specific hybridization is formed without formation of nonspecific hybridization. Although the conditions differ depending on the nucleotide sequence or the length thereof, examples thereof include conditions under which nucleic acid sequences having high homology (for example, having homology of not less than 75%, preferably homology of not less than 90%, further preferably homology of not less than 95%, most preferably homology of not less than 98%) hybridize to each other, while nucleic acid sequences having homology of less than the above-mentioned standards do not hybridize; or hybridization conditions (60 ℃ C. And 1 XSSC, 0.1% SDS, preferably 0.1 XSSC and a salt concentration equivalent to 0.1% SDS) of usual conditions for rinsing in Southern hybridization.

The expression cassette of AhbD further comprises a promoter and a terminator. The choice of the promoter and terminator is not limited, so long as it is capable of initiating and terminating transcription of the polynucleotide sequence of interest in the host cell. In a preferred embodiment, the promoter and terminator are promoters and terminators capable of functioning in rhodobacter sphaeroides.

In embodiments of the invention, the polynucleotide encoding AhbD may be in an expression vector. In some embodiments, the expression vector may be a commercially available expression vector. Regarding the choice of expression vector, one skilled in the art can easily determine according to the type of host.

The expression cassette expressing AhbD may be integrated into the genome of the host cell or in an episomal plasmid. In the present invention, the expression cassette encoding AhbD is preferably in an episomal plasmid.

In the present invention, the recombinant bacterium has an increased level of AhbD enzyme activity compared to the starting strain. In a preferred embodiment, the starting strain does not have heme synthase AhbD.

In a second aspect of the present invention, there is provided a method of preparing a recombinant bacterium as described above, the method comprising: the regulatory capacity of a regulator FnrL in a starting strain is reduced, and a heme synthase AhbD expression cassette is introduced into the starting strain, so that the recombinant bacterium disclosed by the invention is obtained.

In the method of the present invention, the above steps may be performed in any order, for example, the above two steps may be performed simultaneously. For example, the method of the present invention may comprise: introducing a heme synthase AhbD expression cassette into the starting strain; then the regulatory capacity of the regulator FnrL is reduced, so that the recombinant bacterium is obtained. For example, the method of the present invention may comprise: the recombinant bacterium disclosed by the invention is obtained by introducing a heme synthase AhbD expression cassette into a starting strain and reducing the regulatory capability of a regulator FnrL in the starting strain.

In the methods of the invention, any method known to those of skill in the art may be used to reduce the regulatory capacity of the regulator FnrL or to reduce the expression level of the regulator FnrL (including complete or partial knockout of the FnrL gene encoding FnrL). Such methods include, but are not limited to: homologous recombination, CRISPR/Cas systems, site-directed mutagenesis or RNA interference (RNAi).

In one embodiment, the method of the present invention comprises: the fnrL gene in the original strain is completely knocked out, and the expression cassette for encoding heme synthase AhbD is introduced, so that the recombinant strain is obtained. The species of the starting strain are as described above.

In some embodiments, the fnrL gene in the starting strain is knocked out by homologous recombination.

In the case where the recombinant bacterium is rhodobacter sphaeroides, as an example of homologous recombination, a method of double-bacterium combined transfer can be employed. Among them, E.coli and the like can be used as donor bacteria.

Techniques for introducing an expression cassette encoding AhbD are known to those skilled in the art. For example, the introduction may be performed by an electrotransformation method. In a preferred embodiment, the polynucleotide encoding heme synthase AhbD may be operably linked to an expression vector, which is then introduced into the starting strain or the strain from which the fnrL gene has been knocked out. The expression vector may be selected according to the type of recombinant bacterium, for example, commercially available expression vectors may be selected. For example, for rhodobacter sphaeroides, the PUC57 vector, the pBBR vector, the pIND4 vector may be used.

In some embodiments, markers may be used to screen and/or select positive strains in each step. The term "marker" as used herein refers to a reporter gene, a positive selection marker and a negative selection marker. A reporter gene refers to any molecule whose expression in a cell produces a detectable signal (e.g., a detectable signal, e.g., luminescence). Exemplary labels are disclosed, for example, in the following: sambrook, j. Et al, (2001) Molecular Cloning: a Lbaroratory Manual, second edition (2001), cold Spring Harbor Laboratory Press, cold Spring Harbor, n.y.; and U.S. Pat. nos. 5,464,764 and 5,625,048. Various procedures for selecting and detecting markers are known in the art, see, e.g., joyner, a.l. (2000) Gene Targeting: a Practical Approach, second edition, oxford University Press, new York, N.Y. The terms "selectable marker" and "positive selectable marker" as used herein refer to a molecule whose expression enables a cell to contain a gene to be identified, such as an antibiotic resistance gene and a detectable (e.g., fluorescent) molecule. In some embodiments of the invention, the gene encoding the product is such that under some conditions only cells carrying the gene are able to survive and/or grow. For example, strains expressing the introduced ampicillin resistance gene, neomycin resistance (Neor) gene are resistant to the corresponding compounds. Whereas cells not carrying the resistance gene marker are killed by the corresponding compound. Other positive selection markers are known to, or within the purview of, those skilled in the art. "negative selection marker" refers to a gene whose expression inhibits a cell containing the gene to be identified.

In a third aspect of the invention, the invention provides a process for the production of porphyrins, in particular heme, which comprises fermenting the recombinant bacterium of the invention, thereby obtaining the porphyrins.

In one embodiment, the porphyrin-based compound is one or more of uroporphyrinogen III, coproporphyrinogen III, protoporphyrinogen IX, protoporphyrin IX, coproporphyrin III, fe-coproporphyrin III, or heme; preferably one or more of coproporphyrin III, fe-coproporphyrin III and heme.

Regarding fermentation of recombinant bacteria, a person skilled in the art can perform fermentation by fermentation methods conventional in the art depending on the type of host bacteria.

In one embodiment, for a recombinant bacterium in which the starting strain is rhodobacter sphaeroides, the fermentation conditions are: 28-32 ℃, 180-220 rpm; the fermentation time is the carbon source in the medium is depleted. The fermentation medium may be a fermentation medium commonly used in the art. In one embodiment, the fermentation medium may comprise ammonium sulfate, monosodium glutamate, corn steep liquor, glucose, potassium dihydrogen phosphate, sodium chloride, ferrous sulfate, magnesium sulfate, calcium chloride, manganese sulfate, choline chloride, and calcium carbonate.

As the seed liquid, a secondary culture method, that is, culturing at 28-32℃for 6-8 days on a primary seed plate, inoculating to a secondary seed liquid medium, and culturing at 28-32℃at 180rpm-220rpm for 18-48h with an OD of 5-10, can be used. The primary seed medium and the secondary seed medium may be seed media commonly used in the art.

Definitions of terms commonly used in cell biology and molecular biology can be found in the following works: the Encyclopedia of Molecular Biology, blackwell Science Ltd. Published 1994 (ISBN 0-632-02182-9); benjamin Lewis, genes X, published by Jones & Bartlett publishing, 2009 (ISBN-10:0763766321); kendrew et al (ed.), molecularBiology and Biotechnology: a Comprehensive Desk Reference, VCHPublismers, inc. published 1995 (ISBN 1-56081-569-8); and Current Protocols in Protein Sciences 2009,Wiley Intersciences,Coligan, et al.

Examples

The invention is further illustrated by the following examples, which should not be construed as further limiting the invention.

Reagents and standards used in the examples were purchased from Sigma.

EXAMPLE 1 rhodobacter sphaeroides 2.4.1fnrL ^- Construction of mutant (RSI- ΔfnrL)

1. Construction of recombinant plasmid pK18mobsacB-fnrL

Amplifying the left and right homology arms of the fnrL gene (SEQ ID NO: 2) with the genomic DNA of rhodobacter sphaeroides 2.4.1 (ATCC BAA-808) as a template, wherein the sequence of the left homology arm is the nucleic acid sequence shown in SEQ ID NO:6, and the sequence of the right homology arm is the nucleic acid sequence shown in SEQ ID NO: 7; amplification of amp using pBBR-amp plasmid (purchased from adedge) as template ^R The resistance fragment (SEQ ID NO: 8) was used as a screening marker. Amplification primers of the homologous arms of the fnrL gene and amplification primers of the resistance selection marker gene are shown in Table 1, and PCR amplification conditions are as follows. The pK18mobsacB suicide plasmid (purchased from addgene) was double digested with EcoRI/BamH I and the linearized vector fragment was recovered. The cleavage system is shown below.

The obtained left and right homology arms, the resistance screening marker gene fragment and the linearized vector fragment are subjected to four-fragment ligation at 37 ℃ for 30min according to the steps provided by the Ezmax one-step seamless cloning kit. The ligation product was transferred into E.coli DH10b competent cells, and plated on LB plates with 50. Mu.g/mL ampicillin antibiotics for selection, and positive clones were further selected by colony PCR and sequencing, thereby obtaining recombinant plasmid pK18mobsacB-fnrL.

All of the enzymes were purchased from NEW ENGLAND BioLabs, and the Ezmax one-step seamless cloning kit was purchased from Tuber harbor.

TABLE 1

Primer(s)	Sequence(s)	Numbering device
			Left-F	acagctatga catgattacg gcccgacgat ccggccctga	SEQ ID NO:9
Left-R	tgattaagca ttggaagctt ctgccggtct gaggcgaccc	SEQ ID NO:10
			Right-F	gaaaagatca aaggatcttc gtgcagcgtc atgccgtttt	SEQ ID NO:11
Right-R	cctgcaggtc gactctagag cgagaagtcc gtctcggcat	SEQ ID NO:12
			Amp-F	ccaatgctta atcagtgagg	SEQ ID NO:13
Amp-R	gaagatcctt tgatcttttc	SEQ ID NO:14

2. Rhodobacter sphaeroides 2.4.1fnrL ^- Construction of mutant (RSI- ΔfnrL)

The recombinant plasmid pK18mobsacB-fnrL was introduced into E.coli S17-1 (available from Wohan vast, biotechnology Co., ltd., no. P1454) and coated on an ampicillin-resistant and a carbaryl-resistant LB plate to obtain E.coli harboring pK18 mobsacB-fnrL; the monoclonal is selected and cultured in 5mL of ampicillin-resistant LB liquid medium and carbana-resistant LB liquid medium at 37 ℃ and 220rpm for 16h, and then transferred to 5mL of ampicillin-resistant LB medium according to 10 percent, and cultured until OD700 is between 0.3 and 1.0. Rhodobacter sphaeroides 2.4.1 are cultivated on a seed plate, single colony of rhodobacter sphaeroides 2.4.1 which is 6-7 days long is selected and inoculated in a non-antibiotic TSB culture medium, and the culture is carried out at 30 ℃ and 200rpm until the OD is 0.5-2.0.

2mL of the recombinant plasmid-containing E.coli S17-1 culture (hereinafter also referred to as "donor strain") and 1mL of rhodobacter sphaeroides 2.4.1 culture (hereinafter also referred to as "acceptor strain") were separately collected, centrifuged at 6000rpm for 3min, and the supernatant was discarded; the cells were resuspended in l mL of TSB medium, centrifuged at 6000rpm for 3min, and the supernatant discarded; then, each cell was resuspended with l mL of TSB medium; according to 1: taking donor bacteria and acceptor bacteria according to a volume ratio, uniformly mixing the donor bacteria and the acceptor bacteria to ensure that the total volume is 400 mu L, and spotting the mixed bacterial liquid on a non-antibiotic seed flat plate; culturing for 24h at 30 ℃ in an inverted way, so that the recombinant plasmid is combined and transferred to be led into host bacteria and subjected to homologous recombination; the lawn was scraped off and resuspended in 400 μl each of TSB medium; coating the obtained bacterial liquid on a seed solid culture medium containing ampicillin and nalidixic acid antibiotics; culturing the plate at 30deg.C until the binder grows out; picking out the binder, and performing liquid culture on the binder by using a TSB liquid culture medium added with nalidixic acid and ampicillin antibiotics; 1. Mu.L of bacterial liquid was used for PCR to verify whether the binding agent was single-exchanged or double-exchanged.

If the strain is monoclonal, 200 mu L of bacterial liquid is coated on a seed solid culture medium containing sucrose and ampicillin antibiotics for screening until a double-exchange conjugate is obtained, namely, the strain is used as an amp ^R The resistance marker replaces the binder of the fnrL fragment.

Finally, the double-crossover binder RSI- ΔfnrL (see FIG. 2 and FIG. 3), namely rhodobacter sphaeroides 2.4.1fnrL, was obtained by completely knocking out the fnrL gene ^- A mutant strain.

Wherein the final concentration of the ampicillin is 50 mug/mL and the final concentration of the nalidixic acid is 7.5 mug/mL.

Seed plate medium: 30g of yeast extract (yeast extract), 3g of monopotassium phosphate, 5g of sodium chloride, 1g of ferrous sulfate heptahydrate, 2g of magnesium sulfate heptahydrate, 3mL of manganese sulfate (1%), 1mL of cobalt chloride (1%), 1mL of choline chloride (0.404 g/L), 20g of agar powder, adjusting the pH to 7.0, and adding double distilled water to a total volume of 1L. Sterilizing at 121deg.C under high temperature and humidity for 25min.

TSB medium formulation: tryptone soybean beef extract (tryptone soya broth) 30g/L. Sterilizing at 115deg.C for 20min.

EXAMPLE 2 rhodobacter sphaeroides 2.4.1fnrL ^- Results of fermentation of mutant RSI- ΔfnrL

Picking a plurality of rhodobacter sphaeroides 2.4.1 (as control strain, RSI) and rhodobacter sphaeroides fnrL with good growth condition from seed plate culture medium ^- Mutant strains (6-8 days of growth, full appearance, no white edges and uniform colony size) are respectively inoculated into a secondary seed shake flask culture medium, cultured for 24 hours at 30 ℃ and 200rpm, and when the OD value is about 5-10, fermentation broth is transferred to a tertiary fermentation shake flask culture medium according to 20 percent, and fermented at 30 ℃ and 200rpm until the carbon source in the culture medium is exhausted.

The method for measuring the OD value of the fermentation broth comprises the following steps: adding 500 μl of fermentation broth into EP tube, adding 200 μl of 0.5mol/L HCl, mixing, and removing CaCO in fermentation medium ₃ Water was added to a volume of 10mL and the OD was measured at a wavelength of 600 nm.

The formula of the secondary seed culture medium comprises: yeast extract 8g, ammonium sulfate 7g, monosodium glutamate 3g, corn steep liquor 4g, glucose 5g, dipotassium phosphate 0.5g, potassium dihydrogen phosphate 0.5g, sodium chloride 5g, ferrous sulfate 0.5g, magnesium sulfate 1g, manganese sulfate (1%) 2mL, cobalt chloride (1%) 3mL, choline chloride (0.404 g/L) 3mL, and calcium carbonate 16g. Deionized water was added to a total volume of 1L. Sterilizing at 121deg.C under high temperature and humidity for 30min.

The formula of the three-stage fermentation medium comprises: 6g of ammonium sulfate, 6g of monosodium glutamate, 15g of corn steep liquor powder, 15g of glucose, 2g of monopotassium phosphate, 4g of sodium chloride, 1.16g of ferrous sulfate, 25g of magnesium sulfate, 2g of calcium chloride, 0.15g of manganese sulfate, 3mL of choline chloride (0.404 g/L), 20g of calcium carbonate and deionized water are added to a total volume of 1L. Sterilizing at 121deg.C under high temperature and humidity for 30min.

And detecting the fermentation liquor by a full spectrum scanner, a low-resolution LC-MS and a high-resolution LC-MS respectively.

Taking 1mL of control fermentation liquor and 1mL of experimental fermentation liquor fermented for 48h, centrifuging at 12000rpm for 1min, and taking supernatant, and performing full spectrum scanning by an enzyme-labeled instrument in a 96-well plate (wherein the full spectrum scanner is a Germany BGM CLARIOstar full-functional multifunctional enzyme-labeled instrument). The results are shown in FIG. 4, wherein the upper line represents the RSI- ΔfnrL strain and the lower line represents the control RSI. As can be seen, the RSI-. DELTA.fnrL strain has a distinct absorption peak in the broad spectrum range of 380-390nm, which coincides with the absorption peak of porphyrins.

Respectively taking 50mL of fermentation liquor of a control group and 50mL of fermentation liquor of an experimental group, centrifuging at 9000rpm for 10min, and taking supernatant for rotary evaporation concentration; after the supernatant was spin-evaporated to dryness, a small amount of deionized water was added, the crude extract was eluted from the spin-evaporation flask and transferred to a 10mL centrifuge tube, centrifuged at 4700rpm for 10min, the supernatant was filtered with a 0.22 μm filter membrane, and the filtrate was subjected to low resolution LC-MS detection. The column was Agilent YMC-PacK ODS-A, 250X 4.6mml.D.S-5 μm,12nm.

LC conditions: phase A is H ₂ O+0.1% hcooh; phase B is Methanol

The results of the low resolution LC-MS detection are shown in figure 5. As can be seen from fig. 5, RS Two distinct peaks were present in the fermentation broth of strain I- ΔfnrL, whereas no corresponding peak was always found in the fermentation broth of strain RSI. The corresponding mass spectrum results are shown in fig. 6 and 7. The results of FIG. 6 correspond to the first of the two distinct peaks of FIG. 5, and the mass fraction is 707 determined from the positive and negative ion sources of the mass spectrum, which is compared with the intermediate in the porphyrin pathway to determine that it is Fe-coproporphyrin III (Fe-Coproporphyrin III, C) ₃₆ H ₃₆ FeN ₄ O ₈ ). The results of FIG. 7 correspond to the second of the two distinct peaks of FIG. 5, and the mass fraction of the source peaks was determined to be 654 based on the positive and negative ion of the mass spectrum, which was compared with the intermediate in the porphyrin pathway to determine that it was coproporphyrin III (Coproporphyrin III, C) ₃₆ H ₃₈ N ₄ O ₈ )。

Taking a crude extract sample for low-resolution liquid chromatography-mass spectrometry detection, diluting the crude extract sample by 10 times with methanol, and carrying out high-resolution LC-MS detection.

LC conditions: phase A is H ₂ O+0.1% hcooh; phase B is Methanol

/>

The results are shown in FIG. 8. In FIG. 8, there are two distinct absorption peaks at 390nm, where 1 is the absorption peak at 388nm and 2 is the absorption peak at 389 nm. Ion chromatograms were extracted between MS 654.5-655.5 and 707.5-708.5, respectively. Comparing the extracted ion chromatograms by using HR-MS analysis software, wherein the absorption intensity of the peak 2 reaches 2.37E9, the molecular weight is 655.26074, and the chemical structural formula comparison is C ₃₆ H ₃₉ O ₈ N ₄ Consistent with coproporphyrin III (see fig. 9). Comparing the extracted ion chromatograms by using HR-MS analysis software, wherein the absorption intensity of peak 1 reaches 2.99E8, the molecular weight is 708.17133, and the chemical structural formula comparison is C ₃₆ H ₃₆ O ₈ N ₄ Fe, consistent with Fe-manure porphyrin III (see FIG. 10).

EXAMPLE 3 construction of heme-producing Strain

The AhbD gene Mbar-A1458 (from Methanosarcina barkeri Fusaro) was codon optimized to give the AhbD gene shown in SEQ ID NO. 5 and was artificially synthesized onto a PUC57 vector (supplied by Nanjing Jinsri Biotechnology Co., ltd.). The target fragment was obtained by PCR amplification (see Table 2 for primers), and the fragment was constructed on pBBR vector (purchased from Tu Long Biotechnology Co., ltd.) with EZmax one-step cloning kit to obtain recombinant plasmid. The recombinant plasmid with correct sequencing verification is introduced into rhodobacter sphaeroides strain by an electrotransformation method to obtain strain RSI-ahbD and shake flask fermentation is carried out.

TABLE 2

Primer(s)	Sequence(s)	Numbering device
			AhbD-F	gagctcatgatcgccatgac	SEQ ID NO:15
AhbD-R	cgggcaagaagtgaggatcc	SEQ ID NO:16

The steps of the electrotransformation process are as follows:

1. 2mL of cells (cultured in TSB medium to OD 1-3) were added to each of 2mL of sterile EP tube, and centrifuged at 9000rpm for 1min;2. removing the supernatant, adding 1mL of deionized water, and blowing and uniformly mixing; centrifuging at 3.9000rpm for 1min, pouring out the supernatant, adding 1mL deionized water, blowing and mixing the mixture uniformly at the gun head, and repeating the water washing for three times; 4. the supernatant was decanted, 100. Mu.L of 10% glycerol was added, the cells were resuspended and the plasmid (100 ng) was added and mixed well; 5. taking out the mixed solution, and completely injecting the mixed solution into a 2mm electric rotating cup; 6. electric conversion conditions: 1500V-3000V,200Ω,2mm;7. after the electric transfer is completed, 600 mu L of non-antibiotic TSB culture medium is added, all liquid is taken out after blowing and sucking are carried out uniformly, and the mixture is placed in a 2mL EP tube for incubation at 30 ℃ and 200rpm for 2 hours; 8.12000g are centrifuged for 1min, part of the supernatant is removed, the rest bacterial liquid is evenly mixed and coated on a Kana resistance plate, and the mixture is placed in a 30 ℃ incubator for culture.

Shake flask fermentation culture conditions:

a plurality of wild Rhodobacter Sphaeroides (RSI) and rhodobacter sphaeroides RSI-ahbD (6-8 days of growth, full appearance, no white edge and uniform colony size) with good growth conditions are selected from a seed plate culture medium, inoculated into a secondary seed shake flask culture medium, cultured for 24 hours at 30 ℃ and 200rpm, and when the OD value is about 5-10, a fermentation broth is transferred to a tertiary fermentation shake flask culture medium according to 20%, and fermented at 30 ℃ and 200rpm until carbon in the culture medium is consumed.

The medium formulation was as described in example 2.

Taking 2mL of fermentation broth, centrifuging at 12000rpm for 1min, removing supernatant, washing the thalli three times by using PBS buffer, pre-freezing the thalli at-80 ℃, and freeze-drying the thalli in a freeze dryer (LABCONCO freeze dryer is purchased from Beijing Zhaosheng Instrument and device Co.). 1mL DMSO and a proper amount of steel balls and magnetic beads are added into the dry bacterial powder, and then bacterial cell disruption is carried out in a full-automatic sample freezing grinder (purchased from Shanghai Xingzhi industry development Co., ltd.). Centrifuging at 12000rpm in 1min, collecting supernatant, adding 1mL DMSO into crushed thallus, shaking thoroughly, mixing at 12000rpm, centrifuging at 1min, collecting supernatant, and extracting with DMSO three times. The extract was filtered through a 0.22 μm filter and then subjected to LC-MS detection. The detection conditions were as described in example 2. Experimental results indicate that heme is obtained from RSI-ahbD fermentative production (see FIGS. 11-12).

In addition, heme was also detected in the broth supernatant of RSI-ahbD by the same detection method, i.e., the recombinant bacterium of the present invention can be excreted to produce heme.

Sequence listing

<110> university of Industy of Huadong

<120> recombinant bacterium for producing porphyrin-like compound and method for producing porphyrin-like compound

<130> SHIC198037

<160> 16

<170> PatentIn version 3.5

<210> 1

<211> 248

<212> PRT

<213> rhodobacter sphaeroides (Rhodobacter sphaeroides)

<400> 1

Met Thr Leu His Glu Val Pro Thr Ile Leu His Arg Cys Gly Asp Cys

1 5 10 15

Pro Ile Arg His Arg Ala Val Cys Ala Arg Cys Asp Ser Glu Glu Leu

20 25 30

Ala Thr Leu Glu Gln Ile Lys Tyr Tyr Arg Ser Tyr Gln Ala Gly Gln

35 40 45

Thr Val Ile Trp Ser Gly Asp Lys Met Asp Phe Val Ala Ser Val Val

50 55 60

Thr Gly Ile Ala Thr Leu Thr Gln Thr Met Glu Asp Gly Arg Arg Gln

65 70 75 80

Met Val Gly Leu Leu Leu Pro Ser Asp Phe Val Gly Arg Pro Gly Arg

85 90 95

Gln Thr Val Ala Tyr Asp Val Thr Ala Thr Thr Asp Leu Leu Met Cys

100 105 110

Cys Phe Arg Arg Lys Pro Phe Glu Glu Met Met Gln Lys Thr Pro His

115 120 125

Val Gly Gln Arg Leu Leu Glu Met Thr Leu Asp Glu Leu Asp Ala Ala

130 135 140

Arg Glu Trp Met Leu Leu Leu Gly Arg Lys Thr Ala Arg Glu Lys Ile

145 150 155 160

Ala Ser Leu Leu Ala Ile Ile Ala Arg Arg Asp Ala Ala Leu Lys Leu

165 170 175

Arg Glu Ser Asn Gly Pro Met Thr Phe Asp Leu Pro Leu Thr Arg Glu

180 185 190

Glu Met Ala Asp Tyr Leu Gly Leu Thr Leu Glu Thr Val Ser Arg Gln

195 200 205

Val Ser Ala Leu Lys Arg Asp Gly Val Ile Ala Leu Glu Gly Lys Arg

210 215 220

His Val Ile Val Thr Asp Phe Ala Arg Leu Leu Glu Glu Ala Gly Asp

225 230 235 240

Asp Ser Asp Gly Gly Leu Pro Val

245

<210> 2

<211> 747

<212> DNA

<213> rhodobacter sphaeroides (Rhodobacter sphaeroides)

<400> 2

atgacgctgc acgaagtccc aaccatcctt caccgctgcg gcgactgccc gatccgtcat 60

cgtgccgtct gcgcacgctg tgactccgaa gaactcgcga cgctcgagca gatcaagtat 120

taccgcagct atcaggccgg tcagaccgtg atctggtcgg gcgacaagat ggatttcgtg 180

gcgtcggtcg tcaccggcat cgcgacgctg acccagacga tggaggacgg ccgccggcag 240

atggtgggcc ttctgctgcc ttcggatttc gtgggccgtc ccggccggca gaccgtggcc 300

tatgacgtga ccgccacgac cgacctgctg atgtgctgct tccggcgcaa gcccttcgag 360

gaaatgatgc agaagacgcc ccatgtgggg cagcgcctgc tggagatgac gctcgacgag 420

ctcgatgccg cgcgcgaatg gatgctgctc ctgggacgca agacggcgcg cgagaagatc 480

gcgagcctgc ttgcgatcat cgcccggcgc gacgcggcgc tgaagctgcg cgagtcgaac 540

ggacccatga ccttcgacct gccgctcacg cgcgaggaga tggcggatta cctcggcctg 600

acgctcgaga ccgtgagccg tcaggtctcg gcgctgaagc gggacggggt gatcgcgctc 660

gaaggcaagc ggcatgtgat cgtgacagac ttcgcccgtc tgctcgaaga ggccggcgac 720

gacagcgacg gcggtctgcc ggtctga 747

<210> 3

<211> 349

<212> PRT

<213> Methanosarcina barkeri Fusaro

<400> 3

Met Ile Ala Met Thr Asn Ala Pro Arg Leu Ile Ala Trp Glu Leu Thr

1 5 10 15

Ala Gly Cys Asn Leu Asn Cys Val His Cys Arg Gly Ala Ser Thr Ser

20 25 30

Ser Val Pro Ala Gly Glu Leu Thr Thr Asp Glu Ala Lys His Phe Ile

35 40 45

Asp Glu Val Ala Ser Ile Gly Lys Pro Ile Leu Ile Leu Ser Gly Gly

50 55 60

Glu Pro Leu Thr Arg Pro Asp Val Phe Glu Ile Ala Arg Tyr Gly Thr

65 70 75 80

Asp Ala Gly Leu Arg Val Val Leu Ala Thr Asn Gly Thr Leu Leu Thr

85 90 95

Pro Glu Ile Val Glu Lys Leu Arg Ala Ala Gly Val Gln Arg Leu Ser

100 105 110

Val Ser Ile Asp Gly Ala Asn Ala Glu Thr His Asp Asn Phe Arg Gly

115 120 125

Met Pro Gly Ala Phe Glu Arg Thr Leu Ala Gly Ile Glu Val Leu Arg

130 135 140

Lys Ala Asp Phe Pro Phe Gln Ile Asn Thr Thr Val Ser Lys Arg Asn

145 150 155 160

Leu Glu Glu Ile Thr Lys Thr Phe Glu Leu Ala Lys Glu Leu Gly Ala

165 170 175

Val Ala Tyr His Val Phe Phe Leu Val Pro Thr Gly Arg Gly Asp Glu

180 185 190

Ser Asp Glu Val Ser Pro Ala Asp Tyr Glu Arg Ile Leu His Trp Phe

195 200 205

Tyr Glu Met Gln Lys Glu Ser Lys Ile Gln Leu Lys Ala Thr Cys Ala

210 215 220

Pro His Tyr Phe Arg Ile Met Arg Gln Gln Ala Lys Lys Glu Gly Ile

225 230 235 240

Glu Ile Ser Val Lys Thr His Gly Tyr Glu Ala Met Thr Lys Gly Cys

245 250 255

Leu Gly Gly Thr Gly Phe Cys Phe Val Ser Ser Val Gly Lys Val Phe

260 265 270

Pro Cys Gly Tyr Leu Pro Val Leu Ala Gly Asn Ile Arg Glu Gln Pro

275 280 285

Phe Arg Glu Ile Trp Glu Asn Ala Glu Val Phe Arg Lys Leu Arg Asp

290 295 300

Pro Glu Glu Leu Lys Gly Lys Cys Gly Ile Cys Glu Tyr Lys Lys Val

305 310 315 320

Cys Ala Gly Cys Arg Ala Arg Ala Tyr Ala Ala Thr Gly Asp Tyr Leu

325 330 335

Glu Glu Glu Pro Tyr Cys Ile Tyr Arg Pro Gly Lys Lys

340 345

<210> 4

<211> 1050

<212> DNA

<213> Methanosarcina barkeri Fusaro

<400> 4

atgatcgcca tgacaaatgc accaaggctt atcgcatggg aactgactgc aggatgcaac 60

ctgaactgcg tacactgtag gggagcttcc acttcatcgg ttccggcagg tgaacttaca 120

actgatgagg ctaaacactt cattgacgaa gttgcaagta ttggaaaacc cattcttata 180

ctgagcggag gcgagcctct gaccaggcct gacgtttttg aaatcgcacg ttacggtact 240

gatgctgggc ttcgagtcgt acttgcaaca aacgggactc ttcttacgcc tgaaattgtt 300

gagaaattaa gagctgctgg agtgcaaagg ctcagcgtta gtattgatgg agcaaacgca 360

gagacacacg acaatttcag aggcatgccc ggggcttttg aaagaacact tgcaggcatt 420

gaagtcctca ggaaagccga ttttcctttt cagatcaata ccacggtctc aaaacgcaac 480

cttgaggaaa tcactaagac ttttgagctt gcaaaagagc ttggtgcagt tgcatatcat 540

gtctttttcc ttgtgcccac aggcagggga gacgaatccg atgaggtttc ccctgcagac 600

tacgagcgca ttctacactg gttttatgaa atgcaaaaag aatcaaaaat ccagttgaaa 660

gcaacctgtg ctccccacta tttcaggata atgcgccagc aagcaaaaaa agaaggaatt 720

gagatatcgg ttaaaaccca cggctatgaa gcaatgacaa aaggctgcct cggaggtaca 780

ggcttctgtt ttgtatcaag tgtgggtaaa gtcttccctt gcggctacct tccagttctt 840

gccggaaaca taagggaaca gcctttcagg gagatctggg aaaacgccga ggtcttcagg 900

aaactgagag accccgaaga gcttaaagga aagtgcggga tatgtgaata caaaaaagtc 960

tgtgcaggct gcagggcaag agcctatgct gctacaggcg actatctcga agaagagcct 1020

tactgcatat acaggcccgg aaaaaagtga 1050

<210> 5

<211> 1050

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

atgatcgcca tgaccaacgc cccgcgcctc atcgcctggg agctgaccgc gggctgcaac 60

ctgaactgcg tgcattgccg cggcgcctcg acctcgtcgg tgccggccgg cgagctgacg 120

accgacgagg ccaagcactt catcgacgag gtggcctcga tcggcaagcc gatcctgatc 180

ctctcgggcg gcgagccgct cacccgcccc gacgtgttcg agatcgcccg ctatggcacc 240

gacgccggcc tgcgcgtggt gctggccacc aacggcacgc tgctcacccc ggagatcgtg 300

gagaagctgc gcgccgcggg cgtgcagcgc ctgtcggtgt cgatcgacgg cgccaacgcg 360

gagacccatg acaacttccg cggcatgccg ggcgccttcg agcgcacgct ggccggcatc 420

gaggtgctcc gcaaggcgga cttcccgttc cagatcaaca ccacggtgtc gaagcgcaac 480

ctggaggaga tcaccaagac cttcgagctg gcgaaggagc tgggcgcggt ggcctatcat 540

gtgttcttcc tcgtgccgac cggccgcggc gacgagtcgg acgaggtgtc gccggccgac 600

tatgagcgca tcctgcattg gttctacgag atgcagaagg agtcgaagat ccagctgaag 660

gcgacctgcg ccccgcacta tttccgcatc atgcgccagc aggccaagaa ggagggcatc 720

gagatctcgg tgaagaccca tggctatgag gcgatgacga agggctgcct gggcggcacc 780

ggcttctgct tcgtgtcgtc ggtgggcaag gtgttcccgt gcggctatct cccggtgctg 840

gccggcaaca tccgcgagca gcccttccgc gagatctggg agaacgccga ggtgttccgc 900

aagctccgcg acccggagga gctgaagggc aagtgcggca tctgcgagta caagaaggtg 960

tgcgccggct gccgcgcgcg cgcctatgcg gccacgggcg actatctgga ggaggagccg 1020

tactgcatct atcgcccggg caagaagtga 1050

<210> 6

<211> 500

<212> DNA

<213> rhodobacter sphaeroides (Rhodobacter sphaeroides)

<400> 6

gcccgacgat ccggccctga gcgagcggtt cggccaccgg atcgtcatcg cctgggacca 60

gagccgcgag gcgctgacgg cggtgcgcaa ggccatgccg ttccttctgc gcgccgacaa 120

tgtggacatc gtgatcgtcg atcccgcggc ccatggcgcc gaacggtcgg atccgggcgg 180

cgcgctctgc cagatgctcg tgcgccacgg ggtccgggcc gaggtttcgg tgctggccaa 240

gacgatgccg cgcatttccg acgtgatcgc gcgccatgtg cgcgatcagg atgccgatct 300

tctggtgatg ggtgcctacg gccattcccg cttccgcgag gcgatcctcg gcggggccac 360

gcgggacatg ctcgaactgg cggaagtacc cgtcctgatg gcgcactgac ggaagaaggg 420

gctgcctctg cccgcctcgc aaggggcggg ccttttcaag ccggccgggg cgggaccggc 480

gggtcgcctc agaccggcag 500

<210> 7

<211> 500

<212> DNA

<213> rhodobacter sphaeroides (Rhodobacter sphaeroides)

<400> 7

gtgcagcgtc atgccgtttt ccccgcttga tctgaatcaa agcaatagac gactttcacg 60

cctagcgaaa gccgatggcg gccgtttctc atcttgcaaa actcgggcta tttgacgcgc 120

gggttccacg ctacacgagc tacccgacgg cgccgaactt cggtgtcggg gtaaccgaga 180

acctccatgc ggactggatc tcgtccattc ctgcgggagg ttcaatatca ttatacctcc 240

atgtcccttt ctgtcgcagg ctctgctggt tctgcgcctg ccgcactcag gggacgagtt 300

cggacgcccc cgtgcgcgct tatgccgcag ccctcaaatc cgagctcgcg ctcctgcggg 360

cgcggctcgc tccgggcgtg cgactggcgc ggatgcactg gggcgggggc acgcccacgc 420

tcctgccgcc cacgctgatc catgagctgg ctctggcgat ccgcgatgcg gtgccgtccg 480

atgccgagac ggacttctcg 500

<210> 8

<211> 985

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> ampR resistant fragment

<400> 8

gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa 60

gggattttgg tcatgaacaa taaaactgtc tgcttacata aacagtaata caaggggtgt 120

taagcttatg agtattcaac atttccgtgt cgcccttatt cccttttttg cggcattttg 180

ccttcctgtt tttgctcacc cagaaacgct ggtgaaagta aaagatgctg aagatcagtt 240

gggtgcacga gtgggttaca tcgaactgga tctcaacagc ggtaagatcc ttgagagttt 300

tcgccccgaa gaacgttttc caatgatgag cacttttaaa gttctgctat gtggcgcggt 360

attatcccgt gttgacgccg ggcaagagca actcggtcgc cgcatacact attctcagaa 420

tgacttggtt gagtactcac cagtcacaga aaagcatctt acggatggca tgacagtaag 480

agaattatgc agtgctgcca taaccatgag tgataacact gcggccaact tacttctgac 540

aacgatcgga ggaccgaagg agctaaccgc ttttttgcac aacatggggg atcatgtaac 600

tcgccttgat cgttgggaac cggagctgaa tgaagccata ccaaacgacg agcgtgacac 660

cacgatgcct gcagcaatgg caacaacgtt gcgcaaacta ttaactggcg aactacttac 720

tctagcttcc cggcaacaat taatagactg gatggaggcg gataaagttg caggaccact 780

tctgcgctcg gcccttccgg ctggctggtt tattgctgat aaatctggag ccggtgagcg 840

tgggtctcgc ggtatcattg cagcactggg gccagatggt aagccctccc gtatcgtagt 900

tatctacacg acggggagtc aggcaactat ggatgaacga aatagacaga tcgctgagat 960

aggtgcctca ctgattaagc attgg 985

<210> 9

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> Left-F

<400> 9

acagctatga catgattacg gcccgacgat ccggccctga 40

<210> 10

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> Left-F

<400> 10

tgattaagca ttggaagctt ctgccggtct gaggcgaccc 40

<210> 11

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> Right-F

<400> 11

gaaaagatca aaggatcttc gtgcagcgtc atgccgtttt 40

<210> 12

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> Right-R

<400> 12

cctgcaggtc gactctagag cgagaagtcc gtctcggcat 40

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> Amp-F

<400> 13

ccaatgctta atcagtgagg 20

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> Amp-R

<400> 14

gaagatcctt tgatcttttc 20

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> AhbD-F

<400> 15

gagctcatga tcgccatgac 20

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> AhbD-R

<400> 16

cgggcaagaa gtgaggatcc 20

Claims

1. A recombinant bacterium having a reduced expression level of a regulator FnrL compared to a starting strain and having an introduced expression cassette encoding heme synthase AhbD, wherein the starting strain is rhodobacter sphaeroides, wherein the amino acid sequence of the regulator FnrL is as set forth in SEQ ID NO:1, wherein the amino acid sequence of the AhbD is shown as SEQ ID NO: 3.

2. The recombinant bacterium according to claim 1, wherein the starting strain is a wild-type strain, a genetically engineered strain and/or a chemically mutagenized strain.

3. The recombinant bacterium of claim 1, wherein the recombinant bacterium comprises a regulator FnrL having a modification comprising substitution, insertion and/or deletion of one or more amino acid residues in the amino acid sequence of the regulator FnrL such that the expression level of the regulator FnrL is reduced compared to the starting strain.

4. The recombinant bacterium according to claim 3, wherein the recombinant bacterium has a regulator FnrL with a deletion of part or all of the amino acid residues so that the expression level of the regulator FnrL is reduced as compared with the starting strain.

5. The recombinant bacterium according to claim 3, wherein the recombinant bacterium has one or more amino acid substitutions or insertions that reduce the expression level of FnrL compared to the starting strain.

6. The recombinant bacterium of claim 1 or 2, wherein the recombinant bacterium comprises an fnrL gene having a modification comprising substitution, insertion and/or deletion of one or more bases in the nucleotide sequence of the fnrL gene such that the expression level of the regulator fnrL is reduced compared to the starting strain.

7. The recombinant bacterium according to claim 6, wherein the recombinant bacterium has a part or all of the base-deleted fnrL gene so that the expression level of the regulator fnrL is reduced as compared to the starting strain.

8. The recombinant bacterium according to claim 6, wherein the recombinant bacterium has one or more base substitutions or insertions that reduce the expression level of FnrL as compared to the starting strain.

9. The recombinant bacterium of claim 1 or 2, wherein the recombinant bacterium comprises an element that modulates fnrL gene expression with a modification, as compared to the starting strain, comprising substitution, insertion and/or deletion of one or more bases in the regulatory element of fnrL gene expression, such that the expression level of the regulator fnrL is reduced.

10. The recombinant bacterium according to claim 1 or 2, wherein the recombinant bacterium is a recombinant bacterium in which a gene encoding the regulator FnrL has been knocked out.

11. Recombinant bacterium according to claim 1 or 2, wherein the polynucleotide sequence encoding AhbD is codon optimized.

12. Recombinant bacterium according to claim 1 or 2, wherein the expression cassette encoding heme synthase AhbD is integrated into the genome of the host cell or in an episomal plasmid.

13. A method of producing a recombinant bacterium according to any one of claims 1-12, the method comprising: reducing the expression level of a regulator FnrL in a starting strain, and introducing an expression cassette encoding heme synthase AhbD into the starting strain, wherein the starting strain is rhodobacter sphaeroides.

14. The method of claim 13, wherein the gene encoding the regulator FnrL in the starting strain is knocked out, thereby reducing the regulatory capacity of the regulator FnrL in the starting strain.

15. A live bacterial preparation comprising the recombinant bacterium according to any one of claims 1 to 12.

16. Use of the recombinant bacterium of any one of claims 1-12 or the viable bacteria formulation of claim 15 in the preparation of a porphyrin-like compound selected from one or more of coproporphyrin iii, fe-coproporphyrin iii, and heme.