CN112725254B

CN112725254B - L-homoserine production strain and construction method and application thereof

Info

Publication number: CN112725254B
Application number: CN202110031779.3A
Authority: CN
Inventors: 谢新开; 徐伟
Original assignee: Hunan Lier Biotechnology Co ltd
Current assignee: Hunan Lier Biotechnology Co ltd
Priority date: 2017-10-13
Filing date: 2017-10-13
Publication date: 2023-07-11
Anticipated expiration: 2037-10-13
Also published as: WO2019071668A1; CN112725254A; CN109666617A; CN109666617B

Abstract

The invention provides a strain for producing L-homoserine, which is characterized in that: it has a single stable chromosome, does not contain plasmid forms or other episomal DNA vectors, has one or more genes associated with L-threonine synthesis knocked out or weakened on its chromosomal DNA, and/or has been mutated to enhance, and/or has integrated copies of one or more genes associated with the L-homoserine metabolic pathway on its chromosomal DNA.

Description

L-homoserine production strain and construction method and application thereof

The application is a divisional application of an invention patent application with the application date of 2017, 10-13, the application number of 201710953111.8 and the invention name of 'an L-homoserine production strain, a construction method and application'.

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to a production strain of L-homoserine, and a construction method and application thereof.

Background

L-homoserine is a naturally occurring non-protein amino acid and is present in small amounts in many species as an intermediate common to the biosynthesis of threonine, methionine and lysine. Because L-homoserine has a basic skeleton of L-type-alpha amino acid and gamma-hydroxyl has various chemical activities, the L-homoserine and the derivatives thereof have important application prospects in the aspects of pharmacy, physiology and the like as medical intermediates.

At present, the L-homoserine produced at home and abroad mainly comprises the following methods:

(1) A chemical process; the method adopts relatively expensive L-methionine as a raw material, takes methyl iodide or methyl bromide with serious biotoxicity as a methylation reagent, protects amino by nucleophilic attack, and hydrolyzes under the weak alkaline condition to obtain a product. The method has high cost, needs iodide and sulfide generation, and is not friendly to the environment;

(2) Chemical chiral resolution method; the method utilizes the property difference of non-corresponding isomers after the mixed homoserine reacts with chiral reagent, thereby separating L-homoserine. The method has low yield, high reagent cost and large amount of organic solvent, and has great environmental pollution threat.

(3) A biological enzyme catalysis method; the method utilizes pyruvic acid and formaldehyde to produce amino acid homoserine under the combined action of aldolase and L-amino acid dehydrogenase. The method has the main problems of high cost, the need of using toxic raw materials formaldehyde and formic acid, the need of using expensive coenzyme and the like.

(4) A microbial fermentation process; the method has the advantages of low cost, mild condition, less environmental pollution and the like, and has become the first choice process for producing various amino acids in recent years. However, the current L-homoserine fermentation relies on a gene overexpression system using a plasmid as a vector, and has the disadvantage of poor strain passage stability.

Disclosure of Invention

The first technical problem to be solved by the present invention is to provide a stable L-homoserine producing strain.

The second technical problem to be solved by the invention is to provide a genetic engineering method for constructing an L-homoserine producing strain.

Accordingly, the present invention provides a strain producing L-homoserine, characterized in that: it has a single stable chromosome, does not contain plasmid forms or other episomal DNA vectors, has one or more genes associated with L-threonine synthesis knocked out or weakened on its chromosomal DNA, and/or has been mutated to enhance, and/or has integrated copies of one or more genes associated with the L-homoserine metabolic pathway on its chromosomal DNA.

Preferably, the knocked out or weakened gene is thrB and/or thrL; the genes mutated to enhance are thrA and/or rhtA, and the genes of the integrated copy are one or more of thrA, ppc, pntA, pntB, asd, aspA and aspC.

Preferably, the L-homoserine producing strain belongs to the species Escherichia coli.

Further preferably, the strain is E.coli K-12 wild-type MG1655.

The invention also provides a construction method of the L-homoserine production strain, which comprises one or more of the following steps:

A. one or more genes related to the L-homoserine metabolic pathway in the constructed strain are knocked out or weakened;

B. constructing one or more genes related to the L-homoserine metabolic pathway in the strain to be over-expressed or have enhanced functions through point mutation;

C. one or more genes related to the L-homoserine metabolic pathway in the constructed strain are integrated into chromosomal DNA in multiple copies for overexpression.

Preferably, the knocked out or weakened gene in step a is thrB and/or thrL;

the mutated genes in the step B are thrA and/or rhtA;

in step B, thrA and/or rhtA genes are mutated to thrA and/or rthA23 genes, respectively. The mutant thrA has the characteristic of inhibiting feedback inhibition of a product, and the mutant rhtA23 has the effect of increasing the expression quantity;

the genes over-expressed by increasing chromosome copy number described in step C are one or more of thrA, ppc, pntA, pntB, apsA, aspC and asd.

Preferably, the constructed strain described in the above step belongs to the species E.coli.

Further preferably, the strain is E.coli K-12 wild-type MG1655.

The invention also provides application of the L-homoserine producing strain in producing L-homoserine.

Compared with the prior art, the technical scheme provided by the invention has the following advantages:

(1) The invention can realize the purpose of stable and high yield by integrating and expressing multiple copies of specific genes related to the L-homoserine metabolic pathway. Compared with the prior reported mode of over-expression through a plasmid vector, the strain disclosed by the invention has the advantages of good passage stability, stable fermentation result and higher yield.

(2) The L-homoserine production strain constructed by the invention has less byproducts and high sugar acid conversion rate compared with the strain with plasmid form in the fermentation process.

(3) The L-homoserine producing strain does not need antibiotics in the whole fermentation process, and avoids the pollution of the antibiotics to the environment and the possibility of potential resistance genes flowing into the environment.

Detailed Description

In the embodiment, the Escherichia coli MG1655 is adopted to construct an L-homoserine production strain, and the knockout and editing of genes in the Escherichia coli genome are mainly based on Lambda-Red recombination, FLP-FRT recombination and CRISPR/Cas9 technology. Reference may be made to the literature "Lambda Red Recombination One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products", "Proc Natl Acad Sci usa.2000 Jun 6;97 6640-5 and "Development of a fast and easy method for Escherichia coli genome editing with CRISPR/cas9", "Microb Cell face.2016 Dec 1;15 (1):205..

The temperature sensitive plasmid used in the examples has the document Cell face.2016 Dec 1;15 205. DNA sequence structure shown in temperature sensitive plasmid; the original strain, escherichia coli MG1655, was purchased from ATCC; it should be noted that the materials are all commercially available, and products of different manufacturers and different specifications do not affect the implementation of the present invention for the purpose of the present invention. In an embodiment, the arabinose induction conditions are specifically: induced culture at 30℃in LB medium containing 20mM arabinose.

Example 1

Construction of thrB Gene knockout, rhtA Gene overexpression, thrL Gene knockout, mutant thrA Gene enhancement Strain MG1655 (Deltathr B, rhtA23, deltathr L, thrA x (G433R)).

The L-homoserine producing strain constructed in this example is constructed by a strain MG1655 (Deltathr B, rhtA23, deltathr L, thrA) which knocks out thrB gene, overexpresses rhtA gene, knocks out thrL gene and mutates thrA gene, and the construction method is shown in Chinese patent application CN201710106474.8.

Example 2

Construction of genetically engineered strains MG1655 (Deltathr B, rhtA23, deltathr L, thrA (G433R), deltatA:: thrA-ppc-aspA-pntAB) expressing thrA, ppc, aspA, pntA and pntB in single copy on chromosomal DNA.

The L-homoserine production strain constructed in the embodiment is a genetically engineered bacterium MG1655 (DeltathrB, rhtA23, deltathrL, thrA (G433R) which simultaneously integrates and expresses thrA, ppc, aspA, pntA and pntB on chromosome DNA, deltatcadA:: thrA-ppc-aspA-pntAB), and the construction method can refer to the literature of Microb Cell face.2016Dec 1;15 205, specifically comprising the following steps:

(1) The chromosomal DNA of the strain obtained in example 1 was used as a template, and pSOE-thrA-f and pSOE-ppc-thrA-r were used as templates; pSOE-thrA-ppc-f, pSOE-aspA-ppc-r; pSOE-ppc-aspA-f, pSOE-pntA-aspA-r; pSOE-aspA-pntA-f and pntB-r are used as primers, amplified by an overlap extension PCR method (namely SOE-PCR method), and genes thrA, ppc, aspA, pntAB and the like under the corresponding natural promoters in template bacteria are connected to obtain an integrated inserted gene DNA fragment;

wherein the primer pSOE-thrA-f has a sequence shown as SEQ ID No.1, the primer pSOE-ppc-thrA-r has a sequence shown as SEQ ID No.2, the primer pSOE-thrA-ppc-f has a sequence shown as SEQ ID No.3, the primer pSOE-aspA-ppc-r has a sequence shown as SEQ ID No.4, the primer pSOE-ppc-aspA-f has a sequence shown as SEQ ID No.5, the primer pSOE-pntA-aspA-r has a sequence shown as SEQ ID No.6, the primer pSOE-aspA-pntA-f has a sequence shown as SEQ ID No.7, the primer pntB-r has a sequence shown as SEQ ID No.8,

the method comprises the following steps:

SEQ ID No.1:5’-GCTCATATTGGCACTGGAAG-3’；

SEQ ID No.2:5’-CTTATGGAAATGTTAAAAAATCGCCAAGCTTTACGCGAACGAG-3’；

SEQ ID No.3:5’-CTCGTTCGCGTAAAGCTTGGCGATTTTTTAACATTTCCATAAG-3’；

SEQ ID No.4:5’-CATTTTCCTTTATGTCTATATTGAGATTTCCCTTAAGGATATCTGAAGGTATATTCAG-3’；

SEQ ID No.5:5’-CTGAATATACCTTCAGATATCCTTAAGGGAAATCTCAATATAGACATAAAGGAAAATG-3’；

SEQ ID No.6:5’-GTACTGAAAATTATGCCTGTGATCTGTGCCTTTTTTATTTGTACTACCCT-3’；

SEQ ID No.7:5’-AGGGTAGTACAAATAAAAAAGGCACAGATCACAGGCATAATTTTCAGTAC-3’；

SEQ ID No.8:5’-TCTCAATAAAGAGTGACGGC-3’。

(2) Using MG1655 genome DNA as a template, pSOE-cadA-H1-f, pSOE-cadA-H1-r; pSOE-cadA-H2-f and pSOE-cadA-H2-r are used as primers to respectively obtain upstream and downstream integrated homology arms of cadA, and then amplified by an overlap extension PCR method (namely SOE-PCR method) and the fragment DNA obtained in the step (1) to form an integrated donor DNA. Cloning the combined pcadA-N20-f and pcadA-N20-r into a temperature sensitive plasmid, wherein the temperature sensitive plasmid contains a recombinant enzyme of Lambda phage and a Cas9DNA endonuclease for expressing Gam, bet and Exo 3 by induction;

the primer pSOE-cadA-H1-f has a sequence shown as SEQ ID No.9, the primer pSOE-cadA-H1-r has a sequence shown as SEQ ID No.10, the primer pSOE-cadA-H2-f has a sequence shown as SEQ ID No.11, the primer pSOE-cadA-H2-r has a sequence shown as SEQ ID No.12, the primer pcadA-N20-f has a sequence shown as SEQ ID No.13, the primer pcadA-N20-r has a sequence shown as SEQ ID No.14,

the method comprises the following steps:

SEQ ID No.9:5’-GTGCAGCGCCAGAGCCAC-3’；

SEQ ID No.10:5’-GCCGTCACTCTTTATTGAGAGCTTTAGTCAGCGGAGGC-3’；

SEQ ID No.11:5’-CTTCCAGTGCCAATATGAGCACTGTTTAAATATGTTCGTGAAGG-3’；

SEQ ID No.12:5’-GAGCTGGATGGATTTCACATCCAGTG-3’；

SEQ ID No.13:5’-AGCGGCCTCCGCTGACTAAAGCAT-3’；

SEQ ID No.14:5’-AAACATGCTTTAGTCAGCGGAGGC-3’；

the integrated inserted gene DNA fragment has a sequence shown as SEQ ID No.15, and is specifically as follows:

SEQ ID No.15：5’-GCTCATATTGGCACTGGAAGCCGGGGCATAAACTTTAACCATGTCAGACTCCTAACTTCCATGAGAGGGTACGTAGCAGATCAGCAAAGACACCGGCAGCTGTAACGTCATTGCCCGCACCATATCCGCGCAGTACCAACGGCAGCGGCTGATAATAGTGGCTATAGAAGGCCAGGGCGTTTTCGCCATTTTTCACTTTGAACAGCGGATCATTACCATCCACTTCGGCAATCTTCACGCGGCAGACGCCATCTTCATCAATATTGCCAACATAGCGCAAAACTTTTCCTTCATCACGGGCCTTCGCCACGCGCGCGGCAAAGAGATCGTCGAGTTGTGACAGATTCGCCATAAAAGCGGCAACATCACCCTCGGCGTTAAACTCTGCGGGCAGCACAGGTTCAATTTCAATATCCGCCAGCTCCAGTTCACGTCCCGTTTCACGAGCGAGAATCAATAGTTTACGCGCCACATCCATACCAGAAAGATCATCTCGCGGGTCCGGTTCGGTATAACCCATTTCCCGCGCCAGCGTGGTCGCCTCGGAGAAACTCATGCCTTCGTCTAACTTGCCGAAGATATAAGAAAGCGAACCAGAAAGAATGCCGGAGAACTTCATCAATTCATCACCTGCATTGAGCAGATTTTGCAGGTTCTCAATAACCGGTAATCCAGCCCCAACGTTGGTGTCATAGAGGAATTTACGCCGCGATTTTTCCGCCGCATAACGCAACTGATGGTAGTAATCCATCGACGAGGTGTTGGCCTTTTTGTTCGGCGTGACAACGTGGAAACCTTCGCGCAGGAAGTCGGCATATTGATCCGCCACTGCCTGGCTGGAAGTGCAGTCAACAATGACCGGGTTCAGCAGATGATATTCTTTCACGAGGCGAATTAAGCGCCCGAGATTAAACGGCTCTTTGGCTTGCGCCAGTTCTTCCTGCCAGTTTTCCAGATTAAGGCCATGTACATTGGTGAGCAGAGCCTTCGAGTTGGCAACACCGCAGACACGTAAGTCGATATGTTTATTCTTCAGCCAGCTTTGCTGACGCTTCAGTTGCTCCAGCAGCGCACCGCCAACGCCACCGACGCCAATCACAAACACTTCGATAACCTGATCGGTATTGAACAGCATCTGATGAGTAACGCGCACGCCAGTGGTCGCATCATCGTTATTTACCACGACAGAGATTGAGCGTTCAGAAGATCTCTGAGCAATGGCGACAATGTTGATATTGGCGCGGGCCAGTGCGGCAAAGAATTTCGCCGAGATCCCACGCAAGGTGCGCATACCATCACCTACCACCGAGATAATGGCCAGCCGTTCCGTCACTGCCAGCGGCTCCAGTAAGCCTTCTTTCAGTTCCAGGTAGAACTCTTCCTGCATTGCCCGTTCAGCTCGCACACAGTCGCTTTGTGGAACGCAGAAACTGATGCTGTATTCGGAAGATGATTGCGTAATCAGCACCACGGAAATACGGGCGCGTGACATCGCTGCAAAGACGCGCGCCGCCATGCCGACCATCCCTTTCATCCCCGGACCAGAAACGCTGAACATTGCCATGTTATTCAGATTGGAAATGCCCTTGACCGGTAATTCGTCTTCATCACGGCTGGCACCAATGAGCGTACCTGGTGCTTGAGGATTTCCGGTATTTTTAATCAGGCAAGGGATCTGGAACTGGGCGATGGGGGTAATGGTGCGGGGGTGAAGAACTTTAGCGCCGAAGTAGGAAAGCTCCATCGCTTCCTGGTAGGACATCGACTTCAACAACCTCGCATCGGGCACCTGACGCGGGTCGCAGGTATAGACCCCGTCAACGTCCGTCCAAATCTCGCAACAATCGGCGCGTAAACAGGCAGCCAGCACCGCAGCAGAGTAGTCGGAACCGTTGCGTCCAAGCACCACCAGTTCGCCTTTTTCATTACCGGCGGTGAAACCTGCCATCAGCACCATGTGATCAGCCGGAATGCGGCTTGCCGCAATACGGCGGGTGGACTCAGCAATATCGACGGTAGATTCGAGGTAATGCCCCACTGCCAGCAGTTTTTCGACCGGATCGATAACAGTAACGTTGTGACCGCGCGCTTCTAATACGCCGGCCATAATGGCGATCGACATTTTCTCGCCACGGCAAATCAGCGCAGCGTTGATGCTATCCGGGCACTGCCCCAACAAACTAATGCCATGCAGGACATGTTTTATTTGGGCAAATTCCTGATCGACGAAAGTTTTCAATTGCGCCAGCGGGAACCCCGGCTGGGCGGCGGCGAGTCCCGTCAAAAGTTCGGCAAAAATACGTTCGGCATCGCTGATATTGGGTAAAGCATCCTGGCCGCTAATGGTTTTTTCAATCATCGCCACCAGGTGGTTGGTGATTTTGGCGGGGGCAGAGAGGACGGTGGCCACCTGCCCCTGCCTGGCATTGCTTTCCAGAATATCGGCAACACGCAGAAAACGTTCTGCATTTGCCACTGATGTACCGCCGAACTTCAACACTCGCATGGTTGTTACCTCGTTACCTTTGGTCGGACTCTAGAGTCTTTATCTGTCTGTGCGCTATGCCTATATTGGTTAAAGTATTTAGTGACCTAAGTCAATAAAATTTTAATTTACTCACGGCAGGTAACCAGTTCAGAAGCTGCTATCAGACACTCTTTTTTTAATCCACACAGAGACATATTGCCCGTTGCAGTCAGAATGAAAAGCTGAAAAATACTTACTAAGGCGTTTTTTATTTGGTGATATTTTTTTCAATATCATGCAGCAAACGGTGCAACATTGCCGTGTCTCGTTGCTCTAAAAGCCCCAGGCGTTGTTGTAACCAGTCGACCAGTTTTATGTCATCTGCCACTGCCAGAGTCGTCAGCAATGTCATGGCTCGTTCGCGTAAAGCTTGGCGATTTTTTAACATTTCCATAAGTTACGCTTATTTAAAGCGTCGTGAATTTAATGACGTAAATTCCTGCTATTTATTCGTTTGCTGAAGCGATTTCGCAGCATTTGACGTCACCGCTTTTACGTGGCTTTATAAAAGACGACGAAAAGCAAAGCCCGAGCATATTCGCGCCAATGCGACGTGAAGGATACAGGGCTATCAAACGATAAGATGGGGTGTCTGGGGTAATATGAACGAACAATATTCCGCATTGCGTAGTAATGTCAGTATGCTCGGCAAAGTGCTGGGAGAAACCATCAAGGATGCGTTGGGAGAACACATTCTTGAACGCGTAGAAACTATCCGTAAGTTGTCGAAATCTTCACGCGCTGGCAATGATGCTAACCGCCAGGAGTTGCTCACCACCTTACAAAATTTGTCGAACGACGAGCTGCTGCCCGTTGCGCGTGCGTTTAGTCAGTTCCTGAACCTGGCCAACACCGCCGAGCAATACCACAGCATTTCGCCGAAAGGCGAAGCTGCCAGCAACCCGGAAGTGATCGCCCGCACCCTGCGTAAACTGAAAAACCAGCCGGAACTGAGCGAAGACACCATCAAAAAAGCAGTGGAATCGCTGTCGCTGGAACTGGTCCTCACGGCTCACCCAACCGAAATTACCCGTCGTACACTGATCCACAAAATGGTGGAAGTGAACGCCTGTTTAAAACAGCTCGATAACAAAGATATCGCTGACTACGAACACAACCAGCTGATGCGTCGCCTGCGCCAGTTGATCGCCCAGTCATGGCATACCGATGAAATCCGTAAGCTGCGTCCAAGCCCGGTAGATGAAGCCAAATGGGGCTTTGCCGTAGTGGAAAACAGCCTGTGGCAAGGCGTACCAAATTACCTGCGCGAACTGAACGAACAACTGGAAGAGAACCTCGGCTACAAACTGCCCGTCGAATTTGTTCCGGTCCGTTTTACTTCGTGGATGGGCGGCGACCGCGACGGCAACCCGAACGTCACTGCCGATATCACCCGCCACGTCCTGCTACTCAGCCGCTGGAAAGCCACCGATTTGTTCCTGAAAGATATTCAGGTGCTGGTTTCTGAACTGTCGATGGTTGAAGCGACCCCTGAACTGCTGGCGCTGGTTGGCGAAGAAGGTGCCGCAGAACCGTATCGCTATCTGATGAAAAACCTGCGTTCTCGCCTGATGGCGACACAGGCATGGCTGGAAGCGCGCCTGAAAGGCGAAGAACTGCCAAAACCAGAAGGCCTGCTGACACAAAACGAAGAACTGTGGGAACCGCTCTACGCTTGCTACCAGTCACTTCAGGCGTGTGGCATGGGTATTATCGCCAACGGCGATCTGCTCGACACCCTGCGCCGCGTGAAATGTTTCGGCGTACCGCTGGTCCGTATTGATATCCGTCAGGAGAGCACGCGTCATACCGAAGCGCTGGGCGAGCTGACCCGCTACCTCGGTATCGGCGACTACGAAAGCTGGTCAGAGGCCGACAAACAGGCGTTCCTGATCCGCGAACTGAACTCCAAACGTCCGCTTCTGCCGCGCAACTGGCAACCAAGCGCCGAAACGCGCGAAGTGCTCGATACCTGCCAGGTGATTGCCGAAGCACCGCAAGGCTCCATTGCCGCCTACGTGATCTCGATGGCGAAAACGCCGTCCGACGTACTGGCTGTCCACCTGCTGCTGAAAGAAGCGGGTATCGGGTTTGCGATGCCGGTTGCTCCGCTGTTTGAAACCCTCGATGATCTGAACAACGCCAACGATGTCATGACCCAGCTGCTCAATATTGACTGGTATCGTGGCCTGATTCAGGGCAAACAGATGGTGATGATTGGCTATTCCGACTCAGCAAAAGATGCGGGAGTGATGGCAGCTTCCTGGGCGCAATATCAGGCACAGGATGCATTAATCAAAACCTGCGAAAAAGCGGGTATTGAGCTGACGTTGTTCCACGGTCGCGGCGGTTCCATTGGTCGCGGCGGCGCACCTGCTCATGCGGCGCTGCTGTCACAACCGCCAGGAAGCCTGAAAGGCGGCCTGCGCGTAACCGAACAGGGCGAGATGATCCGCTTTAAATATGGTCTGCCAGAAATCACCGTCAGCAGCCTGTCGCTTTATACCGGGGCGATTCTGGAAGCCAACCTGCTGCCACCGCCGGAGCCGAAAGAGAGCTGGCGTCGCATTATGGATGAACTGTCAGTCATCTCCTGCGATGTCTACCGCGGCTACGTACGTGAAAACAAAGATTTTGTGCCTTACTTCCGCTCCGCTACGCCGGAACAAGAACTGGGCAAACTGCCGTTGGGTTCACGTCCGGCGAAACGTCGCCCAACCGGCGGCGTCGAGTCACTACGCGCCATTCCGTGGATCTTCGCCTGGACGCAAAACCGTCTGATGCTCCCCGCCTGGCTGGGTGCAGGTACGGCGCTGCAAAAAGTGGTCGAAGACGGCAAACAGAGCGAGCTGGAGGCTATGTGCCGCGATTGGCCATTCTTCTCGACGCGTCTCGGCATGCTGGAGATGGTCTTCGCCAAAGCAGACCTGTGGCTGGCGGAATACTATGACCAACGCCTGGTAGACAAAGCACTGTGGCCGTTAGGTAAAGAGTTACGCAACCTGCAAGAAGAAGACATCAAAGTGGTGCTGGCGATTGCCAACGATTCCCATCTGATGGCCGATCTGCCGTGGATTGCAGAGTCTATTCAGCTACGGAATATTTACACCGACCCGCTGAACGTATTGCAGGCCGAGTTGCTGCACCGCTCCCGCCAGGCAGAAAAAGAAGGCCAGGAACCGGATCCTCGCGTCGAACAAGCGTTAATGGTCACTATTGCCGGGATTGCGGCAGGTATGCGTAATACCGGCTAATCTTCCTCTTCTGCAAACCCTCGTGCTTTTGCGCGAGGGTTTTCTGAAATACTTCTGTTCTAACACCCTCGTTTTCAATATATTTCTGTCTGCATTTTATTCAAATTCTGAATATACCTTCAGATATCCTTAAGGGAAATCTCAATATAGACATAAAGGAAAATGGCAATAAAAGGTAACCAGCGCAAAGGTTTCTCCTGTAATAGCAGCCGGTTAACCCCGGCTACCTGAATGGGTTGCGAATCGCGTTTAGCTTATATTGTGGTCATTAGCAAAATTTCAAGATGTTTGCGCAACTATTTTTGGTAGTAATCCCAAAGCGGTGATCTATTTCACAAATTAATAATTAAGGGGTAAAAACCGACACTTAAAGTGATCCAGATTACGGTAGAAATCCTCAAGCAGCATATGATCTCGGGTATTCGGTCGATGCAGGGGATAATCGTCGGTCGAAAAACATTCGAAACCACATATATTCTGTGTGTTTAAAGCAAATCATTGGCAGCTTGAAAAAGAAGGTTCACATGTCAAACAACATTCGTATCGAAGAAGATCTGTTGGGTACCAGGGAAGTTCCAGCTGATGCCTACTATGGTGTTCACACTCTGAGAGCGATTGAAAACTTCTATATCAGCAACAACAAAATCAGTGATATTCCTGAATTTGTTCGCGGTATGGTAATGGTTAAAAAAGCCGCAGCTATGGCAAACAAAGAGCTGCAAACCATTCCTAAAAGTGTAGCGAATGCCATCATTGCCGCATGTGATGAAGTCCTGAACAACGGAAAATGCATGGATCAGTTCCCGGTAGACGTCTACCAGGGCGGCGCAGGTACTTCCGTAAACATGAACACCAACGAAGTGCTGGCCAATATCGGTCTGGAACTGATGGGTCACCAAAAAGGTGAATATCAGTACCTGAACCCGAACGACCATGTTAACAAATGTCAGTCCACTAACGACGCCTACCCGACCGGTTTCCGTATCGCAGTTTACTCTTCCCTGATTAAGCTGGTAGATGCGATTAACCAACTGCGTGAAGGCTTTGAACGTAAAGCTGTCGAATTCCAGGACATCCTGAAAATGGGTCGTACCCAGCTGCAGGACGCAGTACCGATGACCCTCGGTCAGGAATTCCGCGCTTTCAGCATCCTGCTGAAAGAAGAAGTGAAAAACATCCAACGTACCGCTGAACTGCTGCTGGAAGTTAACCTTGGTGCAACGGCAATCGGTACTGGTCTGAACACGCCGAAAGAGTACTCTCCGCTGGCAGTGAAAAAACTGGCTGAAGTTACTGGCTTCCCATGCGTACCGGCTGAAGACCTGATCGAAGCGACCTCTGACTGCGGCGCTTATGTTATGGTTCACGGCGCGCTGAAACGCCTGGCTGTGAAGATGTCCAAAATCTGTAACGACCTGCGCTTGCTCTCTTCAGGCCCACGTGCCGGCCTGAACGAGATCAACCTGCCGGAACTGCAGGCGGGCTCTTCCATCATGCCAGCTAAAGTAAACCCGGTTGTTCCGGAAGTGGTTAACCAGGTATGCTTCAAAGTCATCGGTAACGACACCACTGTTACCATGGCAGCAGAAGCAGGTCAGCTGCAGTTGAACGTTATGGAGCCGGTCATTGGCCAGGCCATGTTCGAATCCGTTCACATTCTGACCAACGCTTGCTACAACCTGCTGGAAAAATGCATTAACGGCATCACTGCTAACAAAGAAGTGTGCGAAGGTTACGTTTACAACTCTATCGGTATCGTTACTTACCTGAACCCGTTCATCGGTCACCACAACGGTGACATCGTGGGTAAAATCTGTGCCGAAACCGGTAAGAGTGTACGTGAAGTCGTTCTGGAACGCGGTCTGTTGACTGAAGCGGAACTTGACGATATTTTCTCCGTACAGAATCTGATGCACCCGGCTTACAAAGCAAAACGCTATACTGATGAAAGCGAACAGTAATCGTACAGGGTAGTACAAATAAAAAAGGCACAGATCACAGGCATAATTTTCAGTACGTTATAGGGCGTTTGTTACTAATTTATTTTAACGGAGTAACATTTAGCTCGTACATGAGCAGCTTGTGTGGCTCCTGACACAGGCAAACCATCATCAATAAAACCGATGGAAGGGAATATCATGCGAATTGGCATACCAAGAGAACGGTTAACCAATGAAACCCGTGTTGCAGCAACGCCAAAAACAGTGGAACAGCTGCTGAAACTGGGTTTTACCGTCGCGGTAGAGAGCGGCGCGGGTCAACTGGCAAGTTTTGACGATAAAGCGTTTGTGCAAGCGGGCGCTGAAATTGTAGAAGGGAATAGCGTCTGGCAGTCAGAGATCATTCTGAAGGTCAATGCGCCGTTAGATGATGAAATTGCGTTACTGAATCCTGGGACAACGCTGGTGAGTTTTATCTGGCCTGCGCAGAATCCGGAATTAATGCAAAAACTTGCGGAACGTAACGTGACCGTGATGGCGATGGACTCTGTGCCGCGTATCTCACGCGCACAATCGCTGGACGCACTAAGCTCGATGGCGAACATCGCCGGTTATCGCGCCATTGTTGAAGCGGCACATGAATTTGGGCGCTTCTTTACCGGGCAAATTACTGCGGCCGGGAAAGTGCCACCGGCAAAAGTGATGGTGATTGGTGCGGGTGTTGCAGGTCTGGCCGCCATTGGCGCAGCAAACAGTCTCGGCGCGATTGTGCGTGCATTCGACACCCGCCCGGAAGTGAAAGAACAAGTTCAAAGTATGGGCGCGGAATTCCTCGAGCTGGATTTTAAAGAGGAAGCTGGCAGCGGCGATGGCTATGCCAAAGTGATGTCGGACGCGTTCATCAAAGCGGAAATGGAACTCTTTGCCGCCCAGGCAAAAGAGGTCGATATCATTGTCACCACCGCGCTTATTCCAGGCAAACCAGCGCCGAAGCTAATTACCCGTGAAATGGTTGACTCCATGAAGGCGGGCAGTGTGATTGTCGACCTGGCAGCCCAAAACGGCGGCAACTGTGAATACACCGTGCCGGGTGAAATCTTCACTACGGAAAATGGTGTCAAAGTGATTGGTTATACCGATCTTCCGGGCCGTCTGCCGACGCAATCCTCACAGCTTTACGGCACAAACCTCGTTAATCTGCTGAAACTGTTGTGCAAAGAGAAAGACGGCAATATCACTGTTGATTTTGATGATGTGGTGATTCGCGGCGTGACCGTGATCCGTGCGGGCGAAATTACCTGGCCGGCACCGCCGATTCAGGTATCAGCTCAGCCGCAGGCGGCACAAAAAGCGGCACCGGAAGTGAAAACTGAGGAAAAATGTACCTGCTCACCGTGGCGTAAATACGCGTTGATGGCGCTGGCAATCATTCTTTTTGGCTGGATGGCAAGCGTTGCGCCGAAAGAATTCCTTGGGCACTTCACCGTTTTCGCGCTGGCCTGCGTTGTCGGTTATTACGTGGTGTGGAATGTATCGCACGCGCTGCATACACCGTTGATGTCGGTCACCAACGCGATTTCAGGGATTATTGTTGTCGGAGCACTGTTGCAGATTGGCCAGGGCGGCTGGGTTAGCTTCCTTAGTTTTATCGCGGTGCTTATAGCCAGCATTAATATTTTCGGTGGCTTCACCGTGACTCAGCGCATGCTGAAAATGTTCCGCAAAAATTAAGGGGTAACATATGTCTGGAGGATTAGTTACAGCTGCATACATTGTTGCCGCGATCCTGTTTATCTTCAGTCTGGCCGGTCTTTCGAAACATGAAACGTCTCGCCAGGGTAACAACTTCGGTATCGCCGGGATGGCGATTGCGTTAATCGCAACCATTTTTGGACCGGATACGGGTAATGTTGGCTGGATCTTGCTGGCGATGGTCATTGGTGGGGCAATTGGTATCCGTCTGGCGAAGAAAGTTGAAATGACCGAAATGCCAGAACTGGTGGCGATCCTGCATAGCTTCGTGGGTCTGGCGGCAGTGCTGGTTGGCTTTAACAGCTATCTGCATCATGACGCGGGAATGGCACCGATTCTGGTCAATATTCACCTGACGGAAGTGTTCCTCGGTATCTTCATCGGGGCGGTAACGTTCACGGGTTCGGTGGTGGCGTTCGGCAAACTGTGTGGCAAGATTTCGTCTAAACCATTGATGCTGCCAAACCGTCACAAAATGAACCTGGCGGCTCTGGTCGTTTCCTTCCTGCTGCTGATTGTATTTGTTCGCACGGACAGCGTCGGCCTGCAAGTGCTGGCATTGCTGATAATGACCGCAATTGCGCTGGTATTCGGCTGGCATTTAGTCGCCTCCATCGGTGGTGCAGATATGCCAGTGGTGGTGTCGATGCTGAACTCGTACTCCGGCTGGGCGGCTGCGGCTGCGGGCTTTATGCTCAGCAACGACCTGCTGATTGTGACCGGTGCGCTGGTCGGTTCTTCGGGGGCTATCCTTTCTTACATTATGTGTAAGGCGATGAACCGTTCCTTTATCAGCGTTATTGCGGGTGGTTTCGGCACCGACGGCTCTTCTACTGGCGATGATCAGGAAGTGGGTGAGCACCGCGAAATCACCGCAGAAGAGACAGCGGAACTGCTGAAAAACTCCCATTCAGTGATCATTACTCCGGGGTACGGCATGGCAGTCGCGCAGGCGCAATATCCTGTCGCTGAAATTACTGAGAAATTGCGCGCTCGTGGTATTAATGTGCGTTTCGGTATCCACCCGGTCGCGGGGCGTTTGCCTGGACATATGAACGTATTGCTGGCTGAAGCAAAAGTACCGTATGACATCGTGCTGGAAATGGACGAGATCAATGATGACTTTGCTGATACCGATACCGTACTGGTGATTGGTGCTAACGATACGGTTAACCCGGCGGCGCAGGATGATCCGAAGAGTCCGATTGCTGGTATGCCTGTGCTGGAAGTGTGGAAAGCGCAGAACGTGATTGTCTTTAAACGTTCGATGAACACTGGCTATGCTGGTGTGCAAAACCCGCTGTTCTTCAAGGAAAACACCCACATGCTGTTTGGTGACGCCAAAGCCAGCGTGGATGCAATCCTGAAAGCTCTGTAACCCTGACGGCCTCTGCTGAGGCCGTCACTCTTTATTGAGA-3’；

(3) Screening the temperature-sensitive plasmid obtained in the step (2), transferring the correct plasmid into competent cells of the strain obtained in the example 1, culturing at 30 ℃, placing the strain successfully transferred with the plasmid under an arabinose induction condition for continuous culture, enabling the strain to express Lambda phage recombinase, gRNA and Cas9DNA endonuclease, and screening target mutant bacterial colonies;

(4) Culturing the mutant colonies screened and confirmed in the step (3) at 42 ℃ to eliminate CRISPR/Cas9 plasmids and simultaneously eliminate the resistance of the kanamycin caused by the plasmids, thus obtaining the strain MG1655 (DeltatherB, rhtA23, deltatherL, thrA (G433R), deltatA:: thrA-ppc-aspA-pntAB).

Example 3

Construction of a genetically engineered Strain MG1655 (Deltathr B, rhtA23, deltathr L, thrA (G433R), deltatA:: thrA-ppc-aspA-pntAB, deltatJ:: thrA-ppc-aspA-pntAB) expressing thrA, ppc, aspA, pntA and pntB in two copies on chromosomal DNA.

The L-homoserine producing strain constructed in this example was a genetically engineered strain MG1655 (Deltathr B, rhtA23, deltathr L, thrA (G433R), deltata:: thrA-ppc-aspA) expressing thrA, ppc, aspA, pntA and pntB in two-fold integration on chromosomal DNA

ThrA-ppc-aspA-pntAB), strain construction was achieved using CRISPR/Cas9 gene editing technique, and the fragment of SEQ ID No.15 described in example 2 was inserted downstream of the yidJ gene, with the construction method substantially similar to that of example 2, except that: the product strain of original bacterium example 2 is used as an operation object, and the integration position is downstream of yidJ gene. The method comprises the following steps: the primers used in step (2) described in example 2 were replaced with pSOE-yidJ-H1-f, pSOE-yidJ-H2-r, pyidJ-N20-f, pyidJ-N20-r from the primers pSOE-cadA-H1-f, pSOE-cadA-H1-r, pSOE-cadA-H2-f, pSOE-cadA-H2-r, pcadA-N20-f, pcadA-N20-r;

wherein the primer pSOE-yidJ-H1-f has a sequence shown as SEQ ID No.16, the primer pSOE-yidJ-H1-r has a sequence shown as SEQ ID No.17, the primer pSOE-yidJ-H2-f has a sequence shown as SEQ ID No.18, the primer pSOE-yidJ-H2-r has a sequence shown as SEQ ID No.19, the primer pyidJ-N20-f has a sequence shown as SEQ ID No.20, and the primer pyidJ-N20-r has a sequence shown as SEQ ID No.21, concretely as follows:

SEQ ID No.16:5’-GTGCGAAATTTTCATTGTTGCTCCTTTGC-3’；

SEQ ID No.17：5’-CTTCCAGTGCCAATATGAGCCGGCCTACCGACACAAG-3’；

SEQ ID No.18：5’-GGCCGTCACTCTTTATTGAGAGTGTCATAGTCGCGTACAAC-3’；

SEQ ID No.19：5’-GAGCCGGCGATGTATGACGACATC-3’；

SEQ ID No.20：5’-AGCGGTTGTACGCGACTATGACAC-3’；

SEQ ID No.21：5’-AAACGTGTCATAGTCGCGTACAAC-3’。

example 4

Construction of genetically engineered strains MG1655 (DeltatherB, rhtA23, deltatherL, thrA (G433R), deltatA:: thrA-ppc-aspA-pntAB, deltatJ::: thrA-ppc-aspA-pntAB, deltatpC::: thrA-ppc-aspA-pntAB) expressing thrA, ppc, aspA, pntA and pntB in three copies on chromosomal DNA.

The L-homoserine producing strain constructed in this example was a genetically engineered strain MG1655 (DeltatherB, rhtA23, deltatherL, thrA (G433R) expressing thrA, ppc, aspA, pntA and pntB simultaneously and three times integrated on chromosomal DNA, deltatdA:: thrA-ppc-aspA-pntAB, deltatpC:: thrA-ppc-aspA-pntAB) constructed by using CRISPR/Cas9 gene editing technique, and the construction method was substantially similar to that of example 2 except that the fragment of SEQ ID No.15 described in example 2 was inserted downstream of the atpC gene: the product strain of original bacterium example 3 was used as the subject, and the integration position was downstream of the atpC gene. Specific: the primers used in step (2) described in example 2 were replaced with pSOE-atpC-H1-f, pSOE-atpC-H2-r, patpC-N20-f, patpC-N20-r from the primers pSOE-cadA-H1-f, pSOE-cadA-H1-r, pSOE-cadA-H2-f, pSOE-cadA-N20-f, pcadA-H2-r, pcadA-N20-r;

wherein the primer pSOE-atpC-H1-f has a sequence shown as SEQ ID No.22, the primer pSOE-atpC-H1-r has a sequence shown as SEQ ID No.23, the primer pSOE-atpC-H2-f has a sequence shown as SEQ ID No.24, the primer pSOE-atpC-H2-r has a sequence shown as SEQ ID No.25, the primer patpC-N20-f has a sequence shown as SEQ ID No.26, and the primer patpC-N20-r has a sequence shown as SEQ ID No.27, concretely as follows:

SEQ ID No.22:5’-GTGCGAAATTTTCATTGTTGCTCCTTTGC-3’；

SEQ ID No.23：5’-CTTCCAGTGCCAATATGAGCGAAAGCGCCATTTTCGACC-3’；

SEQ ID No.24：5’-GCCGTCACTCTTTATTGAGAGTCAGCGGGGATAATCCGT-3’；

SEQ ID No.25：5’-GAGCCATAACCGGTCGGATCATCC-3’；

SEQ ID No.26：5’-AGCGGTTGTACGCGACTATGACAC-3’；

SEQ ID No.27：5’-AAACGTGTCATAGTCGCGTACAAC-3’。

example 5

Construction of the genetically engineered strains MG1655 (DeltathrB, rhtA23, deltathL, thrA (G433R), deltataA::: thrA-ppc-aspA-pntAB, deltatiJ::: thrA-ppc-aspA-pntAB, deltatpC::: thrA-ppc-aspA-pntAB, deltatacA::: thrA) were continued to be integrated in chromosomal DNA.

The L-continuous integration thrA constructed in this example was used as the genetic engineering strain MG1655 (DeltatherB, rhtA23, deltatherL, thrA (G433R), deltatadA:: thrA-ppc-aspA-pntAB, deltatdJ:: thrA-ppc-aspA-pntAB, deltatpC:: thrA-ppc-aspA)

pntAB, Δdaca: : thrA) and constructing a strain by using CRISPR/Cas9 gene editing technology, and inserting a thrA expression cassette into the dacA gene, wherein the construction method is basically similar to the method of example 2, and the difference is that: the original strain example 4 was used as an operating object, and the integration position was the reverse insertion into the dacA gene. Specific: the insert was obtained by PCR amplification from the MG1655 genome using the primers pSOE-thrA-f and pSOE-thrA-r, and the primers used in step (2) described in example 2 were replaced with pSOE-cadA-H1-f, pSOE-cadA-H1-r, pSOE-cadA-H2-f, pSOE-cadA-H2-r, pcadA-N20-f, pcadA-N20-r, pSOE-dacA-H1-f, pSOE-dacA-H1-r, pSOE-dacA-H2-f, pSOE-dacA-H2-r, pdac A-N20-f, pdac A-N20-r;

wherein the primer pSOE-thrA-f has a sequence shown as SEQ ID No.1, the primer pSOE-thrA-r has a sequence shown as SEQ ID No.28, the primer pSOE-dacA-H1-f has a sequence shown as SEQ ID No.29, the primer pSOE-dacA-H1-r has a sequence shown as SEQ ID No.30, the primer pSOE-dacA-H2-f has a sequence shown as SEQ ID No.31, the primer pSOE-dacA-H2-r has a sequence shown as SEQ ID No.32, the primer pdac A-N20-f has a sequence shown as SEQ ID No.33, and the primer pdac A-N20-r has a sequence shown as SEQ ID No.34, specifically as follows:

SEQ ID No.28:5’-AAGCTTTACGCGAACGAGC-3’；

SEQ ID No.29:5’-GTGCGAAATTTTCATTGTTGCTCCTTTGC-3’；

SEQ ID No.30：5’-GCTCGTTCGCGTAAAGCTTGTACGTCACGGATCAATGC-3’；

SEQ ID No.31：5’-CTTCCAGTGCCAATATGAGCCGAATGAATACTCGATCTATAAAGAAAAAG-3’；

SEQ ID No.32：5’-GAGCAACCAAACCAGTGATGGAAC-3’；

SEQ ID No.33：5’-AGCGAGTATTCATTCGGTACGTCA-3’；

SEQ ID No.34：5’-AAACTGACGTACCGAATGAATACT-3’。

example 6

Construction of the genetically engineered strains MG1655 (DeltatrB, rhtA23, deltatrL, thrA (G433R), deltatadA::: thrA-ppc-aspA-pntAB, deltatpC:: thrA-ppc-aspA-pntAB, deltatacA::: thrA::: deltatbcsB:::: thrA) were continued to be integrated in chromosomal DNA.

In this embodiment, the CRISPR/Cas9 gene editing technology is adopted to implement the construction of the strain, and the thrA expression cassette is inserted into the bcsB gene, and the construction method is basically similar to that of embodiment 5, and the difference is only that: the product strain of original bacterium example 5 is used as an operation object, and the integration position is reversely inserted into the bcsB gene. Specific: insert same as example 5 and replacing the primers used in step (2) described in example 5 with pSOE-bcsB-H1-f, pSOE-bcsB-H1-r, pSOE-bcsB-H2-f, pSOE-bcsB-H2-r, pbcsB-N20-f, pbcsB-N20-r from the described pSOE-dacA-H1-f, pSOE-dacA-H1-r, pSOE-dacA-H2-f, pSOE-dacA-H2-r, pSOE-dacA-N20-f, pdacsB-N20-r;

wherein the primer pSOE-bcsB-H1-f has a sequence shown as SEQ ID No.35, the primer pSOE-bcsB-H1-r has a sequence shown as SEQ ID No.36, the primer pSOE-bcsB-H2-f has a sequence shown as SEQ ID No.37, the primer pSOE-bcsB-H2-r has a sequence shown as SEQ ID No.38, the primer pbcsB-N20-f has a sequence shown as SEQ ID No.39, and the primer pbcsB-N20-r has a sequence shown as SEQ ID No.40, specifically as follows:

SEQ ID No.35:5’-GTGCTCGTTACTGCCTGTCCAGTC-3’；

SEQ ID No.36:5’-GCTCGTTCGCGTAAAGCTTCAGTTTGACGTAAGGATTCTGC-3’；

SEQ ID No.37：5’-CTTCCAGTGCCAATATGAGCCTGGTGGTGTTTGGTCGTGACG-3’；

SEQ ID No.38：5’-GAGCGCTGGAAGGTAATACAGTTATCCAC-3’；

SEQ ID No.39：5’-AGCGGAATCCTTACGTCAAACTGC-3’；

SEQ ID No.40：5’-AAACGCAGTTTGACGTAAGGATTC-3’；

example 7

Construction of a genetically engineered strain MG1655 (DeltatherB, rhtA23, deltatherL, thrA (G433R), deltatA:: -thrA-ppc-aspA-pntAB, deltatpC:: -thrA-ppc-aspA-pntAB, deltatac::: -thrA-x, deltatbcsB:: -thrA-x, deltomenH::: aspC) integrating aspC in chromosomal DNA.

The present example was constructed on a genetically engineered strain MG1655 (DeltathrB, rhtA23, deltathL, thrA (G433R), deltataA::::: -ppc-aspA-pntAB, deltatpC:::: -thrA-ppc-aspA-pntAB, deltatcA:::: -thrA-ppc-aspA-pntAB, deltatacA::::: -thrA:, deltataH::::: aspC). The insertion of aspC expression cassette inside the menH gene is realized by CRISPR/Cas9 gene editing technology. The construction method was substantially similar to that of example 5, except that: the aspC gene under the natural promoter was inserted into the menH gene in the reverse direction using the strain produced in the original strain example 6 as an operation object. Specific: the insert was obtained by PCR amplification from the MG1655 genome with the primers pSOE-aspC-f and pSOE-aspC-r, and the primers used in example step (2) were replaced with pSOE-menH-H1-f, pSOE-dacA-H1-r, pSOE-dacA-H2-f, pSOE-dacA-H2-r, pdac-N20-f, pdac-N20-r, pSOE-menH-H1-f, pSOE-menH-H1-r, pSOE-menH-H2-f, pSOE-menH-H2-r, pmenH-N20-f;

wherein the primer pSOE-aspC-f has a sequence shown as SEQ ID No.41, the primer pSOE-aspC-r has a sequence shown as SEQ ID No.42, the primer pSOE-menH-H1-f has a sequence shown as SEQ ID No.43, the primer pSOE-menH-H1-r has a sequence shown as SEQ ID No.44, the primer pSOE-menH-H2-f has a sequence shown as SEQ ID No.45, the primer pSOE-menH-H2-r has a sequence shown as SEQ ID No.46, the primer pmenH-N20-f has a sequence shown as SEQ ID No.47, and the primer pmenH-N20-r has a sequence shown as SEQ ID No.48, specifically as follows:

SEQ ID No.41:5’-CTGACCGTACCAACCTGCA-3’；

SEQ ID No.42:5’-CCTGATAAGCGTAGCGCAT-3’；

SEQ ID No.43:5’-GTGCGTTTGCCGACTACTCACG-3’；

SEQ ID No.44：5’-TGCAGGTTGGTACGGTCAGGCGCTAAGGTTAGCACGTAAAT-3’；

SEQ ID No.45：5’-ATGCGCTACGCTTATCAGGCCGCACATTTGCGTTTTATTAT-3’；

SEQ ID No.46：5’-GAGCACATTCAGGTGATGTACGCC-3’；

SEQ ID No.47：5’-AGCGACGCAAATGTGCGGGCGCTA-3’；

SEQ ID No.48：5’-AAACTAGCGCCCGCACATTTGCGT-3’。

example 8

Construction of a genetically engineered strain MG1655 (DeltatherB, rhtA23, deltatherL, thrA (G433R), deltatadA:: -thrA-ppc-aspA-pntAB, deltatpC:: -thrA-ppc-aspA-pntAB, deltatdA:: -thrA-ppc-aspA-pntAB, deltatacA::: -thrA-x, deltatcsB:: -thrA-x, deltathH:::: aspC, deltatdB::: asd) integrating aspC in chromosomal DNA.

The present example constructed a genetically engineered strain MG1655 (Deltathr B, rhtA23, deltathr L, thrA (G433R), deltatA:: thrA-ppc-aspA-

pntAB，ΔyidJ::thrA*-ppc-aspA-pntAB，ΔatpC::thrA*-ppc-aspA

pntAB, ΔdacA:: thrA:, ΔbcsB:: thrA:, Δmen::: aspC, ΔyddB:: asd). The CRISPR/Cas9 gene editing technology is adopted to realize the insertion of an asd expression cassette inside the yddB gene. The construction method was substantially similar to that of example 5, except that: the asd gene under the natural promoter was inserted into the yddB gene using the strain produced in example 7 of the original strain as an object of manipulation. Specific: the insert was obtained by PCR amplification from the MG1655 genome with the primers pSOE-asd-f and pSOE-asd-r, and the primers used in example step (2) were replaced with pSOE-yddB-H1-f, pSOE-yddB-H1-r, pyddB-N20-f, pSOE-menoH 2-r, pmenH-N20-f, pmenH-N20-r by the primers pSOE-menoH-H1-f, pSOE-menoH-H1-r, pSOE-yddB-H2-f, pSOE-yddB-H2-r, pyddB-N20-f, pyddB-N20-r;

wherein the primer pSOE-asd-f has a sequence shown as SEQ ID No.49, the primer pSOE-asd-r has a sequence shown as SEQ ID No.50, the primer pSOE-yddB-H1-f has a sequence shown as SEQ ID No.51, the primer pSOE-yddB-H1-r has a sequence shown as SEQ ID No.52, the primer pSOE-yddB-H2-f has a sequence shown as SEQ ID No.53, the primer pSOE-yddB-H2-r has a sequence shown as SEQ ID No.54, the primer pyddB-N20-f has a sequence shown as SEQ ID No.55, and the primer pyddB-N20-r has a sequence shown as SEQ ID No.56, specifically as follows:

SEQ ID No.49:5’-GGATCCATAATCAGGATCAATAAAACT-3’；

SEQ ID No.50:5’-AGGATCCGCAAAATGGCC-3’；

SEQ ID No.51:5’-GTGCGGCTCTTCAGGAAGTACTTATTAC-3’；

SEQ ID No.52：5’-GTTTTATTGATCCTGATTATGGATCCCAGTCCACGCATCGGAATAG-3’；

SEQ ID No.53：5’-GGCCATTTTGCGGATCCTAACGCCATAACCAGTCTGAAT-3’；

SEQ ID No.54：5’-GAGCCTGAACGAATGCGTTTTGG-3’；

SEQ ID No.55：5’-AGCGATGGCGTTCAGTCCACGCAT-3’；

SEQ ID No.56：5’-AAACATGCGTGGACTGAACGCCAT-3’。

example 9

L-homoserine producing strain for producing L-homoserine by fermentation

The strain prepared in example 1 is adopted in the present example to perform fermentation production of L-homoserine, and the production method can be seen in Chinese patent application CN201710106474.8, and homoserine 5.3g/L is obtained by fermentation.

As an alternative embodiment of this example, the strain finally prepared in example 1 may also be replaced with the strain finally prepared in examples 2 to 8.

EXAMPLE 10 statistics of results of fermentation of L-homoserine producing Strain

The present example preferably uses the strains constructed in examples 1 and 4 and 8 to produce L-homoserine by fermentation, as compared with MG1655 strain. The production process was exactly the same as described in example 10.

The results of the detection and calculation of the L-homoserine production were as follows, according to the experiment No. Hom4 for fermentation using the strain prepared in example 4 and the experiment No. Hom8 for fermentation using the strain prepared in example 8:

bacterial strain	L-homoserine production (g/L)
		MG1655	0
Hom1	4.8±1.2
		Hom4	53.8±5.9
Hom8	88.1±11.4

As shown by the results, the yield of the L-homoserine produced by fermenting the strain of the invention is up to nearly 100g/L, which indicates that the invention has obvious effects on knocking out, weakening, enhancing, over-expressing and mutating genes.

It is apparent that the above examples are given by way of illustration only and are not limiting of the embodiments. Other variations or modifications of the above teachings will be apparent to those of ordinary skill in the art. While still being apparent from variations or modifications that may be made by those skilled in the art are within the scope of the invention.

SEQUENCE LISTING

<110> Sichuan Lier Biotech Co., ltd

<120> an L-homoserine producing strain, its construction method and application

<130> TC5382

<160> 56

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 1

gctcatattg gcactggaag 20

<210> 2

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 2

cttatggaaa tgttaaaaaa tcgccaagct ttacgcgaac gag 43

<210> 3

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 3

ctcgttcgcg taaagcttgg cgatttttta acatttccat aag 43

<210> 4

<211> 58

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 4

cattttcctt tatgtctata ttgagatttc ccttaaggat atctgaaggt atattcag 58

<210> 5

<211> 58

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 5

ctgaatatac cttcagatat ccttaaggga aatctcaata tagacataaa ggaaaatg 58

<210> 6

<211> 50

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 6

gtactgaaaa ttatgcctgt gatctgtgcc ttttttattt gtactaccct 50

<210> 7

<211> 50

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 7

agggtagtac aaataaaaaa ggcacagatc acaggcataa ttttcagtac 50

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 8

tctcaataaa gagtgacggc 20

<210> 9

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 9

gtgcagcgcc agagccac 18

<210> 10

<211> 38

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 10

gccgtcactc tttattgaga gctttagtca gcggaggc 38

<210> 11

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 11

cttccagtgc caatatgagc actgtttaaa tatgttcgtg aagg 44

<210> 12

<211> 26

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 12

gagctggatg gatttcacat ccagtg 26

<210> 13

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 13

agcggcctcc gctgactaaa gcat 24

<210> 14

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 14

aaacatgctt tagtcagcgg aggc 24

<210> 15

<211> 10891

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 15

gctcatattg gcactggaag ccggggcata aactttaacc atgtcagact cctaacttcc 60

atgagagggt acgtagcaga tcagcaaaga caccggcagc tgtaacgtca ttgcccgcac 120

catatccgcg cagtaccaac ggcagcggct gataatagtg gctatagaag gccagggcgt 180

tttcgccatt tttcactttg aacagcggat cattaccatc cacttcggca atcttcacgc 240

ggcagacgcc atcttcatca atattgccaa catagcgcaa aacttttcct tcatcacggg 300

ccttcgccac gcgcgcggca aagagatcgt cgagttgtga cagattcgcc ataaaagcgg 360

caacatcacc ctcggcgtta aactctgcgg gcagcacagg ttcaatttca atatccgcca 420

gctccagttc acgtcccgtt tcacgagcga gaatcaatag tttacgcgcc acatccatac 480

cagaaagatc atctcgcggg tccggttcgg tataacccat ttcccgcgcc agcgtggtcg 540

cctcggagaa actcatgcct tcgtctaact tgccgaagat ataagaaagc gaaccagaaa 600

gaatgccgga gaacttcatc aattcatcac ctgcattgag cagattttgc aggttctcaa 660

taaccggtaa tccagcccca acgttggtgt catagaggaa tttacgccgc gatttttccg 720

ccgcataacg caactgatgg tagtaatcca tcgacgaggt gttggccttt ttgttcggcg 780

tgacaacgtg gaaaccttcg cgcaggaagt cggcatattg atccgccact gcctggctgg 840

aagtgcagtc aacaatgacc gggttcagca gatgatattc tttcacgagg cgaattaagc 900

gcccgagatt aaacggctct ttggcttgcg ccagttcttc ctgccagttt tccagattaa 960

ggccatgtac attggtgagc agagccttcg agttggcaac accgcagaca cgtaagtcga 1020

tatgtttatt cttcagccag ctttgctgac gcttcagttg ctccagcagc gcaccgccaa 1080

cgccaccgac gccaatcaca aacacttcga taacctgatc ggtattgaac agcatctgat 1140

gagtaacgcg cacgccagtg gtcgcatcat cgttatttac cacgacagag attgagcgtt 1200

cagaagatct ctgagcaatg gcgacaatgt tgatattggc gcgggccagt gcggcaaaga 1260

atttcgccga gatcccacgc aaggtgcgca taccatcacc taccaccgag ataatggcca 1320

gccgttccgt cactgccagc ggctccagta agccttcttt cagttccagg tagaactctt 1380

cctgcattgc ccgttcagct cgcacacagt cgctttgtgg aacgcagaaa ctgatgctgt 1440

attcggaaga tgattgcgta atcagcacca cggaaatacg ggcgcgtgac atcgctgcaa 1500

agacgcgcgc cgccatgccg accatccctt tcatccccgg accagaaacg ctgaacattg 1560

ccatgttatt cagattggaa atgcccttga ccggtaattc gtcttcatca cggctggcac 1620

caatgagcgt acctggtgct tgaggatttc cggtattttt aatcaggcaa gggatctgga 1680

actgggcgat gggggtaatg gtgcgggggt gaagaacttt agcgccgaag taggaaagct 1740

ccatcgcttc ctggtaggac atcgacttca acaacctcgc atcgggcacc tgacgcgggt 1800

cgcaggtata gaccccgtca acgtccgtcc aaatctcgca acaatcggcg cgtaaacagg 1860

cagccagcac cgcagcagag tagtcggaac cgttgcgtcc aagcaccacc agttcgcctt 1920

tttcattacc ggcggtgaaa cctgccatca gcaccatgtg atcagccgga atgcggcttg 1980

ccgcaatacg gcgggtggac tcagcaatat cgacggtaga ttcgaggtaa tgccccactg 2040

ccagcagttt ttcgaccgga tcgataacag taacgttgtg accgcgcgct tctaatacgc 2100

cggccataat ggcgatcgac attttctcgc cacggcaaat cagcgcagcg ttgatgctat 2160

ccgggcactg ccccaacaaa ctaatgccat gcaggacatg ttttatttgg gcaaattcct 2220

gatcgacgaa agttttcaat tgcgccagcg ggaaccccgg ctgggcggcg gcgagtcccg 2280

tcaaaagttc ggcaaaaata cgttcggcat cgctgatatt gggtaaagca tcctggccgc 2340

taatggtttt ttcaatcatc gccaccaggt ggttggtgat tttggcgggg gcagagagga 2400

cggtggccac ctgcccctgc ctggcattgc tttccagaat atcggcaaca cgcagaaaac 2460

gttctgcatt tgccactgat gtaccgccga acttcaacac tcgcatggtt gttacctcgt 2520

tacctttggt cggactctag agtctttatc tgtctgtgcg ctatgcctat attggttaaa 2580

gtatttagtg acctaagtca ataaaatttt aatttactca cggcaggtaa ccagttcaga 2640

agctgctatc agacactctt tttttaatcc acacagagac atattgcccg ttgcagtcag 2700

aatgaaaagc tgaaaaatac ttactaaggc gttttttatt tggtgatatt tttttcaata 2760

tcatgcagca aacggtgcaa cattgccgtg tctcgttgct ctaaaagccc caggcgttgt 2820

tgtaaccagt cgaccagttt tatgtcatct gccactgcca gagtcgtcag caatgtcatg 2880

gctcgttcgc gtaaagcttg gcgatttttt aacatttcca taagttacgc ttatttaaag 2940

cgtcgtgaat ttaatgacgt aaattcctgc tatttattcg tttgctgaag cgatttcgca 3000

gcatttgacg tcaccgcttt tacgtggctt tataaaagac gacgaaaagc aaagcccgag 3060

catattcgcg ccaatgcgac gtgaaggata cagggctatc aaacgataag atggggtgtc 3120

tggggtaata tgaacgaaca atattccgca ttgcgtagta atgtcagtat gctcggcaaa 3180

gtgctgggag aaaccatcaa ggatgcgttg ggagaacaca ttcttgaacg cgtagaaact 3240

atccgtaagt tgtcgaaatc ttcacgcgct ggcaatgatg ctaaccgcca ggagttgctc 3300

accaccttac aaaatttgtc gaacgacgag ctgctgcccg ttgcgcgtgc gtttagtcag 3360

ttcctgaacc tggccaacac cgccgagcaa taccacagca tttcgccgaa aggcgaagct 3420

gccagcaacc cggaagtgat cgcccgcacc ctgcgtaaac tgaaaaacca gccggaactg 3480

agcgaagaca ccatcaaaaa agcagtggaa tcgctgtcgc tggaactggt cctcacggct 3540

cacccaaccg aaattacccg tcgtacactg atccacaaaa tggtggaagt gaacgcctgt 3600

ttaaaacagc tcgataacaa agatatcgct gactacgaac acaaccagct gatgcgtcgc 3660

ctgcgccagt tgatcgccca gtcatggcat accgatgaaa tccgtaagct gcgtccaagc 3720

ccggtagatg aagccaaatg gggctttgcc gtagtggaaa acagcctgtg gcaaggcgta 3780

ccaaattacc tgcgcgaact gaacgaacaa ctggaagaga acctcggcta caaactgccc 3840

gtcgaatttg ttccggtccg ttttacttcg tggatgggcg gcgaccgcga cggcaacccg 3900

aacgtcactg ccgatatcac ccgccacgtc ctgctactca gccgctggaa agccaccgat 3960

ttgttcctga aagatattca ggtgctggtt tctgaactgt cgatggttga agcgacccct 4020

gaactgctgg cgctggttgg cgaagaaggt gccgcagaac cgtatcgcta tctgatgaaa 4080

aacctgcgtt ctcgcctgat ggcgacacag gcatggctgg aagcgcgcct gaaaggcgaa 4140

gaactgccaa aaccagaagg cctgctgaca caaaacgaag aactgtggga accgctctac 4200

gcttgctacc agtcacttca ggcgtgtggc atgggtatta tcgccaacgg cgatctgctc 4260

gacaccctgc gccgcgtgaa atgtttcggc gtaccgctgg tccgtattga tatccgtcag 4320

gagagcacgc gtcataccga agcgctgggc gagctgaccc gctacctcgg tatcggcgac 4380

tacgaaagct ggtcagaggc cgacaaacag gcgttcctga tccgcgaact gaactccaaa 4440

cgtccgcttc tgccgcgcaa ctggcaacca agcgccgaaa cgcgcgaagt gctcgatacc 4500

tgccaggtga ttgccgaagc accgcaaggc tccattgccg cctacgtgat ctcgatggcg 4560

aaaacgccgt ccgacgtact ggctgtccac ctgctgctga aagaagcggg tatcgggttt 4620

gcgatgccgg ttgctccgct gtttgaaacc ctcgatgatc tgaacaacgc caacgatgtc 4680

atgacccagc tgctcaatat tgactggtat cgtggcctga ttcagggcaa acagatggtg 4740

atgattggct attccgactc agcaaaagat gcgggagtga tggcagcttc ctgggcgcaa 4800

tatcaggcac aggatgcatt aatcaaaacc tgcgaaaaag cgggtattga gctgacgttg 4860

ttccacggtc gcggcggttc cattggtcgc ggcggcgcac ctgctcatgc ggcgctgctg 4920

tcacaaccgc caggaagcct gaaaggcggc ctgcgcgtaa ccgaacaggg cgagatgatc 4980

cgctttaaat atggtctgcc agaaatcacc gtcagcagcc tgtcgcttta taccggggcg 5040

attctggaag ccaacctgct gccaccgccg gagccgaaag agagctggcg tcgcattatg 5100

gatgaactgt cagtcatctc ctgcgatgtc taccgcggct acgtacgtga aaacaaagat 5160

tttgtgcctt acttccgctc cgctacgccg gaacaagaac tgggcaaact gccgttgggt 5220

tcacgtccgg cgaaacgtcg cccaaccggc ggcgtcgagt cactacgcgc cattccgtgg 5280

atcttcgcct ggacgcaaaa ccgtctgatg ctccccgcct ggctgggtgc aggtacggcg 5340

ctgcaaaaag tggtcgaaga cggcaaacag agcgagctgg aggctatgtg ccgcgattgg 5400

ccattcttct cgacgcgtct cggcatgctg gagatggtct tcgccaaagc agacctgtgg 5460

ctggcggaat actatgacca acgcctggta gacaaagcac tgtggccgtt aggtaaagag 5520

ttacgcaacc tgcaagaaga agacatcaaa gtggtgctgg cgattgccaa cgattcccat 5580

ctgatggccg atctgccgtg gattgcagag tctattcagc tacggaatat ttacaccgac 5640

ccgctgaacg tattgcaggc cgagttgctg caccgctccc gccaggcaga aaaagaaggc 5700

caggaaccgg atcctcgcgt cgaacaagcg ttaatggtca ctattgccgg gattgcggca 5760

ggtatgcgta ataccggcta atcttcctct tctgcaaacc ctcgtgcttt tgcgcgaggg 5820

ttttctgaaa tacttctgtt ctaacaccct cgttttcaat atatttctgt ctgcatttta 5880

ttcaaattct gaatatacct tcagatatcc ttaagggaaa tctcaatata gacataaagg 5940

aaaatggcaa taaaaggtaa ccagcgcaaa ggtttctcct gtaatagcag ccggttaacc 6000

ccggctacct gaatgggttg cgaatcgcgt ttagcttata ttgtggtcat tagcaaaatt 6060

tcaagatgtt tgcgcaacta tttttggtag taatcccaaa gcggtgatct atttcacaaa 6120

ttaataatta aggggtaaaa accgacactt aaagtgatcc agattacggt agaaatcctc 6180

aagcagcata tgatctcggg tattcggtcg atgcagggga taatcgtcgg tcgaaaaaca 6240

ttcgaaacca catatattct gtgtgtttaa agcaaatcat tggcagcttg aaaaagaagg 6300

ttcacatgtc aaacaacatt cgtatcgaag aagatctgtt gggtaccagg gaagttccag 6360

ctgatgccta ctatggtgtt cacactctga gagcgattga aaacttctat atcagcaaca 6420

acaaaatcag tgatattcct gaatttgttc gcggtatggt aatggttaaa aaagccgcag 6480

ctatggcaaa caaagagctg caaaccattc ctaaaagtgt agcgaatgcc atcattgccg 6540

catgtgatga agtcctgaac aacggaaaat gcatggatca gttcccggta gacgtctacc 6600

agggcggcgc aggtacttcc gtaaacatga acaccaacga agtgctggcc aatatcggtc 6660

tggaactgat gggtcaccaa aaaggtgaat atcagtacct gaacccgaac gaccatgtta 6720

acaaatgtca gtccactaac gacgcctacc cgaccggttt ccgtatcgca gtttactctt 6780

ccctgattaa gctggtagat gcgattaacc aactgcgtga aggctttgaa cgtaaagctg 6840

tcgaattcca ggacatcctg aaaatgggtc gtacccagct gcaggacgca gtaccgatga 6900

ccctcggtca ggaattccgc gctttcagca tcctgctgaa agaagaagtg aaaaacatcc 6960

aacgtaccgc tgaactgctg ctggaagtta accttggtgc aacggcaatc ggtactggtc 7020

tgaacacgcc gaaagagtac tctccgctgg cagtgaaaaa actggctgaa gttactggct 7080

tcccatgcgt accggctgaa gacctgatcg aagcgacctc tgactgcggc gcttatgtta 7140

tggttcacgg cgcgctgaaa cgcctggctg tgaagatgtc caaaatctgt aacgacctgc 7200

gcttgctctc ttcaggccca cgtgccggcc tgaacgagat caacctgccg gaactgcagg 7260

cgggctcttc catcatgcca gctaaagtaa acccggttgt tccggaagtg gttaaccagg 7320

tatgcttcaa agtcatcggt aacgacacca ctgttaccat ggcagcagaa gcaggtcagc 7380

tgcagttgaa cgttatggag ccggtcattg gccaggccat gttcgaatcc gttcacattc 7440

tgaccaacgc ttgctacaac ctgctggaaa aatgcattaa cggcatcact gctaacaaag 7500

aagtgtgcga aggttacgtt tacaactcta tcggtatcgt tacttacctg aacccgttca 7560

tcggtcacca caacggtgac atcgtgggta aaatctgtgc cgaaaccggt aagagtgtac 7620

gtgaagtcgt tctggaacgc ggtctgttga ctgaagcgga acttgacgat attttctccg 7680

tacagaatct gatgcacccg gcttacaaag caaaacgcta tactgatgaa agcgaacagt 7740

aatcgtacag ggtagtacaa ataaaaaagg cacagatcac aggcataatt ttcagtacgt 7800

tatagggcgt ttgttactaa tttattttaa cggagtaaca tttagctcgt acatgagcag 7860

cttgtgtggc tcctgacaca ggcaaaccat catcaataaa accgatggaa gggaatatca 7920

tgcgaattgg cataccaaga gaacggttaa ccaatgaaac ccgtgttgca gcaacgccaa 7980

aaacagtgga acagctgctg aaactgggtt ttaccgtcgc ggtagagagc ggcgcgggtc 8040

aactggcaag ttttgacgat aaagcgtttg tgcaagcggg cgctgaaatt gtagaaggga 8100

atagcgtctg gcagtcagag atcattctga aggtcaatgc gccgttagat gatgaaattg 8160

cgttactgaa tcctgggaca acgctggtga gttttatctg gcctgcgcag aatccggaat 8220

taatgcaaaa acttgcggaa cgtaacgtga ccgtgatggc gatggactct gtgccgcgta 8280

tctcacgcgc acaatcgctg gacgcactaa gctcgatggc gaacatcgcc ggttatcgcg 8340

ccattgttga agcggcacat gaatttgggc gcttctttac cgggcaaatt actgcggccg 8400

ggaaagtgcc accggcaaaa gtgatggtga ttggtgcggg tgttgcaggt ctggccgcca 8460

ttggcgcagc aaacagtctc ggcgcgattg tgcgtgcatt cgacacccgc ccggaagtga 8520

aagaacaagt tcaaagtatg ggcgcggaat tcctcgagct ggattttaaa gaggaagctg 8580

gcagcggcga tggctatgcc aaagtgatgt cggacgcgtt catcaaagcg gaaatggaac 8640

tctttgccgc ccaggcaaaa gaggtcgata tcattgtcac caccgcgctt attccaggca 8700

aaccagcgcc gaagctaatt acccgtgaaa tggttgactc catgaaggcg ggcagtgtga 8760

ttgtcgacct ggcagcccaa aacggcggca actgtgaata caccgtgccg ggtgaaatct 8820

tcactacgga aaatggtgtc aaagtgattg gttataccga tcttccgggc cgtctgccga 8880

cgcaatcctc acagctttac ggcacaaacc tcgttaatct gctgaaactg ttgtgcaaag 8940

agaaagacgg caatatcact gttgattttg atgatgtggt gattcgcggc gtgaccgtga 9000

tccgtgcggg cgaaattacc tggccggcac cgccgattca ggtatcagct cagccgcagg 9060

cggcacaaaa agcggcaccg gaagtgaaaa ctgaggaaaa atgtacctgc tcaccgtggc 9120

gtaaatacgc gttgatggcg ctggcaatca ttctttttgg ctggatggca agcgttgcgc 9180

cgaaagaatt ccttgggcac ttcaccgttt tcgcgctggc ctgcgttgtc ggttattacg 9240

tggtgtggaa tgtatcgcac gcgctgcata caccgttgat gtcggtcacc aacgcgattt 9300

cagggattat tgttgtcgga gcactgttgc agattggcca gggcggctgg gttagcttcc 9360

ttagttttat cgcggtgctt atagccagca ttaatatttt cggtggcttc accgtgactc 9420

agcgcatgct gaaaatgttc cgcaaaaatt aaggggtaac atatgtctgg aggattagtt 9480

acagctgcat acattgttgc cgcgatcctg tttatcttca gtctggccgg tctttcgaaa 9540

catgaaacgt ctcgccaggg taacaacttc ggtatcgccg ggatggcgat tgcgttaatc 9600

gcaaccattt ttggaccgga tacgggtaat gttggctgga tcttgctggc gatggtcatt 9660

ggtggggcaa ttggtatccg tctggcgaag aaagttgaaa tgaccgaaat gccagaactg 9720

gtggcgatcc tgcatagctt cgtgggtctg gcggcagtgc tggttggctt taacagctat 9780

ctgcatcatg acgcgggaat ggcaccgatt ctggtcaata ttcacctgac ggaagtgttc 9840

ctcggtatct tcatcggggc ggtaacgttc acgggttcgg tggtggcgtt cggcaaactg 9900

tgtggcaaga tttcgtctaa accattgatg ctgccaaacc gtcacaaaat gaacctggcg 9960

gctctggtcg tttccttcct gctgctgatt gtatttgttc gcacggacag cgtcggcctg 10020

caagtgctgg cattgctgat aatgaccgca attgcgctgg tattcggctg gcatttagtc 10080

gcctccatcg gtggtgcaga tatgccagtg gtggtgtcga tgctgaactc gtactccggc 10140

tgggcggctg cggctgcggg ctttatgctc agcaacgacc tgctgattgt gaccggtgcg 10200

ctggtcggtt cttcgggggc tatcctttct tacattatgt gtaaggcgat gaaccgttcc 10260

tttatcagcg ttattgcggg tggtttcggc accgacggct cttctactgg cgatgatcag 10320

gaagtgggtg agcaccgcga aatcaccgca gaagagacag cggaactgct gaaaaactcc 10380

cattcagtga tcattactcc ggggtacggc atggcagtcg cgcaggcgca atatcctgtc 10440

gctgaaatta ctgagaaatt gcgcgctcgt ggtattaatg tgcgtttcgg tatccacccg 10500

gtcgcggggc gtttgcctgg acatatgaac gtattgctgg ctgaagcaaa agtaccgtat 10560

gacatcgtgc tggaaatgga cgagatcaat gatgactttg ctgataccga taccgtactg 10620

gtgattggtg ctaacgatac ggttaacccg gcggcgcagg atgatccgaa gagtccgatt 10680

gctggtatgc ctgtgctgga agtgtggaaa gcgcagaacg tgattgtctt taaacgttcg 10740

atgaacactg gctatgctgg tgtgcaaaac ccgctgttct tcaaggaaaa cacccacatg 10800

ctgtttggtg acgccaaagc cagcgtggat gcaatcctga aagctctgta accctgacgg 10860

cctctgctga ggccgtcact ctttattgag a 10891

<210> 16

<211> 29

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 16

gtgcgaaatt ttcattgttg ctcctttgc 29

<210> 17

<211> 37

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 17

cttccagtgc caatatgagc cggcctaccg acacaag 37

<210> 18

<211> 41

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 18

ggccgtcact ctttattgag agtgtcatag tcgcgtacaa c 41

<210> 19

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 19

gagccggcga tgtatgacga catc 24

<210> 20

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 20

agcggttgta cgcgactatg acac 24

<210> 21

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 21

aaacgtgtca tagtcgcgta caac 24

<210> 22

<211> 29

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 22

gtgcgaaatt ttcattgttg ctcctttgc 29

<210> 23

<211> 39

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 23

cttccagtgc caatatgagc gaaagcgcca ttttcgacc 39

<210> 24

<211> 39

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 24

gccgtcactc tttattgaga gtcagcgggg ataatccgt 39

<210> 25

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 25

gagccataac cggtcggatc atcc 24

<210> 26

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 26

agcggttgta cgcgactatg acac 24

<210> 27

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 27

aaacgtgtca tagtcgcgta caac 24

<210> 28

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 28

aagctttacg cgaacgagc 19

<210> 29

<211> 29

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 29

gtgcgaaatt ttcattgttg ctcctttgc 29

<210> 30

<211> 38

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 30

gctcgttcgc gtaaagcttg tacgtcacgg atcaatgc 38

<210> 31

<211> 50

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 31

cttccagtgc caatatgagc cgaatgaata ctcgatctat aaagaaaaag 50

<210> 32

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 32

gagcaaccaa accagtgatg gaac 24

<210> 33

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 33

agcgagtatt cattcggtac gtca 24

<210> 34

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 34

aaactgacgt accgaatgaa tact 24

<210> 35

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 35

gtgctcgtta ctgcctgtcc agtc 24

<210> 36

<211> 41

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 36

gctcgttcgc gtaaagcttc agtttgacgt aaggattctg c 41

<210> 37

<211> 42

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 37

cttccagtgc caatatgagc ctggtggtgt ttggtcgtga cg 42

<210> 38

<211> 29

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 38

gagcgctgga aggtaataca gttatccac 29

<210> 39

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 39

agcggaatcc ttacgtcaaa ctgc 24

<210> 40

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 40

aaacgcagtt tgacgtaagg attc 24

<210> 41

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 41

ctgaccgtac caacctgca 19

<210> 42

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 42

cctgataagc gtagcgcat 19

<210> 43

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 43

gtgcgtttgc cgactactca cg 22

<210> 44

<211> 41

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 44

tgcaggttgg tacggtcagg cgctaaggtt agcacgtaaa t 41

<210> 45

<211> 41

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 45

atgcgctacg cttatcaggc cgcacatttg cgttttatta t 41

<210> 46

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 46

gagcacattc aggtgatgta cgcc 24

<210> 47

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 47

agcgacgcaa atgtgcgggc gcta 24

<210> 48

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 48

aaactagcgc ccgcacattt gcgt 24

<210> 49

<211> 27

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 49

ggatccataa tcaggatcaa taaaact 27

<210> 50

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 50

aggatccgca aaatggcc 18

<210> 51

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 51

gtgcggctct tcaggaagta cttattac 28

<210> 52

<211> 46

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 52

gttttattga tcctgattat ggatcccagt ccacgcatcg gaatag 46

<210> 53

<211> 39

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 53

ggccattttg cggatcctaa cgccataacc agtctgaat 39

<210> 54

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 54

gagcctgaac gaatgcgttt tgg 23

<210> 55

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 55

agcgatggcg ttcagtccac gcat 24

<210> 56

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthesis by hand

<400> 56

aaacatgcgt ggactgaacg ccat 24

Claims

1. An L-homoserine producing strain, characterized in that it has a single stable chromosome, does not contain plasmid forms or other episomal DNA vectors, and has thrB gene knocked out on its chromosomal DNA; thrL gene is knocked out; the thrA gene is mutated to thrA, and the thrA has the property of inhibiting feedback inhibition of the product; and the rhtA, thrA, ppc, pntAB and aspA genes are over-expressed or enhanced, wherein the over-expression or enhancement of rhtA is achieved by rhtA23, the L-homoserine producing strain is E.coli K-12 strain, and the thrA is the thrA gene mutated from G to R at position 433.

2. An L-homoserine producing strain, characterized in that it has a single stable chromosome, does not contain plasmid forms or other episomal DNA vectors, and has thrB gene knocked out on its chromosomal DNA; thrL gene is knocked out; the thrA gene is mutated to thrA, and the thrA has the property of inhibiting feedback inhibition of the product; and the rhtA, thrA, ppc, pntAB, aspA, aspC and asd genes are over-expressed or enhanced, wherein the over-expression or enhancement of rhtA is achieved by rhtA23, the L-homoserine producing strain is escherichia coli K-12 strain, and the thrA is the thrA gene mutated from G to R at position 433.

3. The L-homoserine producing strain according to claim 1 or 2, wherein the strain is escherichia coli K-12 wild-type MG1655.

4. A method of constructing an L-homoserine producing strain according to any one of claims 1 to 3, comprising the following steps in any order:

A. knocking out thrB gene in the strain;

B. overexpressing the rhtA gene in the strain;

C. knocking out thrL gene in the strain;

D. thrA gene in the mutant strain is thrA, which has the property of inhibiting feedback inhibition of the product;

E. integrating thrA, ppc, pntAB and aspA genes or thrA, ppc, pntAB, aspA, aspC and asd genes in multiple copies into chromosomal DNA in the strain for overexpression;

the L-homoserine producing strain is an escherichia coli K-12 strain, and thrA is a thrA gene mutated from G to R at 433 th position.

5. The method according to claim 4, wherein the strain is Escherichia coli K-12 wild-type MG1655.

6. Use of the L-homoserine producer strain according to any one of claims 1 to 3 for producing L-homoserine.