CN112725355A

CN112725355A - Dragon fruit HuNIP6 and 1 gene for promoting early flowering of plants and application thereof

Info

Publication number: CN112725355A
Application number: CN202110171710.0A
Authority: CN
Inventors: 秦永华; 叶小滢; 张志珂; 胡桂兵; 赵杰堂
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2021-02-08
Filing date: 2021-02-08
Publication date: 2021-04-30
Anticipated expiration: 2041-02-08
Also published as: CN112725355B

Abstract

The invention discloses a dragon fruit HuNIP6 for promoting the early flowering of plants; 1 gene and application thereof. The invention firstly provides a dragon fruit HuNIP6 for promoting the early flowering of plants; 1 gene, the nucleotide sequence of which is shown in SEQ ID NO. 1. The invention controls the dragon fruit HuNIP6 that the plant blooms through the agrobacterium-mediated arabidopsis genetic transformation method; 1, the function of the gene is verified, and the fact that the gene is expressed in a heterologous way can enable the flowering time of a transgenic plant to be obviously earlier than that of a wild type plant is found, so that the gene has the function of regulating and controlling the early flowering of the plant; the gene is used for improving plant varieties, the harvest period of vegetables or fruits can be shortened, the yield and economic benefits are improved, and germplasm resources are provided for enriching and balancing the crop market in China.

Description

A dragon fruit HuNIP6 for promoting early flowering of plant; 1 gene and application thereof

Technical Field

The invention relates to the technical field of molecular biology, in particular to a dragon fruit HuNIP6 for promoting early flowering of plants; 1 gene and application thereof.

Background

Pitaya, also known as red dragon fruit, immortal fruit, sweetberry, etc., is a cultivated plant of Cactaceae (Cactaceae) genus (Hylocereus) or Bidens (Selenicerus). The dragon fruit is a new fruit with high nutritive value and economic value, and is popular with consumers since the improvement of the dragon fruit is introduced into China. The pitaya flower, also called sword flower, overlord flower, gaultheria flower and the like, is a flower under the ovary, is funnel-shaped, has the length of about 35cm, has the diameter of 25-30 cm when being opened, has strong flower fragrance and has great ornamental value. The dragon fruit is blossoming at night, and gradually closes and withers when the dragon fruit is bright, and is a flowering mode with circadian rhythm. In order to improve the yield and economic benefit of the dragon fruit, artificial pollination is generally carried out in production, but the production cost is increased.

Flowering is an important process of plant transformation from vegetative to reproductive growth, an important agronomic trait that determines whether a plant is adapted to a particular cultivation area and growing season. Plant flowering is the key to the change of plant growth from vegetative to reproductive growth. Under the influence of external environment and internal factors, plants can bloom at proper time and then grow in a reproductive mode. By adjusting the flowering period, the plants are enabled to bloom in a delayed or advanced way, the vegetative growth or reproductive growth of the plants can be controlled, and the harm of adverse circumstances to crops is avoided. The flowering in the most suitable period can achieve the maximum benefit, promote the accumulation, distribution and effective utilization of resources and have great significance for improving the crop yield.

Aquaporin (Aquaporin) is a multifunctional membrane protein that plays an essential role in the growth and development of many plants. Besides water transportation, the aquaporins can also realize transmembrane transportation of small molecular solutes, gases and metal ions, participate in leaf stomatal movement, photosynthesis and plant flowering processes, and can effectively resist various stress resistance stresses. The role of Aquaporin in dragon fruit flowering has not been reported. Therefore, in the field, a gene which can promote the plants to bloom in advance needs to be screened in the dragon fruit blooming mode, the plant variety improvement is carried out, the harvest period of vegetables and fruits is shortened, the yield and the economic benefit are improved, and germplasm resources are provided for enriching and balancing the crop market in China.

Disclosure of Invention

The invention aims to provide a dragon fruit HuNIP6 for promoting the early flowering of plants; 1 gene and application thereof. The invention provides theoretical basis and technical means for regulating and controlling the flowering time of plants, has wide application prospect in production for promoting the plants to bloom in advance, and has great application value.

The invention has the first aim of providing a dragon fruit HuNIP6 for promoting the early flowering of plants; 1 gene.

It is a second object of the present invention to provide a method of promoting premature flowering in plants by HuNIP6;1 protein.

The third object of the present invention is to provide a recombinant vector.

The fourth purpose of the invention is to provide a recombinant engineering bacterium.

It is a fifth object of the present invention to provide said HuNIP6;1 gene, the HuNIP6;1, the recombinant vector or the recombinant engineering bacterium in promoting the early flowering of plants.

The sixth object of the present invention is to provide a method for promoting premature flowering of plants.

It is a seventh object of the present invention to provide a set for amplifying said HuNIP6;1 gene.

It is an eighth object of the present invention to provide a set for identifying said HuNIP6;1 gene.

In order to achieve the purpose, the invention is realized by the following technical scheme:

the invention provides a dragon fruit HuNIP6 for promoting the early flowering of plants; 1 gene, the nucleotide sequence of which is shown in SEQ ID NO. 1.

A HuNIP6 for promoting early flowering of plants; 1, and the amino acid sequence of the protein is shown as SEQ ID NO. 2.

Preferably, said plant premature flowering promoting HuNIP6;1 protein is encoded by the HuNIP6;1 gene code.

The invention claims a recombinant vector, which contains the HuNIP6;1 gene.

And claim a kind of recombinant engineering bacterium, contain said HunIP6;1 gene or the recombinant vector.

The HunIP6;1 gene, the HuNIP6;1, the recombinant vector or the recombinant engineering bacterium in promoting the early flowering of plants, and also belongs to the protection scope of the invention.

Preferably, said use is the expression or overexpression of said HuNIP6 in a plant; 1 gene and/or the HuNIP6 of claim 2; 1 protein.

Preferably, the plant is a crucifer.

The invention also claims a method for promoting the early flowering of plants, which comprises the steps of mixing the HuNIP6;1 gene into a plant.

Preferably, said recombinant vector or said recombinant engineered bacterium is transformed into a plant for expression or overexpression of said HuNIP6;1 gene.

More preferably, the method comprises the following specific steps:

s1, mixing HuNIP6;1 gene is constructed on an expression vector driven by 35S to obtain a recombinant vector.

S2, transferring the recombinant vector obtained in the step S1 into engineering bacteria to obtain the recombinant engineering bacteria.

S3, transforming the recombinant engineering bacteria of the step S3 into plants.

More preferably, the expression vector of step S1 is pppzp 6k 90.

More preferably, the engineering bacterium in step S2 is agrobacterium tumefaciens.

More preferably, the plant is a crucifer.

Further preferably, the plant is arabidopsis thaliana.

The invention also claims:

a set for amplifying said HuNIP6;1, the nucleotide sequence of the primer is shown in SEQ ID NO. 3-4.

A panel for identifying said HuNIP6; the nucleotide sequence of the primer of the positive transgenic plant of the gene 1 is shown in SEQ ID NO. 7-8.

The sequence is specifically as follows:

SEQ ID NO.3：ATGGATGCTGAGGATCCCGG；

SEQ ID NO.4：TCATCTCCGGAAGCTTGGTG；

SEQ ID NO.7：

CATTCTACAACTACATCTAGAATGGATGCTGAGGATCCCGG；

SEQ ID NO.8：

AGCTTGCATGCCAATTCTAGATCATCTCCGGAAGCTTGGTG。

compared with the prior art, the invention has the following beneficial effects:

the invention provides a dragon fruit HuNIP6 for promoting the early flowering of plants; 1 gene. The invention clones HuNIP6 for regulating and controlling the flowering of the dragon fruit for the first time; 1 gene, which is a member of Aquaporin gene family, has the length of 915bp and encodes 304 amino acids. The dragon fruit HuNIP6 for regulating the flowering of the plants is subjected to genetic transformation by using agrobacterium-mediated arabidopsis; 1 gene function is verified, and the discovery that the heterologous expression of the gene can enable the flowering time of a transgenic plant to be obviously earlier than that of a wild type shows that the gene has the function of regulating and controlling the early flowering of the plant.

Therefore, the invention provides theoretical basis and technical means for regulating and controlling the flowering time of plants, has wide application prospect in production for promoting the plants to bloom in advance, and has great application value; the gene is used for improving plant varieties, the harvest period of vegetables or fruits can be shortened, the yield and economic benefits are improved, and germplasm resources are provided for enriching and balancing the crop market in China.

Drawings

FIG. 1 is a dendrogram of the genes of Hylocereus undulatus and other species Aquaporin.

FIG. 2 is an agarose gel electrophoresis of total RNA from pitaya flowers.

Fig. 3 is HuNIP6;1 agarose gel electrophoresis picture of gene clone amplification.

Fig. 4 is HuNIP6;1 gene subcellular localization map.

Fig. 5 is a HuNIP6; agarose gel electrophoresis picture of PCR amplification product of 1 gene Arabidopsis thaliana.

Fig. 6 is a HuNIP6; phenotype map of 1-gene Arabidopsis thaliana and wild-type Arabidopsis thaliana.

Detailed Description

The invention is described in further detail below with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.

Example 1 screening and cloning of genes related to nighttime flowering of Pitaya

1. Screening and cluster analysis of pitaya night flowering related genes

Adopting an 'Aquaporin' keyword to search 44 gene sequences in a pitaya genome database, eliminating an incomplete MIP structural domain or an incomplete NPA motif, and finally screening 1 related gene HuNIP6 with complete structure and flowering at night of the pitaya; 1. the full-length sequence of amino acids of Aquaporin gene used for construction of the phylogenetic tree was downloaded using TAIR (https:// www.arabidopsis.org /) and NCBI database (https:// www.ncbi.nlm.nih.gov), and the Bootstrap value (set-up value) of the phylogenetic tree was constructed 1000 times by MEGAX software using the maximum likelihood method, and the phylogenetic tree results are shown in FIG. 1.

2. Hunip6;1 Gene sequence analysis and physicochemical Properties of amino acid sequence

Hunip6; the nucleotide sequence of the 1 gene is shown as SEQ ID NO.1, HuNIP6; the cDNA total length of the gene 1 is 915bp, the gene encodes 304 amino acid proteins in total, the amino acid sequence is shown as SEQ ID NO.2, the isoelectric point is 6.07, the molecular weight of the protein is 31.43kD, and the protein is positioned on the chromosome 3 of the pitaya.

3. Extraction of total RNA and first strand cDNA synthesis of pitaya flower sample

Total RNA of pitaya 'Hongguan No. 1' flower is extracted by adopting an EASYspin Plus plant RNA rapid extraction kit (RN38) (Aidlab, China) (the specific method refers to the instruction), 2 mu L of RNA solution is placed on a nucleic acid determinator to detect the concentration and purity of the RNA, 1% agarose gel is used for electrophoresis to detect the integrity of the RNA solution, and samples meeting the conditions are used for the next experiment.

The agarose gel electrophoresis detection result is shown in fig. 2, and it can be seen that the total RNA of the pitaya flower presents clear 28S and 18S bands, the brightness of 28S is about twice of the brightness of 18S, no tailing phenomenon exists, no genome DNA pollution is caused, the extracted total RNA has high quality, no obvious degradation is caused, and the requirement of subsequent experiments can be met.

After the band meets the requirement, the total RNA is reversely transcribed into cDNA by using PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa, Japan), and the specific operation refers to the instruction. And detecting the cDNA by using a reference gene Actin in the dragon fruit, and storing the cDNA at the temperature of 20 ℃ below zero for later use.

4. Hunip6;1 cloning of the Gene

(1) Hunip6;1 amplification and detection of Gene

Cloning HuNIP6 by using a specific primer by taking cDNA of pitaya flowers as a template; 1 reaction System and reaction procedure with specific reference to I-5^TM2 × High-Fidelity Master Mix (MCLAB, America). According to HuNIP6;1 gene (SEQ ID NO.1), primers are designed at the initiator and terminator positions respectively by using Primer Premier 5.0 software, the Primer sequences are shown as SEQ ID NO. 3-4, and the primers are synthesized by Egyptian bioengineering (Guangzhou) Limited.

SEQ ID NO.3：ATGGATGCTGAGGATCCCGG；

SEQ ID NO.4：TCATCTCCGGAAGCTTGGTG。

The amplification conditions were: at 98 deg.C for 2 min; 35 cycles of 98 deg.C, 10s, 56 deg.C, 15s, 72 deg.C, 5 min; 72 deg.C, 10 min. After the reaction is finished, 2 mu L of amplification product is taken for gel electrophoresis, and whether the PCR amplification product is correct or not is detected. The amplification result is shown in FIG. 3, and a band is evident at 915bp, indicating that the PCR amplification product is correct.

(2) Recovery of PCR products

And (3) completely using the PCR amplification products for common agarose gel electrophoresis, cutting gel under an ultraviolet lamp by using a scalpel, and finally recovering by using a StarPrep rapid DNA gel recovery kit, wherein the specific method is shown in the specification. And after recovery, taking a proper amount of product to perform agarose gel electrophoresis detection, and detecting the purity and concentration of the recovered product on a nucleic acid determinator.

(3) Ligation and transformation of the fragment of interest

The molar ratio of glue recovered purified product to pEASY-Blunt cloning vector was 7: 1 the purified product was ligated to the support at 25 ℃ for 10min, with particular reference

Instructions for use of the Cloning Kit (TransGen, Beijing). Sucking the ligation product, adding the ligation product into 50 mu L of Transl-T1 competent cells, flicking and mixing uniformly, performing ice bath for 30min, performing water bath heat shock for 30s at 42 ℃, immediately placing on ice for 2min, adding 500 mu L of LB culture solution on a clean bench, performing shaking culture at 37 ℃ and 200rpm for 1h, centrifuging at 5000rpm for 1min, leaving 100 mu L of supernatant, resuspending the precipitate with a gun head, sucking 30 mu L of the supernatant, and coating the supernatant containing 100 mu g mL of the supernatant^-1Amp LB solid plate culture medium, in 37 degrees C incubator inverted overnight culture. On day 2, colonies were picked with sterilized toothpicks to contain 100. mu.g mL^-1Amp 500 mu L LB liquid culture solution, after shaking culture at 37 ℃ and 200rpm for 3-4 h, bacteria solution PCR detection positive clone, the concrete steps refer to 2 xTaq Master Mix (Vazyme, Nanjing) use instruction, bacteria solution with correct amplification product strip size is selected for sequencing, the sequencing is completed in Guangzhou Aiji biological Limited company, the sequence returned by the sequencing is compared with the sequence in the genome, and finally the sequence is obtainedHunip6;1 gene.

Example 2 HuNIP6;1 Gene subcellular localization analysis

1. Construction of vectors

The vector of the subcellular localization experiment selects pC18-GFP vector, selects Hind III and BamH I as recombination sites, and uses Primer Premier 5.0 software to design a Primer (the sequence is shown as SEQ ID NO. 5-6) with a vector homology arm to amplify HuNIP6;1 cDNA full-Length sequence of Gene (not including stop codon), reference

The HD Cloning kit (TaKaRa, Japan) was used to ligate the amplification product to pC18-GFP vector, and the PCR recombinant plasmid was transformed into E.coli Transl-T1 competent cells in the same manner as in example 1, with the antibiotic Kan. Carrying out PCR detection and sequencing on bacterial liquid by using primers (the primer sequences are shown as SEQ ID NO.5 and 6) with vector homologous arms, and sequencing a positive strain detected by the PCR to obtain pC18-HuNIP 6;1 subcellular localization of recombinant plasmids. The primer sequences are as follows:

SEQ ID NO.5：

GTCGACGGTATCGATAAGCTTATGGATGCTGAGGATCCCGG；

SEQ ID NO.6：

TTTACTCATACTAGTGGATCCTCTCCGGAAGCTTGGTG。

2. recombinant plasmid transformed agrobacterium tumefaciens

Aspirating 3 μ L (about 200ng) of recombinant plasmid pC18-HuNIP 6;1 into 50 mul Agrobacterium tumefaciens GV 3101-pseudo competence, flicking the tube, mixing well, putting on ice for 30min, freezing with liquid nitrogen for 5min, water bathing at 37 ℃ for 5min, ice bathing for 2min, adding 500 mul YEP liquid culture medium without antibiotic into a super clean bench, shaking and culturing at 28 ℃ and 200rpm for 3-4 h, centrifuging at 5000rpm for 1min, leaving 100 mul supernatant, resuspending the precipitate with a gun head, sucking 30 mul and spreading on YEP solid plate culture medium (containing antibiotic 100 mu g mL^-1Kan and 50. mu.g mL^-1Rif), culturing in an inverted manner in an incubator at 28 ℃ for 2-3 days, and picking a single colony with a sterilized toothpick to a medium containing 100 mu g mL of the single colony^-1Kan and 50. mu.g mL ^-1500 μ L of Rif YEP liquid culture MediumIn (3), the mixture was cultured overnight at 28 ℃ with shaking at 200 rpm. And (5) performing PCR verification on the bacterial liquid, and storing the positive agrobacterium tumefaciens strain with the correct verification result for later use.

3. Agrobacterium tumefaciens-mediated transient expression of nicotiana benthamiana leaves

Transformation into GV3101-psoup-p19 competence was performed as described in 2 above using pAN95-At5g19750 (for membrane localization) as a control. Culturing the bacterial liquid to OD₆₀₀After changing to 0.6-0.8, MAA resuspension (0.5. mu.M MES, 0.02. mu.M AS, 0.5. mu.M MgCl)₂pH 5.7) resuspension to OD₆₀₀0.4. By using the agrobacterium tumefaciens-mediated transient expression technology of the Nicotiana benthamiana leaf, At5g19750 is fused with RFP, and HuNIP6;1 gene was fused with GFP, and the fused two were mixed at a ratio of 1:1, and the mixture was injected into Nicotiana benthamiana leaves using a 1mL syringe, and simultaneously, Agrobacterium containing the empty vector pC18 was injected as a control.

Taking tobacco leaves which are infiltrated by agrobacterium for 48h, and shearing the leaves in an infiltration area to about 1cm by using scissors²Small pieces, placed on the slide at the drop and soaked, carefully cover the slide with forceps, taking care not to leave air bubbles. Placing the prepared sheet under a Zeiss laser confocal microscope (ZEISS LCM-800), arranging an eyepiece of the microscope to 20 x, adjusting to clearly observe epidermal cells of the leaf under a bright field, operating software, selecting an excitation wavelength of 488nm of GFP and an excitation wavelength of 610nm of mCherry, scanning under different excitation lights respectively, selecting an area of most cells on the same plane, adjusting fluorescent field GFP, mChery and bright field gain to be optimal, performing double-channel fluorescence imaging, and taking a picture, wherein the result is shown in figure 4.

Results As shown in FIG. 4, the combination of GFP fluorescence and RFP fluorescence revealed that At5g19750-RFP and HuNIP6; 1-GFP fluorescence can overlap, which indicates that HuNIP6;1 are located on the cell membrane.

Example 3 HuNIP6;1 functional verification of Gene

1. Construction of vector, recombinant plasmid and transformation of Agrobacterium tumefaciens

Mixing HuNIP6; the gene 1 is constructed on an expression vector pPZP6k90 driven by 35S, the antibiotic is Kan, the recombination enzyme cutting site is Xba I, and a primer with a sequence shown in SEQ ID NO. 7-8 is designed. The connected vector plasmid is transferred into agrobacterium GV3101, and is detected as positive bacteria liquid through PCR and stored for further use, and the specific operation is the same as that in example 2. The primer sequences are as follows:

SEQ ID NO.7：

CATTCTACAACTACATCTAGAATGGATGCTGAGGATCCCGG；

SEQ ID NO.8：

AGCTTGCATGCCAATTCTAGATCATCTCCGGAAGCTTGGTG。

2. agrobacterium tumefaciens mediated transformation of Arabidopsis thaliana

(1) In a clean bench, 1mL of the above-mentioned bacterial suspension was added to 200mL of YEP medium (containing 100. mu.g mL of antibiotic)^- ¹Kan and 50. mu.g mL^-1Rif), incubated overnight at 28 ℃ with shaking at 220rpm until OD₆₀₀1.0. Centrifuging at 4000rpm for 15min, collecting thallus, and soaking in flower infiltration culture medium [1/2MS + 5% sucrose + 0.03% surfactant (Silwet L-77) with pH of 5.8]Diluting the cells to OD₆₀₀About 0.8 for standby.

(2) Selecting strong arabidopsis plants in full-bloom stage, cutting off pods and already opened flowers, horizontally placing the arabidopsis plants to be transformed, completely immersing flower buds in the agrobacterium suspension for 1min, then moving the culture pot away and inverting the culture pot and placing the culture pot into a large disc, and completely draining the redundant liquid. Covering the treated arabidopsis thaliana with a plastic cover, culturing in the dark for 24h, and then putting the arabidopsis thaliana in the illumination condition of 23-25 ℃ for normal growth. The dip dyeing can be carried out once more after 1 week. After 3-4 weeks, after the pod of Arabidopsis thaliana begins to turn yellow, the pod of Arabidopsis thaliana is cut off and placed in a culture dish for drying, and when most of the pod of Arabidopsis thaliana turns yellow, all seeds can be collected and stored in a 1.5mL centrifuge tube (appropriate silica gel can be placed in the tube for drying). After the seeds are completely dried, the seeds are placed in a 1.5mL new centrifuge tube for short-term storage at 4 ℃, and if necessary, the seeds can be placed in a refrigerator at-20 ℃ for long-term storage.

(3) Taking part of arabidopsis thaliana seeds (200-300 grains) on a superclean bench into a sterilized 1.5mL centrifuge tube, and treating the seeds with 70% alcohol for 2 times for 30s each time; suspending the seeds with absolute ethanol, and pouring onto a sterilized filter paper; after the absolute ethyl alcohol is volatilized, uniformly mixing the seedsSowed in seed germination medium (1/2MS +30g L)^-1Sucrose + 5-6 g L^-1Agar + 100. mu.g mL^-1Kan, pH5.8); and sealing the culture dish by using Parafilm, treating the culture dish at 4 ℃ for 24 hours, then placing the culture dish under the condition of 16 hours of illumination/8 hours of darkness for culturing for 7-10 days, transplanting the culture dish into a nutrition pot, and placing the culture dish in a culture room for culturing for 3-4 weeks for next-step identification.

3. Identification of transgenic plants

Extracting the genome DNA of the resistant plant by using a novel plant genome DNA rapid extraction kit (Aidlab, China), and then performing PCR identification by using 2 xTaq Master Mix (Vazyme, Beijing), wherein the specific steps refer to an instruction book, and the PCR primer is a primer with a sequence shown in SEQ ID NO. 7-8. After the reaction is finished, 2 mu L of amplification product is taken for gel electrophoresis, and whether the PCR amplification product is correct or not is detected. The amplification result is shown in FIG. 5, a band is obvious at 915bp, which indicates that the plant is HuNIP6;1 gene plant.

4. Phenotypic observations of transgenic plants

trans-HuNIP 6; the results of the Arabidopsis phenotype identification of gene 1 are shown in FIG. 6, and it can be seen that the HuNIP6; the flowering time of the arabidopsis thaliana plant with the gene 1 is obviously earlier than that of the wild type arabidopsis thaliana, and the conditions of the bolting height, the number of flower buds, the number of fruit pods, the number of lotus throne leaves and the bolting number of the wild type arabidopsis thaliana and the transgenic arabidopsis thaliana of different strains are observed and recorded, so that the results are shown in table 1 and are transferred into HuNIP6; the bolting height, the number of flower buds, the number of fruit pods, the number of lotus throne leaves and the bolting number of the arabidopsis thaliana plant with the gene 1 are all higher than those of wild arabidopsis thaliana, which indicates HuNIP6;1 has the function of promoting the early flowering of plants.

TABLE 1 growth status observations of different Arabidopsis lines

It should be finally noted that the above examples are only intended to illustrate the technical solutions of the present invention, and not to limit the scope of the present invention, and that other variations and modifications based on the above description and thought may be made by those skilled in the art, and that all embodiments need not be exhaustive. Any modification, equivalent replacement, and improvement made within the spirit and principle of the present invention should be included in the protection scope of the claims of the present invention.

Sequence listing

<110> southern China university of agriculture

<120> dragon fruit HuNIP6, gene 1 for promoting early flowering of plants and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 915

<212> DNA

<213> HuNIP6, gene 1

<400> 1

atggatgctg aggatcccgg ttcaacaccc tcaaccccaa tgaccccagg aactcctggg 60

gctcccctgt ttggaggatt tagcggagac agacccacca caaccccaaa gaaatccctc 120

ctcggcaact gcttcacagt tgaaacttgg cctaatgagg aagggagctt gcctgctgtc 180

acctgcacta tgacaatgcc acctccctct gtccctctat ttaagaaggt agtggcagag 240

ttcatgggca ccctgatact tatctttgct gggactgcca cagcaattgt aaaccagaag 300

acacagggct cggagacact tatcggatgt gcggcctcca gtggccttgc agttatgata 360

gtcatccttg caacaggtca catctctggt gcccatctca atccatctct caccattgct 420

ttcgcagcac tgaaacattt tccatggacc caagtgccgg cgtacattgc agcacaaatg 480

ctagcatctt tatgtgcagc attcttgctc aagggggttt tccatcccat gatgggggga 540

ggagtgactg ttccttctgt aaattatggt caagcttttg ctcttgagtt catcatcacc 600

ttcaacctaa tgttcgttgt cacagctgtt gccactgaca ccagagcagt tggagaacta 660

gcgggaattg cggtaggggc aactgtcatg ctcaacatac tcatagccgg gcctgcaact 720

ggggcatcaa tgaacccagt taggacgctg ggaccagcca tagccgtaaa caacttcaaa 780

ggaatatgga tatacttcac agccccaatc ctgggagcac tctgtggggc aggtgtctat 840

actgctgtca ggctgccaga agaggatgaa gacgccctca agcagccttc agcagcacca 900

agcttccgga gatga 915

<210> 2

<211> 304

<212> PRT

<213> HuNIP6, protein 1

<400> 2

Met Asp Ala Glu Asp Pro Gly Ser Thr Pro Ser Thr Pro Met Thr Pro

1 5 10 15

Gly Thr Pro Gly Ala Pro Leu Phe Gly Gly Phe Ser Gly Asp Arg Pro

20 25 30

Thr Thr Thr Pro Lys Lys Ser Leu Leu Gly Asn Cys Phe Thr Val Glu

35 40 45

Thr Trp Pro Asn Glu Glu Gly Ser Leu Pro Ala Val Thr Cys Thr Met

50 55 60

Thr Met Pro Pro Pro Ser Val Pro Leu Phe Lys Lys Val Val Ala Glu

65 70 75 80

Phe Met Gly Thr Leu Ile Leu Ile Phe Ala Gly Thr Ala Thr Ala Ile

85 90 95

Val Asn Gln Lys Thr Gln Gly Ser Glu Thr Leu Ile Gly Cys Ala Ala

100 105 110

Ser Ser Gly Leu Ala Val Met Ile Val Ile Leu Ala Thr Gly His Ile

115 120 125

Ser Gly Ala His Leu Asn Pro Ser Leu Thr Ile Ala Phe Ala Ala Leu

130 135 140

Lys His Phe Pro Trp Thr Gln Val Pro Ala Tyr Ile Ala Ala Gln Met

145 150 155 160

Leu Ala Ser Leu Cys Ala Ala Phe Leu Leu Lys Gly Val Phe His Pro

165 170 175

Met Met Gly Gly Gly Val Thr Val Pro Ser Val Asn Tyr Gly Gln Ala

180 185 190

Phe Ala Leu Glu Phe Ile Ile Thr Phe Asn Leu Met Phe Val Val Thr

195 200 205

Ala Val Ala Thr Asp Thr Arg Ala Val Gly Glu Leu Ala Gly Ile Ala

210 215 220

Val Gly Ala Thr Val Met Leu Asn Ile Leu Ile Ala Gly Pro Ala Thr

225 230 235 240

Gly Ala Ser Met Asn Pro Val Arg Thr Leu Gly Pro Ala Ile Ala Val

245 250 255

Asn Asn Phe Lys Gly Ile Trp Ile Tyr Phe Thr Ala Pro Ile Leu Gly

260 265 270

Ala Leu Cys Gly Ala Gly Val Tyr Thr Ala Val Arg Leu Pro Glu Glu

275 280 285

Asp Glu Asp Ala Leu Lys Gln Pro Ser Ala Ala Pro Ser Phe Arg Arg

290 295 300

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggatgctg aggatcccgg 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcatctccgg aagcttggtg 20

<210> 5

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gtcgacggta tcgataagct tatggatgct gaggatcccg g 41

<210> 6

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tttactcata ctagtggatc ctctccggaa gcttggtg 38

<210> 7

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cattctacaa ctacatctag aatggatgct gaggatcccg g 41

<210> 8

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

agcttgcatg ccaattctag atcatctccg gaagcttggt g 41

Claims

1. A dragon fruit HuNIP6 for promoting early flowering of plant; 1 gene, characterized in that the nucleotide sequence is shown as SEQ ID NO. 1.

2. A HuNIP6 for promoting early flowering of plants; 1 protein, characterized in that the amino acid sequence is shown as SEQ ID NO. 2.

3. A recombinant vector comprising the HuNIP6 of claim 1; 1 gene.

4. A recombinant engineered bacterium comprising the HuNIP6 of claim 1; 1 gene or the recombinant vector of claim 3.

5. The HuNIP6 of claim 1; 1 gene, HuNIP6 of claim 2; the use of the protein 1, the recombinant vector of claim 3 or the recombinant engineered bacterium of claim 4 for promoting early flowering of plants.

6. The use according to claim 5, wherein the HuNIP6 of claim 1 is expressed or overexpressed in a plant; 1 gene and/or the HuNIP6 of claim 2; 1 protein.

7. A method of promoting premature flowering in a plant by introducing the HuNIP6 of claim 1; 1 gene into a plant.

8. The method of claim 7, wherein said recombinant vector of claim 3 or said recombinant engineered bacterium of claim 4 is transformed into a plant to express or overexpress said HunIP6;1 gene.

9. A set for amplifying HuNIP6 of claim 1; 1 gene primer, characterized in that, the nucleotide sequence is shown in SEQ ID NO. 3-4.

10. A set for identifying the HuNIP6 of claim 1; 1 gene, which is characterized in that the nucleotide sequence is shown as SEQ ID NO. 7-8.