CN112724211A - Application of potato tonoplast monosaccharide transporter StTMT2 gene in improving plant sugar content - Google Patents
Application of potato tonoplast monosaccharide transporter StTMT2 gene in improving plant sugar content Download PDFInfo
- Publication number
- CN112724211A CN112724211A CN202011559640.8A CN202011559640A CN112724211A CN 112724211 A CN112724211 A CN 112724211A CN 202011559640 A CN202011559640 A CN 202011559640A CN 112724211 A CN112724211 A CN 112724211A
- Authority
- CN
- China
- Prior art keywords
- potato
- gene
- sttmt2
- plant
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
Abstract
The invention relates to an application of a potato tonoplast monosaccharide transporter StTMT2 gene in improving the content of plant sugar, belonging to the technical field of plant genetic engineering. The invention provides an application of a potato tonoplast monosaccharide transporter StTMT2 gene or protein or a recombinant vector, an expression cassette or a recombinant bacterium containing the gene in the aspects of improving the plant sugar content and the expression of genes related to sugar metabolism. The application of the invention has important production significance for improving the sugar content and the yield of crops, screening germplasm materials, directional breeding and the like.
Description
The invention is the divisional application of the invention with the application number of CN202010708958.1 and the name of 'application of potato tonoplast monosaccharide transporter StTMT2 gene', the application date of which is 2020, 7, month and 22.
Technical Field
The invention relates to the technical field of plant genetic engineering, in particular to application of a potato tonoplast monosaccharide transporter StTMT2 gene.
Background
The potato (Solanum tuberosum L.) can be used as both food and vegetable, and has high nutritive value and long industrial chain. The tuber is the only form of potato yield, and the starch in the tuber is derived from monosaccharide and sucrose synthesized by photosynthesis of leaves, is transported to the tuber from a source organ for a long distance to be stored or is partially decomposed into the monosaccharide, so that energy is provided for tuber development and the like.
Sugar transport in plants from the source organs to the sink organs is mainly accomplished by sugar transporters that mediate long-distance transport of sugars in the phloem. Approximately 80% of the sugar produced by photosynthesis is transported through the leaf's microtubule system to other parts of the plant, and plays a key role in the development of crop yield. There are at least 69 sugar transporters in Arabidopsis, which belong to 8 subfamilies: sucrose transporter (SUC/SUT), hexose transporter (STP/HXT), polyol transporter (PLT), inositol transporter (myo-inositol transporter, ITR/MIT), plastid transporter (pGlcT), monosaccharide transporter (AZT/MSSP). StSUT1 has been shown to be responsible for the transport of sugar in the sieve tube, mediating the transport of sugar from the phloem to other tissues and organs; after the antisense inhibition of SUT in potatoes, sucrose loading is blocked, so that the sucrose content in leaves is greatly increased. Antisense inhibits the leaf edges of the plants from curling and yellowing, and tubers are significantly reduced.
Monosaccharide transporters are important components of sugar transporters, and play a role in transport, absorption, utilization and accumulation of monosaccharides. It has been shown that there are 54 sugar transporters in potato genome, 20 of which are monosaccharide transporters, but no report on the analysis of monosaccharide transporters, especially the function of the monosaccharide transporter positioned by tonoplast membrane has been found. Identifying tonoplast monosaccharide transporter in potato, deeply analyzing the function of the tonoplast monosaccharide transporter, not only being beneficial to understanding the effect of the tonoplast monosaccharide transporter on plant growth and development, but also being capable of analyzing the influence on yield and agricultural product quality, and further providing reference for breeding.
Disclosure of Invention
The invention aims to provide application of a potato tonoplast monosaccharide transporter StTMT2 gene. The application of the invention has important production significance for improving the sugar content and the yield of crops, screening germplasm materials, directional breeding and the like.
The invention provides an application of a potato tonoplast monosaccharide transporter StTMT2 gene or protein or a recombinant vector, an expression cassette or a recombinant bacterium containing the gene in improving the plant yield, wherein the nucleotide sequence of the potato tonoplast monosaccharide transporter StTMT2 gene is shown as SEQ ID No. 1.
Preferably, the plants include potato and arabidopsis.
Preferably, said plant yield comprises the fresh weight of individual potato plants and the weight of tubers; or the fresh weight of the single plant of the arabidopsis thaliana plant and the weight of the silique.
The invention also provides an application of the potato tonoplast monosaccharide transporter StTMT2 gene or protein or a recombinant vector, an expression cassette or a recombinant bacterium containing the gene in improving the content of plant sugar, wherein the nucleotide sequence of the potato tonoplast monosaccharide transporter StTMT2 gene is shown as SEQ ID No. 1.
Preferably, the plants include potato and arabidopsis.
Preferably, the sugar content comprises the potato lamina sugar content and the tuber sugar content, or comprises the leaf sugar content of arabidopsis thaliana.
The invention also provides an application of the potato tonoplast monosaccharide transporter StTMT2 gene or protein or a recombinant vector, an expression cassette or a recombinant bacterium containing the gene in improving the plant photosynthetic rate, wherein the nucleotide sequence of the potato tonoplast monosaccharide transporter StTMT2 gene is shown as SEQ ID No. 1.
Preferably, the plant comprises potato.
The invention also provides an application of the potato tonoplast monosaccharide transporter StTMT2 gene or protein or a recombinant vector, an expression cassette or a recombinant bacterium containing the gene in improving the chlorophyll content of plant leaves, wherein the nucleotide sequence of the potato tonoplast monosaccharide transporter StTMT2 gene is shown as SEQ ID No. 1.
Preferably, the plant comprises potato.
The invention also provides an application of the potato tonoplast monosaccharide transporter StTMT2 gene or protein or a recombinant vector, an expression cassette or a recombinant bacterium containing the gene in improving the expression quantity of plant sugar metabolism related genes, wherein the nucleotide sequence of the potato tonoplast monosaccharide transporter StTMT2 gene is shown as SEQ ID No. 1.
Preferably, the plants include potato and arabidopsis.
Preferably, the plant sugar metabolism-related genes include potato StAGPase, StGBSS and StSPS genes and arabidopsis thaliana AtAGPase and AtGBSS genes.
The invention provides an application of a potato tonoplast monosaccharide transporter StTMT2 gene. The invention separates and clones the potato StTMT2 gene for the first time, and homologously over-expresses the StTMT2 gene in the potato and heterologously over-expresses the gene in arabidopsis thaliana for the first time. The experimental result shows that compared with a control, the positive transgenic potato strain shows excellent properties of increased tubers, increased leaf and tuber saccharide contents, increased leaf chlorophyll content and photosynthetic rate and the like in the T0 and T1 generations; the sugar content in the positive transgenic arabidopsis leaves is increased. The homologous overexpression of StTMT2 in the potato obviously improves the relative expression quantity of StAGPase, StGBSS and StSPS genes; the relative expression of AtAGPase and AtGBSS in 3 positive transgenic Arabidopsis lines was significantly higher than that of the wild-type receptor. The application of the invention has important production significance for crop yield improvement, breeding and production application.
Drawings
FIG. 1 is a phylogenetic tree analysis diagram of the potato StTMT2 protein and other plant TMT2 proteins provided by the present invention;
FIG. 2 is a double-restriction enzyme identification chart of the recombinant plant expression vector pCAMBIA1302-StTMT2 provided by the invention;
FIG. 3 is a diagram showing the result of PCR detection of a positive transgenic potato strain according to the present invention;
FIG. 4 is a comparison of leaf phenotype and individual potato bearing of the recipient and T0 generation positive transgenic individual plants after 90 days of potting provided by the present invention;
FIG. 5 is a graph showing the comparison of the growth of the overground part of the receptor and the T1 generation positive transgenic plant after the potted plant provided by the present invention is cultivated for 60 days;
FIG. 6 shows the sugar content in leaves of the receptor and positive transgenic lines 90 days after potting;
FIG. 7 shows the sugar content in tubers of the recipient and positive transgenic lines after 90 days of potting provided by the present invention;
FIG. 8 shows the photosynthetic rate and chlorophyll content of the leaves of the recipient and transgenic plants after 90 days of potting provided by the present invention;
FIG. 9 is a diagram showing the result of PCR detection of a positive transgenic Arabidopsis line provided by the present invention;
FIG. 10 is a comparison of the phenotype of wild type and positive transgenic Arabidopsis thaliana provided by the present invention after 30 days of transplantation;
FIG. 11 is a graph showing the determination of sugar content in leaves of wild type and positive transgenic Arabidopsis lines 30 days after transplantation, according to the present invention;
FIG. 12 is a subcellular localization analysis chart of StTMT2 provided by the present invention;
FIG. 13 shows the fluorescence quantitative PCR results of 3 genes involved in sugar metabolism in positive transgenic potato according to the present invention;
FIG. 14 shows the result of fluorescent quantitative PCR of 2 genes involved in sugar metabolism in positive transgenic Arabidopsis provided by the present invention.
Detailed Description
The invention provides an application of a potato tonoplast monosaccharide transporter StTMT2 gene or protein or a recombinant vector, an expression cassette or a recombinant bacterium containing the gene in improving the plant yield, wherein the nucleotide sequence of the potato tonoplast monosaccharide transporter StTMT2 gene is shown as SEQ ID No. 1. The gene of the invention is derived from a sequence with Genbank accession number MT454112, and the sequence is autonomously cloned by an inventor and uploaded to the Genbank. The complete coding region sequence of the potato tonoplast monosaccharide transporter gene is obtained by cloning through an RT-PCR method and is named as StTMT 2. The gene of the invention contains 1 exon, does not contain an intron, contains an Open Reading Frame (ORF) with the full length of 2214bp, and codes a protein which consists of 737 amino acid residues, has the molecular weight of 79.14kD and the theoretical isoelectric point of 4.91. IN the invention, the amino acid sequence of the potato tonoplast monosaccharide transporter is shown as SEQ IN NO. 2. In the present invention, the plants include potato and Arabidopsis thaliana. In the present invention, the plant yield includes the fresh weight of individual potato plants and the weight of the tubers; or the fresh weight of the single plant of the arabidopsis thaliana plant and the weight of the silique. The invention preferably realizes the improvement of the plant yield by over-expressing the potato tonoplast monosaccharide transporter StTMT2 gene in the plant. The method of the present invention for the overexpression is not particularly limited, and a conventional method of overexpression of a gene in a plant, which is well known to those skilled in the art, may be used. For example, the potato tonoplast monosaccharide transporter StTMT2 gene is transferred into potato or Arabidopsis. Specifically, the invention preferably amplifies a potato tonoplast membrane monosaccharide transporter StTMT2 gene by an RT-PCR method, constructs an open reading frame sequence of the gene into a plant expression vector pCAMBIA1302, then transforms the recombinant expression vector into agrobacterium and transforms the agrobacterium into a plant by an agrobacterium-mediated method, thereby improving the expression of the potato tonoplast membrane monosaccharide transporter StTMT2 gene. In the present invention, the plant expression vector constructed is preferably pCAMBIA1302-35S-StTMT 2.
The invention also provides an application of the potato tonoplast monosaccharide transporter StTMT2 gene or protein or a recombinant vector, an expression cassette or a recombinant bacterium containing the gene in improving the content of plant sugar, wherein the nucleotide sequence of the potato tonoplast monosaccharide transporter StTMT2 gene is shown as SEQ ID No. 1. In the present invention, the plants include potato and Arabidopsis thaliana. In the present invention, the sugar content includes glucose, fructose, sucrose and total sugar content in potato leaves and tubers, or includes leaf glucose, fructose, sucrose and total sugar content of arabidopsis thaliana. The invention preferably realizes the increase of the content of the plant sugar by over-expressing the potato tonoplast monosaccharide transporter StTMT2 gene in the plant. The method of the present invention for the overexpression is not particularly limited, and a conventional method of overexpression of a gene in a plant, which is well known to those skilled in the art, may be employed, and the specific method is preferably the same as described above.
The invention also provides an application of the potato tonoplast monosaccharide transporter StTMT2 gene or protein or a recombinant vector, an expression cassette or a recombinant bacterium containing the gene in improving the plant photosynthetic rate, wherein the nucleotide sequence of the potato tonoplast monosaccharide transporter StTMT2 gene is shown as SEQ ID No. 1. In the present invention, the plant includes potato. The invention preferably realizes the increase of the plant photosynthetic rate by over-expressing the potato tonoplast monosaccharide transporter StTMT2 gene in the plant. The method of the present invention for the overexpression is not particularly limited, and a conventional method of overexpression of a gene in a plant, which is well known to those skilled in the art, may be employed, and the specific method is preferably the same as described above.
The invention also provides an application of the potato tonoplast monosaccharide transporter StTMT2 gene or protein or a recombinant vector, an expression cassette or a recombinant bacterium containing the gene in improving the chlorophyll content of plant leaves, wherein the nucleotide sequence of the potato tonoplast monosaccharide transporter StTMT2 gene is shown as SEQ ID No.1, and the amino acid sequence of the encoded protein of the potato tonoplast monosaccharide transporter StTMT2 gene is shown as SEQ ID No. 2. In the present invention, the plant includes potato. The invention preferably realizes the increase of the chlorophyll content of the plants by over-expressing the potato tonoplast monosaccharide transporter StTMT2 gene in the plants. The method of the present invention for the overexpression is not particularly limited, and a conventional method of overexpression of a gene in a plant, which is well known to those skilled in the art, may be employed, and the specific method is preferably the same as described above.
The invention also provides an application of the potato tonoplast monosaccharide transporter StTMT2 gene or protein or a recombinant vector, an expression cassette or a recombinant bacterium containing the gene in improving the expression quantity of plant sugar metabolism related genes, wherein the nucleotide sequence of the potato tonoplast monosaccharide transporter StTMT2 gene is shown as SEQ ID No. 1. In the present invention, the plants include potato and Arabidopsis thaliana. In the present invention, the plant sugar metabolism-related genes include potato StAGPase, StGBSS and StSPS genes and arabidopsis thaliana AtAGPase and AtGBSS genes. The invention preferably realizes the improvement of the expression level of potato StAGPase, StGBSS and StSPS genes and Arabidopsis AtAGPase and AtGBSS genes by over-expressing the potato tonoplast monosaccharide transporter StTMT2 gene in plants. . The method of the present invention for the overexpression is not particularly limited, and a conventional method of overexpression of a gene in a plant, which is well known to those skilled in the art, may be employed, and the specific method is preferably the same as described above.
Specifically, the nucleotide sequences of the PCR primers for cloning the potato tonoplast monosaccharide transporter StTMT2 gene are preferably shown as SEQ ID No. 3-6:
TMTF:5’-GACTTGTGTGCTACTAGTACTGG-3’(SEQ ID NO.3)
TMTR:5’-CGTAGTAAATCCGACAGAAGATACC-3’(SEQ ID NO.4)
TF:5’-GAAGATCTTCATGAATGGTGCTGTG-3’(SEQ ID NO.5)
TR:5’-GGACTAGTCCTCATGCTTCGCGATA-3’(SEQ ID NO.6)
wherein the underlined position is the restriction enzyme cutting site, the restriction enzyme cutting site of the upstream primer is Bgl II, and the restriction enzyme cutting site of the downstream primer is Spe I.
The cloned gene is named StTMT2, and may be transferred into plant via agrobacterium mediated genetic transformation or other transgenic process to obtain transgenic plant or strain. The invention belongs to the protection scope of the invention, and the application of the gene in the aspects of increasing the carbohydrate content, improving the potato yield, the photosynthetic rate and the chlorophyll content by over-expression in a potato body and the application of the gene in the aspects of increasing the carbohydrate content by heterologous expression in an arabidopsis thaliana body.
The application of the potato tonoplast monosaccharide transporter StTMT2 gene of the present invention will be described in further detail with reference to the following specific examples, but the technical solution of the present invention includes, but is not limited to, the following examples.
Example 1
Potato vacuolar membrane monosaccharide transporter StTMT2 gene cloning and expression vector construction
The invention utilizes RT-PCR technology to clone a potato tonoplast monosaccharide transporter StTMT2 gene cDNA sequence from the leaves of a potato cultivar Atlantic, and constructs a pCAMBIA1302-35S-StTMT2 recombinant plant expression vector for genetic transformation.
The amplification method comprises the following steps: firstly, using Plant Total RNAISATION kit (purchased from Novow Zan company) to extract Total RNA of potato leaf, secondly, using HiScript III 1st Strand cDNA Synthesis kit (purchased from Novozan company) to reverse-transcribe into Total cDNA (the concrete process is shown in the specification), then using the cDNA as a template and TMTF and TMTR (SEQ ID NO.3 and SEQ ID NO.4) as primers to perform PCR amplification, and detecting the amplified product as single DNA by 1% agarose gel electrophoresisAfter one band, the target band was recovered with a gel recovery kit (purchased from Tiangen corporation), the recovered target gene fragment and cloning vector pCE2-TA/Blunt-Zero vector (purchased from Novozan) were placed at 25 ℃ for 5min for ligation, 5. mu.L of the ligation product was taken to heat shock transform E.coli Fast-T1 competent cells, spread on a newly prepared LB solid plate containing ampicillin (Amp), cultured overnight at 37 ℃, picked several white spots the next day, and placed on an Amp (50 mg. L. sup. Amp) containing LB solid plate-1) The liquid LB culture medium is subjected to shaking culture at 37 ℃ and 180r/min overnight until the liquid LB culture medium is turbid, TMTF and TMTR primers are used for carrying out PCR detection to detect whether the bacterial liquid is positive, and three screened positive clones are sent to Jinwei Zhi Biotech company for sequencing.
Bioinformatics analysis shows that the gene sequence contains an open reading frame with the full length of 2214bp, contains 1 exon and does not contain an intron. The gene codes a protein which is composed of 737 amino acid residues, has the molecular weight of 79.14kD and the theoretical isoelectric point of 4.91, contains an MFS superfamily conserved domain and has 12 transmembrane helices. The genetic relationship between the gene coding protein and other plants is shown in figure 1 (a phylogenetic tree analysis chart of potato StTMT2 protein and other plant TMT2 protein), and the analysis finds that the homology of the TMT2 protein between the same family plants is higher, and the homology of the protein between different species is lower, which indicates that the protein has higher conservation among the same family plants.
Designing ORF full-length specific amplification primers TF and TR (SEQ ID NO.5 and SEQ ID NO.6, the underlined parts are enzyme cutting sites Bgl II and Spe I) with enzyme cutting sites according to the sequence information of the cloned StTMT2 gene, carrying out PCR amplification by using 'Atlantic' cDNA as a template, carrying out gel cutting, purifying and recovering a target fragment after detecting a PCR product through 1.2% agarose gel electrophoresis, connecting the recovered product with a cloning vector pCE2-TA/Blunt-Zero vector, transforming an escherichia coli competent cell of the connected product through a heat shock method, selecting a single bacterium and shaking the bacterium, screening out a positive clone through PCR bacterial liquid, and sending the positive clone to a biological engineering member limited company for sequencing. Inoculating the positive strains containing pCAMBIA1302 empty vector and sequencing-free target gene respectively in a liquid LB culture medium, performing shake culture at 37 ℃ overnight, and adopting rhizoma gastrodiaeThe small particle extraction reagent respectively extracts two kinds of plasmid DNA. The plasmid of the gene of interest and the pCAMBIA1302 empty vector plasmid were double digested with restriction enzymes Bgl II and Spe I at 37 ℃ for 10 min. After the enzyme digestion reaction is finished, agarose gel electrophoresis is carried out, gel is respectively cut to recover target bands, and the target gene fragment and the pCAMBIA1302 vector fragment are mixed according to the weight ratio of 7: 1, ligated overnight at 16 ℃ with T4-DNA ligase, 5. mu.L of the ligation product was transformed into E.coli DH 5. alpha. competent cells by heat shock method, and plated on cells containing kanamycin (50 mg. L)-1) And (3) culturing on a resistant plate, selecting and shaking out the single strain, screening out a positive strain through the PCR of a bacterial liquid, carrying out amplification culture, extracting a plasmid, carrying out double enzyme digestion and monoclonal sequencing identification, and finally obtaining the plant expression vector of the StTMT2 gene. The result is shown in FIG. 2 (recombinant plant expression vector pCAMBIA1302-StTMT2 double-restriction identification chart), wherein M is Marker, 1 is pCAMBIA1302-StTMT2, and 2 is pCAMBIA1302-StTMT2 double-restriction result, which is shown in FIG. 2 to correspond to the size of the fragment expected by restriction.
Transforming Agrobacterium GV3101 with the obtained recombinant plasmid by heat shock transformation, screening positive transformed colonies with LB solid resistant plate containing kanamycin (Kan)50mg/L, and picking several positive spots on kanamycin (Kan)50 mg.L-1The culture was carried out overnight at 180r/min in LB liquid medium (Bio Rad laboratories) at 28 ℃ using 1. mu.L of the template for PCR detection of recombinant plasmids, and the strains confirmed to be positive were stored for subsequent genetic transformation.
Example 2
Genetic transformation of potato tonoplast monosaccharide transporter StTMT2 gene
Inoculating the preserved positive agrobacterium liquid into 50mL LB liquid culture medium (containing 50 mg. L)-1Kan), shaking and culturing for 24h at the temperature of 28 ℃ in a shaking table at the speed of 180rpm, taking out, centrifuging, discarding supernatant, collecting thalli, re-suspending the thalli by using an MS liquid culture medium, and measuring the OD value of the thalli to be about 0.6-0.8 for infection transformation. Taking out test-tube potato in an ultraclean workbench, cutting into slices of about 1-2 mm, placing into an aseptic triangular flask, pouring the above-mentioned heavy suspension Agrobacterium liquid, dip-dyeing for 12min (shaking the triangular flask continuously), pouring out the liquid, absorbing the residual liquid on the surface of potato chips with aseptic filter paper, transferring the potato chips to a device with 2 layers of filtersPaper co-culture medium (MS 4.42 g. L)-1Sucrose (30 g. L)-1Agar 4.5 g. L-1、NAA 0.05mg·L-1) Culturing at 25 deg.C in dark for 48 h. Clamping the potato chips subjected to dark culture for 48h in an ultraclean workbench by using sterile forceps into a sterile triangular flask, and adding a cephalosporin solution (500 mg. L)-1) The potato chips were washed 4 times for 8min each time (while gently shaking the triangular flask) to be thoroughly washed. And then washed with sterile water for 4 times, each time for 1 min. The chips were removed and laid flat on sterile filter paper to remove any residual liquid from the chip surface. It was transferred to a selection medium (MS 4.42 g. L)-1Sucrose (30 g. L)-1Agar 4.5 g. L-1、ZT1.0 mg·L-1、 6-BA 0.5mg·L-1、IAA 1.0mg·L-1、GA 0.2mg·L-1、Cef500 mg·L-1、Kan 50 mg·L-1) Culturing at 24 + -2 deg.C under light cycle of 16 h/8 h and illumination of 2000Lx for about 10 days, turning green to obtain resistant bud, and transferring to culture medium containing cephalosporin (500 mg. L) when the resistant bud grows to 3-4 cm-1) Obtaining the potato transformation plant in the rooting culture medium. Extracting genome DNA of a receptor plant and a transformed plant, designing a cross-carrier primer, performing PCR amplification by taking the DNA as a template, taking the DNA of a bacterial liquid as a positive control and taking the total DNA of untransformed potatoes as a negative control, and identifying a positive transgenic strain. The result is shown in FIG. 3 (PCR detection result of positive transgenic potato strain), wherein M is Marker, 1 is receptor, 2 is positive plasmid, and 3-5 are 3 positive strains, the transgenic positive plant can be amplified to form a band (fragment size) with the same size as the recombinant plasmid fragment, while the untransformed receptor does not amplify a corresponding specific band.
And (3) carrying out subculture on the screened T0-generation positive strains and a control strain (WT) in an aseptic culture bottle, selecting positive transgenic seedlings and untransformed recipient seedlings with consistent growth conditions, carrying out pot culture test under control conditions, growing for about 90 days in the same environment, measuring photosynthetic efficiency parameters after transplanting and growing for 90 days, sampling and measuring chlorophyll content and carbohydrate content, collecting overground plants and tubers of each plant, and quickly weighing the fresh weight of each plant and the weight of each tuber of each plant. As a result, the transgenic positive lines OE-1, OE-2 and OE-3 shown in Table 1 show that the fresh weight of each plant is significantly higher than that of the untransformed recipient, and the weight of each potato of 3 positive transgenic lines is significantly higher than that of the recipient. As shown in FIG. 4 (a comparison graph of the leaf phenotype of the receptor and the positive transgenic single plant of the T0 generation and the single potato bearing condition after being potted for 90 days) and FIG. 5 (a comparison graph of the overground part growth condition of the receptor and the positive transgenic plant of the T1 generation after being potted for 60 days), the comparison pictures of the control (WT) and OE-1, OE-2 and OE-3 after being potted for 90 days show that the positive transgenic plant grows robustly and leaves grow more fully, and the single potato bearing quantity of the OE-1 and OE-2 is more than that of the receptor plant; the fructose, glucose, sucrose and total sugar contents in the leaves and tubers of the recipient plants and 3 positive transgenic plants after 90 days of potting were determined using 4 sugar content kits (purchased from Namo corporation, Suzhou) as shown in FIG. 6 (sugar contents in the leaves of the recipient and positive transgenic plants after 90 days of potting), wherein A is a comparison graph of the fructose contents in the leaves of the recipient (WT) and 3 positive transgenic lines (OE-1, OE-2 and OE-3), B is a comparison graph of the glucose contents in the leaves of the recipient (WT) and 3 positive transgenic lines (OE-1, OE-2 and OE-3), C is a comparison graph of the sucrose contents in the leaves of the recipient (WT) and 3 positive transgenic lines (OE-1, OE-2 and OE-3), D is a comparison graph of the sucrose contents in the recipient (WT) and 3 positive transgenic lines (OE-1, total sugar content in OE-2 and OE-3) leaves) and FIG. 7 (sugar content in tubers of recipient and positive transgenic lines after 90 days of potting) where A is the fructose content in the recipient (WT) plants and 3 leaves of positive transgenic lines (OE-1, OE-2 and OE-3), B is the glucose content in the recipient (WT) plants and 3 leaves of positive transgenic lines (OE-1, OE-2 and OE-3), C is the sucrose content in the recipient (WT) plants and 3 leaves of positive transgenic lines (OE-1, OE-2 and OE-3), and D is the total sugar content in the recipient (WT) plants and 3 leaves of positive transgenic lines (OE-1, OE-2 and OE-3), the content of 4 saccharides of 3 positive transgenic strains (OE-1, OE-2, OE-3) was increased to different degrees compared with that of the recipient plants, and there were statistically significant differences (P <0.05) or very significant (P <0.01, P < 0.001); the 4 carbohydrate content of the 3 positive transgenic lines was also significantly (. about.p <0.05) or very significantly (. about.p <0.01,. about.p <0.001) higher than that of the recipient plants in the tubers. The photosynthetic rate and chlorophyll content of the leaves of the recipient plants and transgenic positive plants were determined using a GFS-3000 photosynthesizer and chlorophyll content kit (available from Suzhou Keming Co.). As shown in FIG. 8 (comparison of photosynthetic rate and chlorophyll content of leaves of recipient (WT) plants and 3 positive transgenic lines (OE-1, OE-2 and OE-3), and comparison of chlorophyll content in leaves of recipient (WT) plants and 3 positive transgenic lines (OE-1, OE-2 and OE-3)), the photosynthetic rate of the 3 positive transgenic lines was increased compared to that of the recipient plants, and the total chlorophyll content was increased compared to that of the recipient plants.
The positive lines and the control lines (WT) of the T1 generation are potted under the control condition, the soil filling amount of each pot is consistent, 1 line is planted in each pot under the conventional watering management, the vegetative growth period (60 days after planting) is found (figure 5, the comparison between the overground part growth condition of the receptor and the positive transgenic plants of the T1 generation after potting for 60 days), and the plant height and the overground part growth condition of the 3 over-expression lines OE-1, OE-2 and OE-3 are obviously superior to those of the receptor (WT). Growing for 90 days in the same environment, collecting tubers of each plant, and weighing the tubers of each plant. As a result, the transgenic positive lines OE-1, OE-2 and OE-3 shown in Table 2 all show that the weight of each potato bearing plant is significantly larger than that of the receptor.
Table 1 potted plant recipients and T0 generation positive transgenic lines individual plant fresh weight and individual potato bearing weight (3 biological replicates per line, # P <0.01)
Table 2 potted plant recipients and T1 generation positive transgenic lines individual potato bearing weights (3 biological replicates per line, # P <0.01)
Example 3
Genetically transformed Arabidopsis thaliana with potato vacuolar membrane monosaccharide transporter StTMT2 gene
Planting of arabidopsis thaliana: a proper amount of Arabidopsis seeds are loaded into a centrifuge tube, 75% alcohol is added into an ultra-clean workbench for disinfection for 2min, 1mL (10% NaCLO + 0.01% Triton) is added for disinfection for 10min, and the centrifuge tube is washed with sterilized distilled water for 4 times, 1min each time. And finally, uniformly sowing seeds on an MS solid culture medium, performing vernalization on the flat plate at 4 ℃ for 2-3 days, placing the flat plate in an artificial incubator for 16h illumination/8 h darkness, culturing at 22 ℃ for about 10 days, and transplanting after four true leaves of arabidopsis grow. Mixing the nutrient soil, vermiculite and perlite according to the ratio of 6:3:1, sterilizing at high temperature, filling into a nutrient bowl, and thoroughly pouring the nutrient solution. And (3) selecting strong seedlings to transplant into a nutrition pot, covering a preservative film for moisture preservation and culture for 2-3 days, and then culturing under normal illumination. And (3) growing the arabidopsis thaliana to a bolting state, cutting off pod fruits which are already pod-bearing, leaving buds to be opened, and performing an agrobacterium infection experiment.
1mL of the Agrobacterium solution was inoculated into 50mL of a solution containing kanamycin (50 mg. L)-1) The LB liquid medium of (9) was cultured overnight at 180rpm at 28 ℃. Taking out bacterial liquid, centrifuging at 3500rpm for 10min, discarding supernatant, and collecting thallus. And (4) resuspending the thallus by using a transformation penetrating fluid, and measuring the OD value of the thallus to be about 0.8-1 for infection transformation. Removing the formed fruit pod before infection, soaking the arabidopsis inflorescence in an infection solution, infecting for 1min, covering the arabidopsis with a film after infection is completed, watering for preserving moisture, culturing in the dark for 24h, and then normally culturing in an illumination incubator. And infecting the plant once for 6-7 days according to the growth vigor of the plant, not infecting the plant after infecting for 2-3 times, and harvesting the seed after the plant is mature. Drying the collected seeds at 37 deg.C, vernalizing at 4 deg.C for about 3 days, sterilizing the seeds, and spreading on a flat bag containing 50 mg.L-1Culturing on hygromycin MS plate at 4 deg.C for 3 days, culturing in artificial culture box at 22 deg.C for 16 h/8 h in dark for about two weeks, and screening out the transgenic plant with good growth on antibiotic plate. The preserved recombinant plant expression vector pCAMBIA1302-The 35S-StTMT2 plasmid was transiently transformed into Arabidopsis protoplasts and analyzed for subcellular localization under a confocal laser microscope.
Seeds of T1 generation are sowed on MS plate containing hygromycin, and resistant T2 generation seedlings are selected and transplanted. Total DNA of transgenic Arabidopsis and wild Arabidopsis is extracted, PCR amplification is carried out by using cross-vector specific primers, and agarose gel electrophoresis detection shows that (figure 9, a PCR detection result diagram of a positive transgenic Arabidopsis strain, wherein, a lane 1 represents a band size after electrophoresis of a positive plasmid of a recombinant plant expression vector pCAMBIA1302-35S-StTMT2, a lane 2-7 represents a target band size of a transgenic StTMT2 gene strain in Arabidopsis, and a lane 4-6 represents a band which is detected by amplification and electrophoresis and has the same molecular weight with the positive plasmid), 3 strains in 5 transgenic strains in the diagram amplify a band (the strain represented by a lane 4-6 in figure 9) with the same size with the positive plasmid fragment, and a non-transgenic control strain does not amplify a corresponding specific band. Collecting seeds of T2 generation, continuously screening seedlings of T3 generation and transplanting, growing for 3 weeks in a long-day environment of 16h light/8 h dark, and carrying out phenotype identification on arabidopsis thaliana. As a result, it was found (FIG. 10, a comparison of the phenotype of wild type and positive transgenic Arabidopsis), that 3 transgenic Arabidopsis lines (Line-1, Line-2 and Line-3 in FIG. 10) exhibited robust seedling growth, more sufficient leaf growth, and enhanced rosette leaf growth, as compared to the control recipient (WT in FIG. 10). To confirm whether or not sugar accumulation was increased after the transgenesis, the contents of fructose, glucose, sucrose and total sugar in leaves of the wild type and transgenic Arabidopsis lines were measured 3 weeks after the transplantation, respectively. The results show (FIG. 11, plots of sugar content determination in leaves of wild-type and positive transgenic Arabidopsis lines 3 weeks after transplantation, where A is a plot of comparison of fructose content in leaves of recipient (WT) plants and 3 positive transgenic lines (Line-1, Line-2 and Line-3), B is a plot of comparison of glucose content in leaves of recipient plants and 3 positive transgenic lines (Line-1, Line-2 and Line-3), C is a plot of comparison of sucrose content in leaves of recipient plants and 3 positive transgenic lines (Line-1, Line-2 and Line-3), D is a plot of comparison of total sugar content in leaves of recipient plants and 3 positive transgenic lines (Line-1, Line-2 and Line-3), and the content of 4 sugars in 3 positive transgenic lines is either significant (P <0.05) or significant (P <0.01, p <0.001) higher than wild type. Preliminary demonstration that expression of StTMT2 increased sugar accumulation in leaves.
Subcellular localization analysis of StTMT2 showed (FIG. 12, subcellular localization analysis chart of StTMT2, in which A is the fluorescent signal of empty vector 35S-GFP under a confocal laser microscope, B is the fluorescent signal of chloroplast in recipient plant, C is the fluorescent signal of protoplast in bright field, D is the fluorescent signal of the mixture of images A, B and C in the same field, E is the fluorescent signal of StTMT1-GFP fusion protein, F is the fluorescent signal of marker protein, G is the fluorescent signal of protoplast in bright field gene plant, H is the fluorescent signal of the mixture of images E, F and G in the same field), in Arabidopsis mesophyll protoplast, green fluorescence in empty vector control (35S-GFP) filled the whole protoplast, and is expressed in cell membrane, cytoplasm, nucleus and the like, while 35S-StTMT2-GFP fusion protein is expressed only on the vacuolar membrane, suggesting that StTMT2 may exert biological functions primarily on the vacuolar membrane.
Example 4
Analysis of sugar metabolism-related gene expression levels in StTMT2 transgenic positive lines of potato and Arabidopsis thaliana was carried out by taking 3 positive transgenic lines of the T1 generation obtained in example 2 as the study subjects and leaves as the material, extracting total RNA from the tissue by a kit method (purchased from Nanjing Nozam Biotech Co., Ltd.), and reverse-transcribing the total RNA into cDNA (purchased from Nanjing Nozam Biotech Co., Ltd.). The normalized cDNA is used as a template, ef1 alpha is used as an internal reference gene (Qef1 alpha F:5 'CAAGGATGACCCAGCCAAG, SEQ ID NO. 7; Qef1 alpha R:5' TTCCTTACCTGAACGCCTGT, SEQ ID NO.8), StTMT2 gene quantitative primers QStTMT2(QStTMT2F:5'AAGGACTTGTTGTTGCGATGT, SEQ ID NO. 9; QStTMT2R:5' ATAGGGCGACGACCAATACT, SEQ ID NO.10) and 3 sugar metabolism related genes (AGPase, GBSS and SPS, the primer sequences are QStAGPase F:5 'GCAAAGACGTGATGTTAAACCT, SEQ ID NO. 11; QStGPase R:5' TAAAAGCTAAAATCTGGCACCG, SEQ ID NO. 12; QStGBSS F:5 'CTTTCACTGCTATAAACGTGGG, SEQ ID NO. 13; QStGBSS R:5' GACACAACAAGCTGAACCTAAG, SEQ ID NO. 14; QStSPS: 5 'GTTCCATTGGATTTATCCTGGC, SEQ ID NO. 15; QStGBSS R:5' CAAAGTCTTTCTCAACCCTTCG, SEQ ID NO.16) are used as primers for carrying out fluorescent quantitative PCR analysis on a strain of the gene-related gene-expressed in CFtX quantitative PCR instrument, and the fluorescent quantitative expression of CFtX 96 is completed on the fluorescent quantitative PCR instrument.
The results of fluorescent quantitative PCR in transgenic potatoes showed (fig. 13, fluorescent quantitative PCR results of 3 genes associated with sugar metabolism in positive transgenic potatoes) that the expression level of the StAGPase gene was significantly higher in all 3 positive transgenic lines than in the recipient line (a,. times. P <0.01 in fig. 13), wherein the expression level in OE-1 was 46 times higher than in the recipient, the expression level in OE-2 was 90.6 times higher than in the recipient, and the expression level in OE-3 was 31.5 times higher than in the recipient. The expression level of the StGBSS gene was significantly higher in all 3 positive transgenic lines than in the recipient line (B,. times.P <0.001 in FIG. 13), wherein the expression level was 119 times higher in OE-1, 179.8 times higher in OE-2, and 66.6 times higher in OE-3. The expression level of StSPS gene was significantly higher in 3 positive transgenic lines than in the recipient line (C,. times.P <0.001 in FIG. 13), where the expression level was 22.9 times higher in OE-1, 27 times higher in OE-2, and 19 times higher in OE-3 than in the recipient line. The relative expression result of the genes related to the sugar metabolism preliminarily shows that the transfer of the StTMT2 gene influences the expression change of the genes related to the sugar metabolism, and is an important reason for improving the sugar content in leaves and tubers and the yield of single-plant tubers.
The plant leaves of 3T 2 generation positive transgenic arabidopsis lines obtained in example 3 after 30 days of transplantation were used as materials, total RNA of tissues was extracted by a kit method (purchased from nanjing nuozan biotechnology limited), and reverse transcription was performed by the kit method to cDNA (purchased from nanjing nuozan biotechnology limited). The homogenized cDNA is taken as a template, Actin2 is taken as an internal reference gene (Qantagin 2F:5 'CTCCTTTGTTGCTGTTGACTAC, SEQ ID NO. 17; Qantagin 2R:5' GCACAATGTTACCGTACAGATC, SEQ ID NO.18), the relative expression quantity of 2 carbohydrate metabolism related genes (AGPase, GBSS, the primer sequences are QATGPase F:5 'CGTCATCTTTCACGAGCTTATG, SEQ ID NO.19, QATGPase R:5' GACATTATGCTCCTCGAACAAC, SEQ ID NO.20, QATGBSS F:5 'AAATTAACTGGATGAAGGCTGC, SEQ ID NO.21 and QATGBSS R:5' AGAGATGAGTTCTTGAGCGTAG, SEQ ID NO.22) is calculated by a fluorescence quantitative PCR method, the expression condition of the carbohydrate metabolism pathway related genes in a transgenic strain is analyzed, and the fluorescence quantitative PCR is completed on a BerleCFX 96 instrument. The results show (fig. 14, fluorescent quantitative PCR results of 2 genes associated with carbohydrate metabolism in positive transgenic arabidopsis), that the relative expression of AtAGPase and AtGBSS in 3 positive transgenic arabidopsis strains was significantly higher than that of the wild-type receptor (. x.p < 0.001). AtAGPase (A in FIG. 14) was expressed in Line-1 in 15.9-fold, Line-2 in 7.7-fold and Line-3 in 15.5-fold higher than the wild-type receptor. AtGBSS (B in FIG. 14) was expressed in Line-1 in 78.5-fold higher amount than the wild-type receptor, in Line-2 in 53.5-fold higher amount than the wild-type receptor, and in Line-3 in 103.5-fold higher amount than the wild-type receptor. The above results indicate that heterologous expression of StTMT2 in Arabidopsis affects the expression change of genes involved in sugar metabolism.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Ningxia academy of agriculture and forestry academy of sciences and agriculture biotechnological research center (Ningxia agriculture biotechnological focus laboratory)
<120> application of potato tonoplast monosaccharide transporter StTMT2 gene in improving plant sugar content
<160> 22
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2214
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atgaatggtg ctgtgttagt tgcgcttgcc gcgacaattg gaaacttttt gcagggttgg 60
gataatgcta ctattgctgg agctgttgtt tacataaaga aggagcttgc tctggatgct 120
tcagtggaag gacttgttgt tgcgatgtca ctcattggag ccacacttgt cacaacttgt 180
tctggatcca tagctgacag tattggtcgt cgccctatgc ttattatgtc atccatgctt 240
tatttcctta gtggtttaat aatgttgtgg tcccctaatg tctatgtcct gcttatagct 300
agactattag atggatttgg aatcggctta gcggttactc tggtccccct atatatatct 360
gagactgctc catcagaaat acgagggtca ctgaatactc ttccacagtt cactggttct 420
ggtggaatgt tcttggccta ctgcatgatt ttcggaatgt ccttaatgac agcgccgagt 480
tggcgattga tgttgggtgt tctttcaatt ccttctctta tctatttcgt attagttgta 540
ctttatttgc ctgagtctcc tcgatggcta gtcagtaaag gaagaatggt tgaggcaaaa 600
caagttttgc agaaattgcg tggcatagag gatgtttcag gggagatggc attgcttgtt 660
gagggtttgg cagttggcat tgaaccatca atagaagagt atatcattgg tccagctaat 720
gagcttactg acgatcagga cctggctact gacaaagatc atatcaagtt gtacggccca 780
gaggaaggcc tctcgtgggt ggccaagcca gttactggac agagtagtct agctcttgtg 840
tccaggcagg ggagcatggt gcagcagagt gtgcctctta tggatcctct tgtgactcta 900
tttggtagtg tccatgagaa tctccctgat acaggaagta tgagaagcat gctattcccc 960
aatttcggaa gcatgatcag caccatggat cctcatgtca aagatgatca ctgggatgag 1020
gagagtctgc agagagaagg tgatgattat ccttcggatg tcggtgcaga ttctgatgac 1080
aatctacaaa gtccattgat atcacgtcaa acaaccgctg tggaaaccgt agttcctcat 1140
ccccatggca gcactctgag cgtgaggcgg catagcagcc ttatgcaagg caatgctgga 1200
gagggtgtag gcagcatggg cattggtggt ggttggcagt tggcatggaa atggtctgaa 1260
agggaaggtg aagatggaac taaagaagga ggcttcaaaa ggatatattt gcatcaggag 1320
gcaggccctg gctctcgacg tggatctctc gtttcagtcc ctggtggtga tattcctgaa 1380
gatggtgaat tcatacaagc tgcggctttg gtaagtcagc ctgcacttta ctcaaaggaa 1440
cttatggatc agcatcctgt gggaccagcg atggtccatc catctgaaac tgcttcaaaa 1500
ggtccgagtt gggctgctct tcttgaacct ggagtcaagc gagcgctcat tgttggaatt 1560
ggaattcaaa tattgcaaca gttttccggt ataaatggag tcatgtacta cactcctcaa 1620
atccttgagc aggcaggtgt aggagttctt ctttctaact ttggcatcgc atcagactca 1680
gcatccttcc tcatcagtgc gttaacaaac ttcctgatgc tcccttctgt agctattgca 1740
atgcgattca tggatgtggc tggcagaagg tcgctgctgc tgtacactat tcctgttctc 1800
atactatcac tcatctgtct tgtcattggt aacactgtca acctcgggag tgtggctcat 1860
gcagtcgttt ctactatttg cgtgatcctc tacttttgct tctttgtaac gggctatgga 1920
ccaatcccaa atatcctctg ctcagaaatt ttcccaacaa gggttcgtgg tttgtgcatc 1980
gccatctgtg ccctcgtctt ctggatatgt gatgtcattg tgacttacac actgcctgtg 2040
atgctcaact cgattggctt atctggagtt tttggtattt atgccattgt atgtgtcatt 2100
tcttggattt ttgtcttctt gagggttccc gaaaccaaag gcatgccctt agaagtcatt 2160
acagagttct tcgctgttgg tgcaagacaa gctgctatcg cgaagcatga gtag 2214
<210> 2
<211> 737
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 2
Met Asn Gly Ala Val Leu Val Ala Leu Ala Ala Thr Ile Gly Asn Phe
1 5 10 15
Leu Gln Gly Trp Asp Asn Ala Thr Ile Ala Gly Ala Val Val Tyr Ile
20 25 30
Lys Lys Glu Leu Ala Leu Asp Ala Ser Val Glu Gly Leu Val Val Ala
35 40 45
Met Ser Leu Ile Gly Ala Thr Leu Val Thr Thr Cys Ser Gly Ser Ile
50 55 60
Ala Asp Ser Ile Gly Arg Arg Pro Met Leu Ile Met Ser Ser Met Leu
65 70 75 80
Tyr Phe Leu Ser Gly Leu Ile Met Leu Trp Ser Pro Asn Val Tyr Val
85 90 95
Leu Leu Ile Ala Arg Leu Leu Asp Gly Phe Gly Ile Gly Leu Ala Val
100 105 110
Thr Leu Val Pro Leu Tyr Ile Ser Glu Thr Ala Pro Ser Glu Ile Arg
115 120 125
Gly Ser Leu Asn Thr Leu Pro Gln Phe Thr Gly Ser Gly Gly Met Phe
130 135 140
Leu Ala Tyr Cys Met Ile Phe Gly Met Ser Leu Met Thr Ala Pro Ser
145 150 155 160
Trp Arg Leu Met Leu Gly Val Leu Ser Ile Pro Ser Leu Ile Tyr Phe
165 170 175
Val Leu Val Val Leu Tyr Leu Pro Glu Ser Pro Arg Trp Leu Val Ser
180 185 190
Lys Gly Arg Met Val Glu Ala Lys Gln Val Leu Gln Lys Leu Arg Gly
195 200 205
Ile Glu Asp Val Ser Gly Glu Met Ala Leu Leu Val Glu Gly Leu Ala
210 215 220
Val Gly Ile Glu Pro Ser Ile Glu Glu Tyr Ile Ile Gly Pro Ala Asn
225 230 235 240
Glu Leu Thr Asp Asp Gln Asp Leu Ala Thr Asp Lys Asp His Ile Lys
245 250 255
Leu Tyr Gly Pro Glu Glu Gly Leu Ser Trp Val Ala Lys Pro Val Thr
260 265 270
Gly Gln Ser Ser Leu Ala Leu Val Ser Arg Gln Gly Ser Met Val Gln
275 280 285
Gln Ser Val Pro Leu Met Asp Pro Leu Val Thr Leu Phe Gly Ser Val
290 295 300
His Glu Asn Leu Pro Asp Thr Gly Ser Met Arg Ser Met Leu Phe Pro
305 310 315 320
Asn Phe Gly Ser Met Ile Ser Thr Met Asp Pro His Val Lys Asp Asp
325 330 335
His Trp Asp Glu Glu Ser Leu Gln Arg Glu Gly Asp Asp Tyr Pro Ser
340 345 350
Asp Val Gly Ala Asp Ser Asp Asp Asn Leu Gln Ser Pro Leu Ile Ser
355 360 365
Arg Gln Thr Thr Ala Val Glu Thr Val Val Pro His Pro His Gly Ser
370 375 380
Thr Leu Ser Val Arg Arg His Ser Ser Leu Met Gln Gly Asn Ala Gly
385 390 395 400
Glu Gly Val Gly Ser Met Gly Ile Gly Gly Gly Trp Gln Leu Ala Trp
405 410 415
Lys Trp Ser Glu Arg Glu Gly Glu Asp Gly Thr Lys Glu Gly Gly Phe
420 425 430
Lys Arg Ile Tyr Leu His Gln Glu Ala Gly Pro Gly Ser Arg Arg Gly
435 440 445
Ser Leu Val Ser Val Pro Gly Gly Asp Ile Pro Glu Asp Gly Glu Phe
450 455 460
Ile Gln Ala Ala Ala Leu Val Ser Gln Pro Ala Leu Tyr Ser Lys Glu
465 470 475 480
Leu Met Asp Gln His Pro Val Gly Pro Ala Met Val His Pro Ser Glu
485 490 495
Thr Ala Ser Lys Gly Pro Ser Trp Ala Ala Leu Leu Glu Pro Gly Val
500 505 510
Lys Arg Ala Leu Ile Val Gly Ile Gly Ile Gln Ile Leu Gln Gln Phe
515 520 525
Ser Gly Ile Asn Gly Val Met Tyr Tyr Thr Pro Gln Ile Leu Glu Gln
530 535 540
Ala Gly Val Gly Val Leu Leu Ser Asn Phe Gly Ile Ala Ser Asp Ser
545 550 555 560
Ala Ser Phe Leu Ile Ser Ala Leu Thr Asn Phe Leu Met Leu Pro Ser
565 570 575
Val Ala Ile Ala Met Arg Phe Met Asp Val Ala Gly Arg Arg Ser Leu
580 585 590
Leu Leu Tyr Thr Ile Pro Val Leu Ile Leu Ser Leu Ile Cys Leu Val
595 600 605
Ile Gly Asn Thr Val Asn Leu Gly Ser Val Ala His Ala Val Val Ser
610 615 620
Thr Ile Cys Val Ile Leu Tyr Phe Cys Phe Phe Val Thr Gly Tyr Gly
625 630 635 640
Pro Ile Pro Asn Ile Leu Cys Ser Glu Ile Phe Pro Thr Arg Val Arg
645 650 655
Gly Leu Cys Ile Ala Ile Cys Ala Leu Val Phe Trp Ile Cys Asp Val
660 665 670
Ile Val Thr Tyr Thr Leu Pro Val Met Leu Asn Ser Ile Gly Leu Ser
675 680 685
Gly Val Phe Gly Ile Tyr Ala Ile Val Cys Val Ile Ser Trp Ile Phe
690 695 700
Val Phe Leu Arg Val Pro Glu Thr Lys Gly Met Pro Leu Glu Val Ile
705 710 715 720
Thr Glu Phe Phe Ala Val Gly Ala Arg Gln Ala Ala Ile Ala Lys His
725 730 735
Glu
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gacttgtgtg ctactagtac tgg 23
<210> 4
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cgtagtaaat ccgacagaag atacc 25
<210> 5
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gaagatcttc atgaatggtg ctgtg 25
<210> 6
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ggactagtcc tcatgcttcg cgata 25
<210> 7
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
<210> 9
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
aaggacttgt tgttgcgatg t 21
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
<210> 11
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
gcaaagacgt gatgttaaac ct 22
<210> 12
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
<210> 13
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
ctttcactgc tataaacgtg gg 22
<210> 14
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
gacacaacaa gctgaaccta ag 22
<210> 15
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
gttccattgg atttatcctg gc 22
<210> 16
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
<210> 17
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
ctcctttgtt gctgttgact ac 22
<210> 18
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
<210> 19
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
cgtcatcttt cacgagctta tg 22
<210> 20
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
gacattatgc tcctcgaaca ac 22
<210> 21
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
aaattaactg gatgaaggct gc 22
<210> 22
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
agagatgagt tcttgagcgt ag 22
Claims (6)
1. The application of a potato tonoplast monosaccharide transporter StTMT2 gene or protein or a recombinant vector, an expression cassette or a recombinant bacterium containing the gene in improving the content of plant sugar, wherein the nucleotide sequence of the potato tonoplast monosaccharide transporter StTMT2 gene is shown as SEQ ID No. 1.
2. Use according to claim 1, wherein the plants comprise potato and arabidopsis.
3. Use according to claim 1 or 2, wherein the sugar content comprises the potato lamina and tuber sugar content, or the Arabidopsis thaliana lamina sugar content.
4. The application of a potato tonoplast monosaccharide transporter StTMT2 gene or protein or a recombinant vector, an expression cassette or a recombinant bacterium containing the gene in improving the expression quantity of plant sugar metabolism related genes, wherein the nucleotide sequence of the potato tonoplast monosaccharide transporter StTMT2 gene is shown as SEQ ID No. 1.
5. Use according to claim 4, wherein the plants comprise potato and Arabidopsis thaliana.
6. Use according to claim 4, wherein the plant carbohydrate metabolism-related genes include the potato StAGPase, StGBSS and StSPS genes and the Arabidopsis AtAGPase and AtGBSS genes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011559640.8A CN112724211B (en) | 2020-07-22 | 2020-07-22 | Application of potato tonoplast monosaccharide transporter StTMT2 gene in improving plant sugar content |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010708958.1A CN111808181B (en) | 2020-07-22 | 2020-07-22 | Application of potato tonoplast monosaccharide transporter StTMT2 gene |
| CN202011559640.8A CN112724211B (en) | 2020-07-22 | 2020-07-22 | Application of potato tonoplast monosaccharide transporter StTMT2 gene in improving plant sugar content |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010708958.1A Division CN111808181B (en) | 2020-07-22 | 2020-07-22 | Application of potato tonoplast monosaccharide transporter StTMT2 gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112724211A true CN112724211A (en) | 2021-04-30 |
| CN112724211B CN112724211B (en) | 2021-10-22 |
Family
ID=72861672
Family Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010708958.1A Active CN111808181B (en) | 2020-07-22 | 2020-07-22 | Application of potato tonoplast monosaccharide transporter StTMT2 gene |
| CN202011559639.5A Active CN112745377B (en) | 2020-07-22 | 2020-07-22 | Application of potato tonoplast monosaccharide transporter StTMT2 gene in improving plant photosynthetic rate |
| CN202011559640.8A Active CN112724211B (en) | 2020-07-22 | 2020-07-22 | Application of potato tonoplast monosaccharide transporter StTMT2 gene in improving plant sugar content |
Family Applications Before (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010708958.1A Active CN111808181B (en) | 2020-07-22 | 2020-07-22 | Application of potato tonoplast monosaccharide transporter StTMT2 gene |
| CN202011559639.5A Active CN112745377B (en) | 2020-07-22 | 2020-07-22 | Application of potato tonoplast monosaccharide transporter StTMT2 gene in improving plant photosynthetic rate |
Country Status (1)
| Country | Link |
|---|---|
| CN (3) | CN111808181B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114891804A (en) * | 2022-06-08 | 2022-08-12 | 华中农业大学 | Application of TST1 gene in enhancing low-temperature saccharification resistance of potatoes |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050289664A1 (en) * | 2004-01-26 | 2005-12-29 | Monsanto Technology, L.L.C. | Genes encoding 4-Hydroxyphenylpyruvate dioxygenase (HPPD) enzymes for plant metabolic engineering |
| WO2011120549A1 (en) * | 2010-03-27 | 2011-10-06 | Technische Universität Kaiserslautern | Method of enhancing the seed yield and promoting the growth of plants |
| US20160355835A1 (en) * | 2013-03-13 | 2016-12-08 | Carnegie Institution Of Washington | Methods of modulating plant seed and nectary content |
| CN108977462A (en) * | 2018-08-24 | 2018-12-11 | 安徽省农业科学院园艺研究所 | A kind of method of sugar content in raising strawberry fruit |
| CN111073897A (en) * | 2020-01-14 | 2020-04-28 | 华中农业大学 | Application of GhTMT2 gene in regulation of soluble sugar accumulation in cotton |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20110085729A (en) * | 2010-01-21 | 2011-07-27 | 경희대학교 산학협력단 | Ostmt1 gene involved in vacuolar sugar transport from rice |
| DE102014005337A1 (en) * | 2014-04-11 | 2015-10-15 | Friedrich-Alexander-Universität Erlangen-Nürnberg | Tonoplastoid proton / sugar antiporter proteins and their use to increase the sucrose concentration of a sucrose storage organ of plants |
| CN107400671B (en) * | 2017-04-25 | 2021-01-05 | 南京农业大学 | Pear fruit sugar transporter gene PbTMT4 and application thereof |
-
2020
- 2020-07-22 CN CN202010708958.1A patent/CN111808181B/en active Active
- 2020-07-22 CN CN202011559639.5A patent/CN112745377B/en active Active
- 2020-07-22 CN CN202011559640.8A patent/CN112724211B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050289664A1 (en) * | 2004-01-26 | 2005-12-29 | Monsanto Technology, L.L.C. | Genes encoding 4-Hydroxyphenylpyruvate dioxygenase (HPPD) enzymes for plant metabolic engineering |
| WO2011120549A1 (en) * | 2010-03-27 | 2011-10-06 | Technische Universität Kaiserslautern | Method of enhancing the seed yield and promoting the growth of plants |
| US20160355835A1 (en) * | 2013-03-13 | 2016-12-08 | Carnegie Institution Of Washington | Methods of modulating plant seed and nectary content |
| CN108977462A (en) * | 2018-08-24 | 2018-12-11 | 安徽省农业科学院园艺研究所 | A kind of method of sugar content in raising strawberry fruit |
| CN111073897A (en) * | 2020-01-14 | 2020-04-28 | 华中农业大学 | Application of GhTMT2 gene in regulation of soluble sugar accumulation in cotton |
Non-Patent Citations (3)
| Title |
|---|
| ALEXANDRA WORMIT等: "Molecular identification and physiological characterization of a novel monosaccharide transporter from Arabidopsis involved in vacuolar sugar transport", 《THE PLANT CELL》 * |
| KARINA WINGENTER等: "Increased activity of the vacuolar monosaccharide transporter TMT1 alters cellular sugar partitioning, sugar signaling, and seed yield in Arabidopsis", 《PLANT PHYSIOLOGY》 * |
| KY009914.1: "Solanum tuberosum cultivar Ningshu IV monosaccharide-sensing protein mRNA, complete cds", 《GENBANK》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114891804A (en) * | 2022-06-08 | 2022-08-12 | 华中农业大学 | Application of TST1 gene in enhancing low-temperature saccharification resistance of potatoes |
| CN114891804B (en) * | 2022-06-08 | 2024-02-02 | 华中农业大学 | Application of TST1 gene in enhancing low-temperature saccharification resistance of potatoes |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112745377A (en) | 2021-05-04 |
| CN112724211B (en) | 2021-10-22 |
| CN111808181A (en) | 2020-10-23 |
| CN111808181B (en) | 2021-02-26 |
| CN112745377B (en) | 2021-09-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108864267B (en) | Sweet potato carotenoid synthesis and salt-tolerant drought-resistant related protein IbARF5 as well as encoding gene and application thereof | |
| CN110643618B (en) | Jatropha curcas MYB transcription factor JCMYB16 gene and application thereof in improving drought resistance of plants | |
| CN113322261B (en) | Application of soybean ABC transporter gene GmALS3 in breeding of low-phosphorus-resistant and aluminum-toxicity-resistant plants | |
| CN109912701B (en) | Method for improving insect resistance of tomatoes | |
| CN112724211B (en) | Application of potato tonoplast monosaccharide transporter StTMT2 gene in improving plant sugar content | |
| CN109295070A (en) | A kind of and paddy rice anti contravariance related gene OsDTH1 and its coding albumen and application | |
| CN110452917B (en) | Wild grape VyGOLS gene and application of encoding protein thereof in drought stress | |
| CN108610402B (en) | Application of peanut annexin gene AhANN6 in improving high temperature resistance and oxidation stress resistance of plants and microorganisms | |
| CN115807006A (en) | Application of gene fragment B in cultivation of new plant material | |
| CN114807168A (en) | Mung bean VrMIB1 gene and application thereof | |
| CN115491380A (en) | Plant lipoxygenase gene LOX and application thereof in broad-spectrum disease resistance of plants | |
| CN108866074B (en) | Application of herbicide-resistant gene PAR3(G311E) | |
| CN112375129B (en) | Application of SSIP1 small peptide in increasing sizes of seeds and floral organs | |
| CN110734483B (en) | Low-potassium-resistant related protein TaPR1 and coding gene and application thereof | |
| CN113604475B (en) | Application of cotton GH_D03G1517 gene in promotion of drought resistance and salt tolerance | |
| CN110835367B (en) | Pear flowering regulating transcription factor PbrSPL15 and application thereof | |
| CN114591971B (en) | Drought-resistant VvCCD7 gene of grape as well as amino acid sequence and application thereof | |
| CN110922459B (en) | Application of SlSNAT1 protein and related biological material thereof in regulation and control of plant seed aging resistance | |
| CN109678940B (en) | Protein BhDnaJ6, and coding gene and application thereof | |
| CN116396370A (en) | Plant coding gene and protein with functions of improving cadmium resistance and promoting biomass improvement and transgenic strain | |
| CN116218874A (en) | Application of salicornia Hg50329 gene in sodium ion removal | |
| CN104945493A (en) | Soybean protein GmIDD influencing plant growth period as well as encoding gene and application thereof | |
| CN117535318A (en) | Soybean receptor protein kinase gene and application thereof in improving soybean root system structure | |
| CN117343155A (en) | Application of protein and encoding gene thereof in cultivation of stress-resistant plants | |
| CN117304290A (en) | Stress-resistant protein and application of encoding gene thereof in cultivation of stress-resistant plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |