CN112708631B

CN112708631B - Cell-free system protein synthesis method

Info

Publication number: CN112708631B
Application number: CN202011327396.2A
Authority: CN
Inventors: 卢元; 戈钧; 林钲谚; 冯毅
Original assignee: Tsinghua University
Current assignee: Tsinghua University
Priority date: 2020-11-24
Filing date: 2020-11-24
Publication date: 2023-05-02
Anticipated expiration: 2040-11-24
Also published as: CN112708631A

Abstract

A method for synthesizing protein in cell-free system includes adding metal-organic skeleton compound containing gene for coding target protein to be synthesized to cell-free system for synthesizing target protein. According to the method provided by the application, the genes are embedded in the pores of the metal organic framework compound by a precipitation method, and then the metal organic framework compound carrying the genes is placed in a cell-free system, so that macromolecular crowding is caused, the local gene concentration is improved, and the high-yield expression of the proteins of the cell-free system is realized.

Description

Cell-free system protein synthesis method

Technical Field

The application relates to the technical field of synthetic biology, in particular to a cell-free system protein synthesis method.

Background

The cell-free protein synthesis system is a system which utilizes necessary elements including transcription, translation, protein folding and energy metabolism provided by cell extracts of microorganisms and animals and plants, takes exogenous DNA or mRNA as a genetic template, supplements substrates such as amino acid, cofactor, salt ions and the like and energy metabolism substances in a reaction system, and realizes in-vitro expression of protein through coaction.

For decades, cell-free systems have evolved rapidly, with reduced dependence on cells compared to traditional in vivo cell systems, and have the following advantages:

(1) The reaction environment is directly controlled: because the cell-free system has no limitations of cell membranes and cell walls, the environmental variables influencing the synthesis process of cell-free proteins can be directly controlled, such as: ionic strength, pH, temperature, redox environment, etc.

(2) Direct influence on the reaction process: the reaction process is affected by varying the concentration of the reactive ions.

(3) Accelerating the synthesis and purification of target protein: the cell-free system is not affected by cell growth, the synthesis of target protein can be directly carried out without the process of early cell growth, and the obtained protein can be directly purified.

(4) Capable of expressing proteins toxic to cells: the absence of living cells in cell-free systems also avoids the toxic effects of proteins.

(5) Expanding life chemistry: unnatural products, e.g., proteins with unnatural amino acids, can be produced that possess novel structural or functional properties.

(6) The directionally evolved protein can be screened with high throughput.

(7) Can flexibly regulate the formation of a secondary structure of the protein and increase the production proportion of the target conformational protein.

Because of the many advantages of cell-free systems over traditional methods of producing proteins in cells, cell-free systems are now widely used in platform technology development for industrial high-throughput protein production. The primary task is to realize high-yield expression of cell-free systems, and many methods for improving the protein yield of cell-free systems have been generated at present, which are divided into the following five aspects: (1) optimizing a cell extract preparation procedure; (2) improving the energy supply method; (3) a pathway to enhance protein synthesis; (4) optimizing transcription translation elements; (5) macromolecular crowding effect.

While the macromolecular crowding effect, which is a general fundamental feature of all organisms, is of increasing interest in studying its effects in various biological processes, for example, sanders et al studied the transcriptional activation of phage T4 late genes by using crowding agents such as polyethylene glycol (PEG), polyvinyl alcohol, dextran (SANDERS G M, KASSAVETIS G A, GEIDUSCHEK E P.use of a macromolecular crowding agent to dissect interactions and define functions in transcriptional activation by a DNA-trailing protein: bacteriophage T4 gene 45protein and late transcription[J ]. Proceedings of the National Academy of Sciences,1994, 91 (16): 7703-7707). Nakano et al enhanced protein expression by using concentrated wheat germ extract or adding PEG to E.coli extract (NAKANO H, TANAKA T, KAWARASAKI Y, et al Highly produced cell-free protein synthesis system using condensed wheat-germ extract [ J ]. Journal of biotechnology,1996, 46 (3): 275-282). These results all indicate that simulating a crowded macromolecular environment in a cell-free system helps to enhance transcription and translation of proteins, and can increase the expression level of proteins.

However, the crowded environment of macromolecules built by these studies is mainly formed by adding reagents to cell-free systems. The crowded environment created by the method is limited, and the protein expression enhancement rate of the formed cell-free system is limited. Therefore, other methods need to be sought. The cytoplasm is considered to be a "semi-solid" state which is believed to strongly influence the diffusion kinetics of cellular components. For example bacterial mRNA, which is rarely scattered from the production site. Thus, both DNA and mRNA can be considered immobilized in bacterial cells, rather than freely diffusing in solution as in typical in vitro experiments.

Disclosure of Invention

In view of the above drawbacks of the prior art, an object of the present application is to provide a method for synthesizing a cell-free protein system, which uses a metal-organic framework compound to carry genes, and embeds the genes in pores of the metal-organic framework compound by precipitation, thereby causing macromolecular crowding, improving local gene concentration, and realizing high-yield expression of the cell-free protein system.

The application provides the following technical scheme.

1. A cell-free system protein synthesis method, comprising adding a metal-organic framework compound carrying a gene encoding a target protein to be synthesized to a cell-free system to synthesize the target protein.

2. The method for synthesizing a cell-free protein according to item 1, wherein the metal skeleton compound is one or more selected from the group consisting of molecular sieve-like imidazole skeleton ZIF series, uiO series, and zeolite imidazole ester skeleton MIL series.

3. The method for synthesizing a cell-free protein according to item 2, wherein the metal skeleton compound is a molecular sieve-like imidazole skeleton ZIF series, preferably, the molecular sieve-like imidazole skeleton ZIF series is one or more selected from the group consisting of ZIF-8, ZIF-67, ZIF-90 and ZIF-11, and more preferably, ZIF-8.

4. The cell-free system protein synthesis method according to item 2, wherein the metal framework compound is of the UiO series, preferably UiO-66.

5. The cell-free system protein synthesis method according to item 2, wherein the metal framework compound is a zeolitic imidazolate framework MILs series, preferably MILs-101.

6. The method for cell-free protein synthesis system according to any one of claims 1 to 5, wherein the metal-organic framework compound carrying the gene encoding the target protein to be synthesized is a metal-organic framework compound obtained by mixing a metal salt solution, an organic ligand solution and a gene encoding the target protein to be synthesized, and embedding the gene encoding the target protein to be synthesized in pores of the metal-organic framework compound formed by the metal salt solution and the organic ligand solution by a coprecipitation method.

7. The method for synthesizing a cell-free protein according to item 6, wherein the metal salt solution is one or more selected from the group consisting of zinc nitrate solution, zinc acetate solution, cobalt nitrate solution, copper sulfate solution, and ferrous sulfate solution;

the organic ligand solution is selected from one or more than two of 2-methylimidazole, 1-methylimidazole, benzimidazole and imidazole-2-formaldehyde;

preferably, when the metal salt solution is a zinc nitrate solution, the organic ligand solution is 2-methylimidazole, and the molar ratio of 2-methylimidazole to zinc nitrate is (30-90): 1, preferably 60:1;

the mass ratio of the 2-methylimidazole to the zinc nitrate to the gene encoding the target protein to be synthesized is (1000-10000): 248:1, preferably 4100:248:1.

8. the method for cell-free protein synthesis system according to item 6, wherein the protein encoded with the target protein to be synthesized is carriedIn the metal-organic framework compound of the gene, the mass ratio of the gene encoding the target protein to be synthesized to the metal-organic framework compound is (1×10) ^-3 ～9×10 ^-3 ): 1, a step of; preferably 6X 10 ^-3 ：1。

9. The method for cell-free protein synthesis system according to item 6, wherein the metal-organic framework compound has a particle size of 80 to 800nm, preferably 200nm; the pore diameter is 0.2-1.2 nm, preferably 1.2nm;

In a cell-free synthesis system, the concentration of the metal-organic framework compound is less than 100mg/ml, preferably less than 1mg/ml, more preferably less than 0.1mg/ml.

10. The method for cell-free protein synthesis according to item 1, wherein the concentration of the gene encoding the target protein to be synthesized in the cell-free system is 25ng/ul to 75ng/ul, preferably 50 ng/ul.

11. A method for cell-free protein synthesis in a system comprising the steps of:

adding a metal-organic framework compound carrying a gene encoding a target protein to be synthesized and glucose oxidase to a cell-free system;

glucose or hydrochloric acid is added into the cell-free system to break the structure of the metal-organic framework compound and release the gene encoding the target protein to be synthesized so as to trigger the gene encoding the target protein to be synthesized to synthesize the target protein.

12. The method for synthesizing a cell-free protein according to item 11, wherein the metal skeleton compound is one or more selected from the group consisting of molecular sieve-like imidazole skeleton ZIF series, uiO series, and zeolite imidazole ester skeleton MIL series.

13. The method for cell-free protein synthesis system according to item 12, wherein the metal skeleton compound is a molecular sieve-like imidazole skeleton ZIF series, preferably, the molecular sieve-like imidazole skeleton ZIF series is one or more selected from the group consisting of ZIF-8, ZIF-67, ZIF-90 and ZIF-11, and more preferably, ZIF-8.

14. The cell-free system protein synthesis method according to item 12, wherein the metal framework compound is of the UiO series, preferably UiO-66.

15. The cell-free system protein synthesis method according to item 12, wherein the metal framework compound is a zeolitic imidazolate framework MIL series, preferably MIL-101.

16. The method for synthesizing a cell-free protein according to any one of claims 11 to 15, wherein the metal-organic framework compound carrying the gene encoding the target protein to be synthesized and glucose oxidase is a metal-organic framework compound formed by mixing a metal salt solution, an organic ligand solution, glucose oxidase and the gene encoding the target protein to be synthesized, and embedding the gene encoding the target protein to be synthesized and glucose oxidase in pores of the metal-organic framework compound formed by the metal salt solution and the organic ligand solution by a coprecipitation method.

17. The method for cell-free protein synthesis system according to item 16, wherein the metal salt solution is one or more selected from the group consisting of zinc nitrate solution, zinc acetate solution, cobalt nitrate solution, copper sulfate solution, and ferrous sulfate solution;

the mass ratio of the 2-methylimidazole to the zinc nitrate to the gene encoding the target protein to be synthesized to the glucose oxidase is (10000-100000): 1860:1:125, preferably 30750:1860:1:125.

18. the method for cell-free protein synthesis system according to item 16, wherein the mass ratio of the glucose oxidase, the gene encoding the target protein to be synthesized, and the metal-organic framework compound carrying the gene encoding the target protein to be synthesized to the glucose oxidase is 1 (0.002 to 0.008): 10, preferably 1:0.008:10. Can not be changed into a phase

19. The method for synthesizing a cell-free protein according to claim 11, wherein the concentration of glucose added to the cell-free system is 0 to 50mM, preferably 25mM.

20. The method for synthesizing a cell-free protein according to claim 11, wherein the concentration of the hydrochloric acid added to the cell-free system is 1 to 2M, preferably 1.2M.

21. The cell-free protein synthesis system according to item 16, wherein the metal-organic framework compound carrying the gene encoding the target protein to be synthesized and glucose oxidase has a particle size of 80 to 800nm, preferably 200nm; the pore diameter is 0.2 to 1.2nm, preferably 1.2nm.

22. The method for cell-free protein synthesis system according to item 16, wherein,

the concentration of the gene encoding the target protein to be synthesized in the cell-free system is 10 ng/. Mu.l to 30 ng/. Mu.l, preferably 20 ng/. Mu.l.

23. The method for cell-free protein synthesis system according to item 1 or 11, wherein the method for producing a cell-free system comprises the steps of: disrupting the cells to obtain a cell extract, and then adding RNA polymerase and cofactors to obtain a cell-free system.

24. The method for cell-free protein synthesis system according to item 23, wherein the RNA polymerase is T7 RNA polymerase, preferably T7 RNA polymerase extracted using \E.coli BL21 comprising plasmid AR 1219.

25. The method for cell-free protein synthesis system according to item 1 or 11, wherein the gene encoding the target protein is present in the form of a plasmid or linear DNA.

According to the method provided by the application, when the gene concentration is higher, the genes are embedded in the pores of the metal-organic framework compound by a precipitation method, and then the metal-organic framework compound carrying the genes is placed in a cell-free system, so that macromolecular crowding is caused, the local gene concentration is improved, and the high-yield expression of the proteins in the cell-free system is realized.

When the gene concentration is low, embedding the genes and glucose oxidase into pores of the metal organic framework compound by a coprecipitation method, then placing the metal organic framework compound carrying the genes and glucose oxidase into a cell-free system, destroying the structure of the metal organic framework compound by glucose or hydrochloric acid, then releasing the genes in the metal organic framework compound, and carrying out high-yield expression of proteins of the cell-free system by the released genes.

According to the method provided by the application, the dynamics test shows that the metal organic framework compound carrying the gene has better dynamics behavior when carrying out cell-free reaction, and can synthesize the target protein more efficiently and rapidly.

Drawings

FIG. 1 is a scanning electron microscope control of the plasmids @ ZIF-8 and ZIF-8 prepared in example 1.

FIG. 2 is an X-ray diffraction pattern of the plasmids @ ZIF-8 and ZIF-8 prepared in example 1.

FIG. 3 is a photograph of a laser confocal microscope of plasmid @ ZIF-8 prepared in example 1.

FIG. 4 is a comparative graph of protein expression of plasmids @ ZIF-8 and ZIF-8 prepared in example 1.

FIG. 5 is a graph comparing the effect of different molar ratios of 2-methylimidazole to zinc nitrate on plasmid activity.

FIG. 6 shows the effect of varying concentrations of pET-23a-sfGFP plasmid on cell-free protein expression.

FIG. 7 shows the effect of plasmids @ ZIF-8 of different sizes on the synthesis of proteins in a cell-free system.

FIG. 8 is a comparative graph of kinetic experiments of plasmids @ ZIF-8 and ZIF-8 prepared in example 1.

FIG. 9 is a graph showing comparison of transcription process tests of the plasmids @ ZIF-8 and ZIF-8 prepared in example 1.

FIG. 10 is a graph showing the comparison of the scanning electron microscope and the electron transmission microscope of the plasmids & GOx@ZIF-8 and ZIF-8 prepared in example 5.

FIG. 11 is an X-ray diffraction pattern of the plasmid & GOx@ZIF-8 prepared in example 5 and plasmids @ ZIF-8 and ZIF-8.

FIG. 12 is a laser confocal microscope photograph of plasmid & GOx@ZIF-8 prepared in example 5.

FIG. 13 is a graph showing comparison of protein expression of plasmids & GOx@ZIF-8 and ZIF-8 prepared in example 5.

FIG. 14 is a graph of toxicity test results of MOF materials for cell-free systems.

Detailed Description

Exemplary embodiments of the present application are described below, including various details of embodiments of the present application to facilitate understanding, which should be considered as merely exemplary. Accordingly, one of ordinary skill in the art will recognize that various changes and modifications of the embodiments described herein can be made without departing from the scope and spirit of the present application. Also, descriptions of well-known functions and constructions are omitted in the following description for clarity and conciseness.

It should be noted that certain terms are used throughout the description and claims to refer to particular components. Those of skill in the art will understand that a person may refer to the same component by different names. The specification and claims do not identify differences in terms of components, but rather differences in terms of the functionality of the components. As referred to throughout the specification and claims, the terms "include" or "comprising" are used in an open-ended fashion, and thus should be interpreted to mean "include, but not limited to. The description hereinafter sets forth the preferred embodiment for carrying out the present application, but is not intended to limit the scope of the present application in general, as the description proceeds. The scope of the present application is defined by the appended claims.

The present application provides a cell-free system protein synthesis method (first method) comprising adding a metal-organic framework compound carrying a gene encoding a target protein to be synthesized to a cell-free system to perform synthesis of the target protein.

Genes encoding target proteins to be synthesized are located in the interstices of the surface as well as the interior of the metal-organic framework compound.

The type of the gene encoding the target protein to be synthesized is not particularly limited as long as it can be used as a gene template for synthesizing the target protein, and for example, it may be linear DNA or mRNA, circular DNA or RNA, DNA or RNA of any origin, or DNA or RNA of any structural form, as long as it can be finally transcribed and translated into a protein as a gene template. Specifically, in the case of plasmid DNA, the expression plasmid may be one carrying a gene encoding the target protein.

The number of amino acids contained in the target protein to be synthesized is not limited in any way, and for example, the target protein to be synthesized may contain 10 to 3000 amino acids, preferably 10 to 1000 amino acids, and for example, the target protein to be synthesized may contain 10 amino acids, 50 amino acids, 100 amino acids, 200 amino acids, 300 amino acids, 400 amino acids, 500 amino acids, 600 amino acids, 700 amino acids, 800 amino acids, 900 amino acids, 1000 amino acids, 2000 amino acids, 3000 amino acids, and the like.

The gene of the target protein to be synthesized is not limited at all, and may be, for example, a gene encoding a fluorescent protein, a gene encoding a biocatalytic enzyme, a gene encoding a vaccine protein, a gene encoding an antibody protein, a gene encoding a membrane protein, a gene encoding a polypeptide, or the like.

In the application, the metal framework compound is selected from one or more than two of molecular sieve imidazole framework ZIF series, uiO series and zeolite imidazole ester framework MIL series.

In the present application, the metal framework compound is a molecular sieve-like imidazole framework ZIF series, preferably, the molecular sieve imidazole framework ZIF series is one or more selected from ZIF-8, ZIF-67, ZIF-90 and ZIF-11, and more preferably, ZIF-8.

When the metal framework compound is of the UiO series, it is preferably UiO-66.

When the metal framework compound is zeolite imidazole ester framework MIL series, MIL-101 is preferred.

In the present application, the metal-organic framework compound carrying the gene encoding the target protein to be synthesized is a metal-organic framework compound in which the gene encoding the target protein to be synthesized is embedded in the pores of the metal-organic framework compound formed by the metal salt solution and the organic ligand solution by mixing the metal salt solution, the organic ligand solution, and the gene encoding the target protein to be synthesized by a coprecipitation method.

The Metal Organic Framework (MOF) is an ordered network structure formed by organic ligands and metal cations through coordination, and has the advantages of rich pore structure, large specific surface area, high porosity, adjustable structure and the like. Since the mesoporous structure of MOFs is capable of high concentration biomolecular loading, it can be used to immobilize, store and release functional biomolecules such as proteins, enzymes and DNA or RNA. The framework structure of MOFs can significantly improve the thermal and chemical stability of the encapsulated molecules. The application uses MOF material to wrap plasmid, constructs compartment in cell-free system, causes macromolecular crowding effect, and improves the expression quantity of protein.

The genes encoding the target proteins to be synthesized do not affect the reaction of the organic ligand and the metal cations to generate the metal organic framework compound, and the genes encoding the target proteins to be synthesized are embedded in gaps of the metal organic framework compound in the reaction process of the organic ligand and the metal cations, so that the local gene concentration is improved, and the high-yield expression of the proteins of a cell-free system is realized.

In the application, the metal salt solution is one or more than two of zinc nitrate solution, zinc acetate solution, cobalt nitrate solution, copper sulfate solution and ferrous sulfate solution;

The organic ligand solution is selected from one or more than two of 2-methylimidazole, 1-methylimidazole, benzimidazole and imidazole-2-formaldehyde.

Zinc nitrate solution and 2-methylimidazole can be synthesized into ZIF-8 by a coprecipitation method. The molar ratio of the 2-methylimidazole to the zinc nitrate is (30-90): 1, preferably 60:1, a step of;

in the present application, the mass ratio of the gene encoding the target protein to be synthesized to the metal-organic framework compound is (1X 10) ^-3 ～9×10 ^-3 ): 1, a step of; preferably 6X 10 ^-3 ：1。

In synthesizing a metal-organic framework compound carrying a gene encoding a target protein to be synthesized, the gene encoding the target protein to be synthesized is substantially incorporated into pores of the metal-organic framework compound or embedded in pores on the surface of the metal-organic framework compound.

The mass ratio of the gene encoding the target protein to be synthesized to the metal-organic framework compound may be (1X 10) ^-3 )：1、(1.5×10 ^-3 )：1、(2×10 ^-3 )：1、(2.5×10 ^-3 )：1、(3×10 ^-3 )：1、(3.5×10 ^-3 )：1、(4×10 ^-3 )：1、(4.5×10 ^-3 )：1、(5×10 ^-3 )：1、(5.5×10 ^-3 )：1、(6×10 ^-3 )：1、(6.5×10 ^-3 )：1、(7×10 ^-3 )：1、(7.5×10 ^-3 )：1、(8×10 ^-3 )：1、(9×10 ^-3 )：1。

In the present application, the particle size of the metal-organic framework compound (all particle sizes herein are average particle sizes) is 80 to 800nm, preferably 200nm; the pore size (all pore sizes herein are average pore sizes) is from 0.2 to 1.2nm, preferably 1.2nm.

The metal organic framework compound may have a particle size of 80nm, 90nm, 100nm, 110nm, 120nm, 130nm, 140nm, 150nm, 160nm, 170nm, 180nm, 190nm, 200nm, 210nm, 220nm, 230nm, 240nm, 250nm, 260nm, 270nm, 280nm, 290nm, 300nm, 320nm, 350nm, 380nm, 400nm, 420nm, 450nm, 480nm, 500nm, 520nm, 550nm, 580nm, 600nm, 620nm, 650nm, 680nm, 700nm, 720nm, 750nm, 780nm, 800nm.

The pore diameter of the metal organic framework compound can be 0.2nm, 0.3nm, 0.4nm, 0.5nm, 0.6nm, 0.7nm, 0.8nm, 0.9nm, 1.0nm, 1.1nm and 1.2nm.

In a cell-free synthesis system, the metal-organic framework compound may be present at a concentration of 100mg/ml, 90mg/ml, 80mg/ml, 70mg/ml, 60mg/ml, 50mg/ml, 40mg/ml, 30mg/ml, 20mg/ml, 10mg/ml, 9mg/ml, 8mg/ml, 7mg/ml, 6mg/ml, 5mg/ml, 4mg/ml, 3mg/ml, 2mg/ml, 1mg/ml, 0.9mg/ml, 0.8mg/ml, 0.7mg/ml, 0.6mg/ml, 0.5mg/ml, 0.4mg/ml, 0.3mg/ml, 0.2mg/ml, 0.1mg/ml, 0.09mg/ml, 0.08mg/ml, 0.07mg/ml, 0.06mg/ml, 0.05mg/ml, 0.04mg/ml, 0.03mg/ml, 0.02mg/ml, 0.003mg/ml, 0.01mg/ml, 0.002mg/ml, 0.008/ml, 0.001mg/ml, 0.005/ml, 0.001mg/ml ^-4 mg/ml、10 ^-5 mg/ml、10 ^-6 mg/ml。

When the concentration of the metal-organic framework compound is too high, the expression of the protein of the cell-free system is affected, and when the concentration of the metal-organic framework compound is less than 1mg/ml, the expression of the protein of the cell-free system is hardly affected.

In a cell-free system, the concentration of the gene encoding the target protein to be synthesized is 25ng/ul to 75ng/ul, preferably 50 ng/ul;

in the first method, the concentration of the gene encoding the target protein to be synthesized in a cell-free system may be 25 ng/. Mu.l, 30 ng/. Mu.l, 35 ng/. Mu.l, 40 ng/. Mu.l, 45 ng/. Mu.l, 50 ng/. Mu.l, 55 ng/. Mu.l, 60 ng/. Mu.l, 65 ng/. Mu.l, 70 ng/. Mu.l, and 75 ng/. Mu.l.

In this application, the method of preparing the cell-free system comprises the steps of: disrupting the cells to obtain a cell extract, and then adding RNA polymerase and cofactors to obtain a cell-free system, i.e., the cell-free system comprises the cell extract, the RNA polymerase and the cofactors.

The cell extract is derived from bacterial cells or rabbit reticulocytes or wheat germs or insects, preferably bacterial cell extract; the bacterial cell may be a cell extract of any bacterial strain, such as E.coli.

An RNA polymerase that recognizes a promoter to which a gene of interest is operably linked, such as T7 RNA polymerase;

in performing cell-free synthesis, the cofactor provides substances required for protein synthesis, including, for example, energy source substances, amino acids, salts, mg ²⁺ As well as other reagents.

The energy source material is a chemical substrate that can be enzymatically acted upon to provide energy to effect the desired chemical reaction, commonly used energy sources allow for the release of energy for synthesis by cleavage of the high energy phosphate bond as present in nucleoside triphosphates (e.g., ATP), any source that can convert the high energy phosphate bond is particularly suitable, generally ATP, GTP and other phosphates are considered equivalent energy sources for supporting protein synthesis, in the present invention nucleoside triphosphate mixtures (NTPmix) including spermidine, putrescine, nicotinamide adenine dinucleotide, ATP, CTP, GTP, UTP, coA, tRNA and folinic acid are preferred.

The amino acids include arginine (Arg), valine (Val), tryptophan (Trp), phenylalanine (Phe), isoleucine (Ile), leucine (Leu), cysteine (Cys), methionine (Met), alanine (Ala), asparagine (Asn), aspartic acid (Asp), glycine (Gly), glutamine (Gln), lysine (Lys), proline (Pro), serine (Ser), threonine (Ser), tyrosine (Tyr);

The salts include potassium glutamate, ammonium glutamate and potassium oxalate monohydrate;

such other agents include oxidized glutathione, reduced glutathione, and PEG8000.

In this application, the gene encoding the protein of interest is in the form of a plasmid or linear DNA, preferably the pET-23a-sfGFP plasmid.

The application also discloses a cell-free system protein synthesis method (second method), which comprises the following steps:

step one: adding a metal-organic framework compound carrying a gene encoding a target protein to be synthesized and glucose oxidase to a cell-free system;

step two: glucose or hydrochloric acid is added into the cell-free system to trigger the structural rupture of the metal-organic framework compound, so that the gene encoding the target protein to be synthesized is released, and the gene encoding the target protein to be synthesized is used for synthesizing the target protein.

In the first step, the metal-organic framework compound carrying the gene encoding the target protein to be synthesized and the glucose oxidase is prepared by mixing a metal salt solution, an organic ligand solution, the glucose oxidase and the gene encoding the target protein to be synthesized, and embedding the gene encoding the target protein to be synthesized and the glucose oxidase into pores of the metal-organic framework compound formed by the metal salt solution and the organic ligand solution by adopting a coprecipitation method.

The types of the metal skeleton compound, the metal salt solution, the organic ligand solution, and the gene encoding the target protein to be synthesized in the present method are the same as those of the metal skeleton compound, the metal salt solution, the organic ligand solution, and the gene encoding the target protein to be synthesized in the foregoing method.

In the present application, when the metal salt solution is a zinc nitrate solution, the organic ligand solution is 2-methylimidazole, and the molar ratio of 2-methylimidazole to zinc nitrate is (30-90): 1, preferably 60:1;

in synthesizing a metal-organic framework compound carrying a gene encoding a target protein to be synthesized and glucose oxidase, the gene encoding the target protein to be synthesized and glucose oxidase both enter into pores of the metal-organic framework compound or are embedded on pores on the surface of the metal-organic framework compound.

In the present application, the mass ratio of the glucose oxidase (GOx), the gene encoding the target protein to be synthesized, and the metal-organic framework compound is 1 (0.002-0.008): 10, preferably 1:0.008:10.

The mass ratio of glucose oxidase (GOx), gene encoding the target protein to be synthesized, and the metal organic framework compound may be 1:0.002:10, 1:0.003:10, 1:0.004:10, 1:0.005:10, 1:0.006:10, 1:0.007:10, 1:0.008:10.

In the present application, the concentration of glucose added to the cell-free system is 0 to 50mM, preferably 25mM.

The glucose concentration may be 1mM, 5mM, 10mM, 15mM, 20mM, 25mM, 30mM, 35mM, 40mM, 45mM, 50mM.

In the present application, the concentration of the hydrochloric acid added to the above cell-free system is 0 to 2M, preferably 1.2M.

The concentration of the hydrochloric acid may be 0.1M, 0.2M, 0.3M, 0.4M, 0.5M, 0.6M, 0.7M, 0.8M, 0.9M, 1.0M, 1.1M, 1.2M, 1.3M, 1.4M, 1.5M, 1.6M, 1.7M, 1.8M, 1.9M, 2M.

In the present application, the particle size of the metal-organic framework compound carrying the gene encoding the target protein to be synthesized and glucose oxidase is 80 to 800nm, preferably 200nm. The pore diameter is 0.2 to 1.2nm, preferably 1.2nm.

The size of the metal organic framework compound carrying the gene encoding the target protein to be synthesized and glucose oxidase is 80nm, 90nm, 100nm, 110nm, 120nm, 130nm, 140nm, 150nm, 160nm, 170nm, 180nm, 190nm, 200nm, 210nm, 220nm, 230nm, 240nm, 250nm, 260nm, 270nm, 280nm, 290nm, 300nm, 320nm, 350nm, 380nm, 400nm, 420nm, 450nm, 480nm, 500nm, 520nm, 550nm, 580nm, 600nm, 620nm, 650nm, 680nm, 700nm, 720nm, 750nm, 780nm, 800nm.

The pore size of the metal-organic framework compound carrying the gene encoding the target protein to be synthesized and glucose oxidase may be 0.2nm, 0.3nm, 0.4nm, 0.5nm, 0.6nm, 0.7nm, 0.8nm, 0.9nm, 1.0nm, 1.1nm, 1.2nm.

In a cell-free system, the concentration of the metal-organic framework compound is less than 100mg/ml, preferably less than 1mg/ml, more preferably less than 0.1mg/ml.

In the cell-free synthesis system, the concentration of the gene encoding the target protein to be synthesized is 10 ng/. Mu.l to 30 ng/. Mu.l, preferably 20 ng/. Mu.l.

In the second method, the concentration of the gene encoding the target protein to be synthesized is 10 ng/. Mu.l, 11 ng/. Mu.l, 12 ng/. Mu.l, 13 ng/. Mu.l, 14 ng/. Mu.l, 15 ng/. Mu.l, 16 ng/. Mu.l, 17 ng/. Mu.l, 18 ng/. Mu.l, 19 ng/. Mu.l, 20 ng/. Mu.l, 21 ng/. Mu.l, 22 ng/. Mu.l, 23 ng/. Mu.l, 24 ng/. Mu.l, 25 ng/. Mu.l, 26 ng/. Mu.l, 27 ng/. Mu.l, 28 ng/. Mu.l, 29 ng/. Mu.l, 30 ng/. Mu.l.

In this application, when the concentration of the gene encoding the target protein to be synthesized is 20 to 700 ng/. Mu.l, preferably 200 ng/. Mu.l, the amount of the gene involved in the cell-free reaction is 200ng.

ZIF-8 carrying plasmid is abbreviated as plasmid @ ZIF-8.

ZIF-8 carrying plasmid, glucose oxidase is abbreviated as plasmid & GOx@ZIF-8.

Materials used in the examples herein, as well as the test methods, are generally and/or specifically described, and in the examples below,% represents wt%, i.e., weight percent, unless otherwise specifically indicated. The reagents or apparatus used were conventional reagent products commercially available without the manufacturer's knowledge.

Wherein the Escherichia coli is purchased from Beijing Bomaide Gene technology Co., ltd

The strain E.coli BL21 (DE 3) -pAR1219, a plasmid containing the gene encoding the T7 RNA polymerase purchased at Addgene, was transformed into E.coli BL21 (DE 3) competent cells by chemical transformation.

LSM-780 laser confocal microscope was purchased from Zeiss

Quantum studio real-time fluorescent quantitative PCR apparatus was purchased from applied biosystems

Sirion 200 scanning electron microscope was purchased from Hitachi high technology Co

TI-2 fluorescence microscope was purchased from Nikon, japan

C1000PCR instrument was purchased from Bio-Rad

Primer 1 and primer 2 were purchased from the biotechnology company, su zhou Jin Weizhi, and the sequences of primer 1 and primer 2 are shown in SEQ ID No.1 and SEQ ID No.2, respectively.

Wherein the primer 1 has the sequence of CGATCCCGCGAAATTAATACGACTCAC

Primer 2 has the sequence TTAATGATGGTGATGGTGATGTTTGTACAGTTCATC

pET-23a-sfGFP plasmid (from Souzhou Jin Weizhi Biotech Co.)

X-ray diffraction (XRD): XRD patterns were recorded using a Bruker D8 Advance X-ray diffractometer at 40kV and 40mA using cuka line (λ= 0.15406 nm). Scanning is performed in a range of 2 theta from 5 to 50 theta.

Scanning Electron Microscope (SEM): SEM images of the samples were taken on a Sirion 200 SEM at an accelerating voltage of 5.0 kV.

Confocal laser scanning microscope images (CLSM) were taken on a Zeiss LSM 780 confocal microscope.

Example 1

(one) preparation of ZIF-8 carrying the pET-23a-sfGFP plasmid (plasmid @ ZIF-8)

743.75mg of Zn (NO) ₃ ) ₂ ·6H ₂ O was dissolved in 10mL of deionized water to form a zinc nitrate solution (0.25M), and then 2.46g of 2-methylimidazole was dissolved in 16mL of deionized water to form a 2-methylimidazole solution (1.875M). Zinc nitrate solution (0.2 mL, 0.25M), pET-23a-sfGFP plasmid solution (200. Mu.L, 300 ng/. Mu.L) and 2-methylimidazole solution (1.6 mL, 1.875M) were mixed (molar ratio of 2-methylimidazole to zinc nitrate: 60), stirred at room temperature for about 0.5 hours, and then allowed to flowThe product was collected by centrifugation at 12000rpm for 10 minutes and washing with deionized water 3 times. The product was dried overnight in a vacuum freeze dryer to give the product as a powder.

To confirm that the powdered product still maintains its original ZIF-8 structure, the powdered product was structurally characterized. The prepared powdery product and ZIF-8 were subjected to Scanning Electron Microscope (SEM) imaging and X-ray diffraction (XRD) characterization, and the morphology and diffraction peaks thereof were observed, and the results are shown in FIG. 1 (ZIF-8 in FIG. 1a and ZIF-8 in FIG. 1 b).

From FIGS. 1 and 2, it can be seen that the powdered product has the same morphology and structure as ZIF-8 and the same diffraction peak. This also demonstrates that the plasmid does not affect the structure of ZIF-8.

To confirm successful embedding of the plasmid into ZIF-8, a confocal laser microscope test was performed. The fluorescein-labeled plasmid solution was reacted according to the above experimental procedure to obtain a powdery product. Deionized water was added to the prepared powdery product for resuspension, diluted to a concentration of 10mg/mL, and the mixture was dropped onto a glass slide, and observed with a Zeiss LSM-780 inverted laser confocal microscope. The results are shown in FIG. 3. A uniform plasmid distribution can be seen inside ZIF-8.

In summary, the powdered product was plasmid @ ZIF-8.

(II) preparation of cell-free systems

(1) Preparation of E.coli cell extract

Configuration of A-related solutions

(1) Culture medium: 2 XYTP: 16g/L peptone, 10g/L yeast extract, 5g/L NaCl,40mM K2HPO4, 22mM KH2PO4, 1.5% agar was added to prepare the solid plates.

(2) Tris:2M Tris, high temperature sterilization and room temperature storage.

(3) DTT:1M DTT, which is sterilized by filtration using a 0.22 μm filter head, is stored at-20 ℃.

(4) S30A:14mM magnesium glutamate, 60mM potassium glutamate, 50mM Tris, pH adjusted with acetic acid to 7.7,4 ℃for storage.

(5) S30B:14mM magnesium glutamate, 60mM potassium glutamate, 2M Tris to pH 8.2,4C for storage.

B method step

(1) First-stage seed liquid: the bacteria were picked up in 10mL of 2 XYTP medium and cultured overnight at 37℃and 220 rpm.

(2) Secondary seed liquid: the primary seed solution was transferred to 200mL of 2 XYTP medium and cultured at 37℃and 220rpm for about 3 hours.

(3) And (3) tertiary fermentation: transferring the second-stage seed solution to a 1L shaking flask, and culturing at 37 ℃ and 220 rpm; if inoculated in a 4L fermenter, the cells were cultured at 37℃and 500 rpm.

(4) Harvesting the cells: monitoring growth condition during culture, centrifuging at 5000 rpm for 10min to collect cells at late stage (about 3-4 hr), washing thallus with S30A for 2 times, weighing thallus mass, and directly performing subsequent operation or preserving at-80deg.C.

(5) Disruption of cells: 1mL of S30A was added to the mixture at a wet weight of 1g of the cells, and the mixture was resuspended to homogenate. A large amount of ice or ice bags are added into a chamber of a high-pressure crusher, the temperature is kept low, the pressure is controlled to be 15000-20000 psi, and the crusher is crushed for 2 times.

(6) Incubation: the cell debris was centrifuged at 13000rpm at 4℃for 30min, the supernatant was collected and the volume was measured, DTT was added in a proportion of 3. Mu.L of 1M DDT to 1mL of cell lysate, and incubated at 37℃for 80min at 120rpm in the absence of light.

(7) And (3) dialysis: centrifugation is carried out at 13000rpm for 30min at 4 ℃, the supernatant is transferred to a 6-8 kDa dialysis bag and placed in 1L S30B for dialysis overnight at 4 ℃.

(8) Split charging and freezing storage: the dialyzed cell extracts were collected and centrifuged at 13000rpm at 4℃for 30min, and the resulting supernatants were aliquoted into 1.5mL EP tubes, flash frozen in liquid nitrogen and stored at-80 ℃.

(2) Preparation of T7 RNA polymerase

Preparation of A-related solution

(1) Culture medium: LB liquid (solid) medium: 1% NaCl,1% tryptone, 0.5% yeast extract (1.5% agar).

(2) Cell lysate: 50mMNaCl,10mM EDTA,10mM K2HPO4,1mM DTT,10mM beta-mercaptoethanol, 1 Xprotease inhibitor, 5% glycerol, pH 8.0.

(3) Dialysis buffer: 50mMNaCl,1mM EDTA,40mM K2HPO4,1mM DTT,20% sucrose, pH 7.7.

(4) S30 buffer: 10mM Tris-acetic acid, 14mM magnesium acetate, 60mM potassium acetate, acetic acid was adjusted to pH 8.2.

B operation step

(1) The strain E.coli BL21 (DE 3) -pAR1219 (Amp resistance) containing the T7 RNA polymerase plasmid was activated and selected to 10mL of LB medium, followed by culturing at 37℃and 220rpm overnight to obtain a seed solution.

(2) Transfer to 1L baffle flask containing 200mL LB medium, culture at 37℃and 220 rpm.

(3) When the OD600 value reaches 0.6 to 0.8, IPTG is added to a final concentration of 0.1mM.

(4) Culturing for 2-3 hr, and centrifuging at 4deg.C and 10000rpm for 10min to obtain thallus, and pre-cooling cell lysate and dialysis buffer.

(5) The cells were transferred to a 50mL BD tube, the wet weight was measured, and the cells were washed 2 times with 10 volumes of S30 buffer (4 ℃ C., 10000rpm,10 min).

(6) Adding precooled cell lysate into each gram of thallus wet weight, re-suspending thallus, and breaking cells by an ultrasonic breaker (carried out on ice), wherein the total time is set to 40min, the power is 35%, and the ultrasonic treatment is carried out for 2s and the intermittent time is set to 6s.

(7) The crushed solution was centrifuged at 13000rpm at 4℃for 30min to leave a supernatant.

(8) The supernatant was transferred to a 6-8 kDa dialysis bag and placed in 1L of pre-chilled buffer for dialysis overnight.

(9) The dialyzed disruption solution was transferred to a fresh BD tube, centrifuged at 13000rpm at 4℃for 30min, and the supernatant was collected.

Is packed into 1.5mL EP tubes, flash frozen with liquid nitrogen, and stored at-80 ℃.

(3) Other components of cell-free systems

ANTP Mix: preparing 1.5M spermidine and 1M putrescine at-80deg.C. The other components are added one by one according to the sequence of the table, and the next reagent is added after the previous reagent is completely dissolved. The final pH of the solution is 7.4-7.6, and the solution is preserved at-80deg.C after liquid nitrogen flash freezing.

TABLE 1 NTP Mix Components

Component (A)	Concentration of stock solution	Concentration of stock solution	System concentration
				Spermidine	1.5M	37.5mM	1.5mM
Putrescine	1M	25mM	1mM
				Nicotinamide adenine dinucleotide	0.3g/mL	8.3mM	0.33mM
ATP	0.5g/mL	30mM	1.2mM
				CTP	0.5g/mL	21.5mM	0.86mM
GTP	0.1g/mL	21.5mM	0.86mM
				UTP	0.5g/mL	21.5mM	0.86mM
CoA	0.1g/mL	6.8mM	0.27mM
				tRNA	0.1g/mL	4.3mg/mL	170μg/mL
Folinic acid	0.1g/mL	0.9mg/mL	34g/mL

B25×pep: the whole process of phosphoenolpyruvate (PEP) preparation is carried out on ice. Sterile water was added at a rate of 1g/mL and then the solution was adjusted to pH 7.4 with 10M KOH at room temperature, which was slowly added dropwise due to the large heat evolved during the KOH addition.

C19 AAs: the concentrations of the 19 amino acids are 50mM, and the amino acids are prepared by adding the amino acids one by one. Arginine (Arg), valine (Val), tryptophan (Trp), phenylalanine (Phe), isoleucine (Ile), leucine (Leu), cysteine (Cys), methionine (Met), alanine (Ala), asparagine (Asn), aspartic acid (Asp), glycine (Gly), glutamine (Gln), lysine (Lys), proline (Pro), serine (Ser), threonine (Ser), tyrosine (Tyr) in this order, without filtration, and pH was adjusted to 7.4 by adding concentrated hydrochloric acid to a final pH of about 8.

D10×salt: ammonium glutamate is prepared by ammonia water (NH3.H2O) and glutamic acid (Glu) with the mol ratio of 1:1, pH adjustment, filtration, split charging, liquid nitrogen flash freezing and storage at-80 ℃.

TABLE 2 10 xSalt Components

E Mg ²⁺ : preparation of Mg at 1M concentration ²⁺ The solution was flash frozen in liquid nitrogen and stored at-80 ℃.

F, preparing other reagents:

(1) oxidized glutathione (GSSG): stock solution concentration was 100mM, in CFPS concentration was typically 4mM, flash frozen in liquid nitrogen, and stored at-80 ℃.

(2) Reduced Glutathione (GSH): stock solution concentration was 100mM, CFPS concentration was typically 1mM, flash frozen in liquid nitrogen, and stored at-80 ℃.

(3) PEG8000: 20g PEG8000 is dissolved in 100mL deionized water and stored at normal temperature.

(III) Synthesis of proteins in cell-free System

Cell-free protein synthesis systems were constructed in 1mLEP tubes according to the compositions shown in Table 3:

TABLE 3 cell-free System composition

Component (A)	Reaction system (20. Mu.L)
		10×Salt	2μL
PEP	1.6μL
		NTP Mix	0.8μL
19AAs	0.8μL
		GSSG	0.8μL
GSH	0.2μL
		Mg ²⁺	0.4μL
T7RNA polymerase	0.2μL
		PEG8000	2.5μL
E.coli cell extract	5μL
		Plasmid @ ZIF-8/pET-23a-sfGFP plasmid solution	Pending
ddH2O	Pending

To the cell-free system 5. Mu.L of the plasmid @ ZIF-8 was added and the cell-free reaction was performed overnight at 30 ℃. mu.L of pET-23a-sfGFP plasmid solution of the same concentration was taken and used as a positive control for cell-free reaction. The fluorescence value was measured by using an enzyme-labeled instrument, and the results are shown in FIG. 4.

As can be seen from FIG. 4, plasmid @ ZIF-8 was able to increase the fluorescence value of the final fluorescent protein when compared to pET-23a-sfGFP plasmid solution when subjected to a cell-free reaction. Because the quantity of pET-23a-sfGFP plasmid entering the interior of the ZIF-8 structure is high, a large quantity of pET-23a-sfGFP plasmid is extruded in the interior of the ZIF-8 structure, so that a macromolecular crowding environment is caused, the local gene template concentration is improved, and further, the high-yield expression of the protein is realized, and therefore, the macromolecular crowding effect constructed by the plasmid @ ZIF-8 can effectively improve the expression quantity of the protein.

Example 1.1 (kinetic test)

In order to investigate whether the effect of macromolecular crowding formed by a metal organic framework compound carrying a plasmid influences the kinetic behavior of a cell-free reaction, the inventors monitored the change of the protein expression level of the cell-free system with the increase of the reaction time.

According to the procedure of example 1, pET-23a-sfGFP plasmid solution, zinc nitrate and 2-methylimidazole were mixed in the proportions of example 1, 5. Mu.L was taken and reacted at 30℃and samples were taken every other hour to measure the fluorescence value of the protein. Cell-free reactions were performed simultaneously using pET-23a-sfGFP plasmid solutions with the same concentration, sampled every one hour as a positive control. The experimental results are shown in FIG. 8.

From FIG. 8, it is understood that the expression amount of fluorescent protein showed a tendency to gradually increase with time. However, there was still a clear difference between the two systems of plasmid @ ZIF-8 and plasmid solution. First, the plasmid @ ZIF-8 system has a longer time span. Plasmid @ ZIF-8 was subjected to a cell-free reaction to achieve a plateau in protein expression after 8 hours, whereas plasmid solution reached the plateau after 4 hours of reaction. In addition, the plasmid @ ZIF-8 system expresses the protein faster than the plasmid solution. Therefore, plasmid @ ZIF-8 has better kinetic behavior when subjected to cell-free reaction.

Example 1.2 (transcription Process test)

In order to further explore the potential mechanism of the metal organic framework compound carrying the plasmid to improve the protein expression amount of the cell-free system, the applicant carried out transcription analysis of the cell-free reaction process.

According to the procedure of example 1, pET-23a-sfGFP plasmid solution, zinc nitrate and 2-methylimidazole were mixed according to the ratio of example 1, 5. Mu.L was taken for cell-free reaction for 8 hours, and samples were taken every other hour and stored at-20 ℃. Plasmid solutions with the same concentration were used simultaneously as positive controls.

Carrying out real-time fluorescence quantitative nucleic acid amplification detection on the obtained cell-free reaction system, wherein the method comprises the following specific steps of: the method comprises the following steps:

1. first, total mRNA was extracted from the reaction system (Eastep Super Total RNA Extraction Kit, promega Corporation)

(1) Sample lysate preparation: mu.L of the cell-free system was aspirated, 100. Mu.L of nuclease-free water was added for dilution, 200. Mu.L of RNA lysate was added, and the mixture was homogenized.

(2) To the sample lysate was added 300. Mu. LRNA dilution and allowed to stand for 3-5min.

(3) Adding 300 μl of absolute ethanol, blowing for 3-4 times, and mixing.

(4) The mixture was added to a centrifuge column and centrifuged at 13000rpm for 1min, and the liquid in the tube was discarded.

(5) 600. Mu.L of RNA wash was added and centrifuged at 13000rpm for 1min, and the tube was discarded.

(6) Preparing DNase I incubation liquid, as shown in the following table:

TABLE 5 DNase I incubation Components

Reagent(s)	Volume of
		10 XDNase I buffer	5μL
DNase I	5μL
		Nuclease-free water	40μL

(7) mu.L of DNase I incubation was added to the adsorption membrane and allowed to stand at room temperature for 15min.

(8) 600. Mu.L of RNA wash was added, centrifuged at 13000rpm for 45s, the filtrate was discarded, and the column was repositioned on the tube and centrifuged at 13000rpm for 2min.

(9) 50-200 mu L of nuclease-free water is added in the center of the centrifugal column, then the mixture is transferred to an elution tube, and the elution tube stands still at room temperature for 2min and is centrifuged at 13000rpm for 1min, and RNA is stored at-80 ℃.

2. The reverse transcription was immediately performed to obtain cDNA (FastKing RT Kit (With gDNase) (TIANGEN, KR 116)).

(1) The template RNA was thawed on ice, the reaction components were thawed at room temperature, and rapidly placed on ice after thawing. (all subsequent operations are performed on ice)

(2) A mixed solution of a system for removing genomic DNA was prepared as shown in the following table:

TABLE 6 removal System of genomic DNA Mixed solution Components

Composition of components	Usage amount
			5×gDNA Buffer	2μL
RNA	8μL
		Rnase-Free ddH2O	L

(3) The prepared mixed solution is incubated for 3min at 42 ℃, and is kept stand on ice.

(4) Preparing a mixed solution of a reverse transcription reaction system, as shown in the following table:

TABLE 7 reverse transcription reaction System Mixed solution Components

Reagent(s)	Usage amount
		10×King RT Buffer	2μL
FastKing RT Enzyme Mix	1μL
		FQ-RT Primer Mix	2μL
Rnase-Free ddH2O	5μL

(5) Mix in reverse transcription was added to the reaction solution in the gDNA removal step, and thoroughly mixed.

(6) Incubate at 42℃for 15min.

(7) The cDNA was incubated at 95℃for 3min and then stored at low temperature.

3. Real-time fluorescent quantitative nucleic acid amplification (TranStart Green qPCR SuperMix Kit (TranStart, AQ 101))

The amplification system was configured as shown in Table 8 and amplified according to the procedure of Table 9, and CT values were read using the ABI 7300 real-time PCR system.

TABLE 8 real-time fluorescent quantitative nucleic acid amplification reaction Components

Component (A)	Reaction system (20. Mu.L)
		Forward primer (10. Mu.M, primer 1)	0.4μL
Reverse primer (10. Mu.M, primer 2)	0.4μL
		2×TransStart Top Green QPCR SuperMix	10μL
Passive Reference Dye(50×)	0.4μL
		Nuclease-free Water	4μL
DNA template (pET-23 a-sfGFP plasmid/plasmid @ ZIF-8)	4.8μL

TABLE 9 real-time fluorescent quantitative nucleic acid amplification cycle settings

The pET-23a-sfGFP plasmid with known concentration is amplified by the method, the standard curve of the relation between cDNA concentration and CT value is obtained by repeating the subsequent experimental steps, the mRNA concentration in the reaction system can be obtained according to the measured CT value, the curve of the mRNA concentration in the reaction system changing with time is shown in figure 9, and the plasmid solution is used as a positive control.

As can be seen from FIG. 9, plasmid @ ZIF-8 had a higher mRNA concentration when subjected to a cell-free reaction than the plasmid solution. This suggests that ZIF-8 can significantly increase the transcript levels in cell-free systems, resulting in higher amounts of protein expression.

The reason for achieving high transcription efficiency is presumably mainly because the plasmid @ ZIF-8 forms a compartmentalization effect, constituting a macromolecular crowded environment in a cell-free system. The local gene concentration of a cell-free system is greatly improved, the enzyme conversion efficiency is further improved, and the high-yield expression of the protein is realized.

Example 2 (Effect of different molar ratios of 2-methylimidazole to Zinc nitrate on plasmid Activity)

Plasmid @ ZIF-8, cell-free system was prepared in the same manner as in example 1, example 2 differing from example 1 in the molar ratio of 2-methylimidazole to zinc nitrate of 30 and 90, and the activity of pET-23a-sfGFP plasmid in the cell-free system is shown in FIG. 5.

The activity of specific pET-23a-sfGFP plasmid is determined by mixing plasmids with the same genetic quantity and 2-methylimidazole with zinc nitrate solution in different molar ratios, forming plasmids with the same genetic quantity, wrapping the plasmids with different sizes and volumes in ZIF-8, adding the plasmids with the same genetic quantity @ ZIF-8 into a cell-free system, and measuring the fluorescence value after reaction, wherein the fluorescence value represents the activity of the plasmids.

As is clear from FIG. 5, the activity of pET-23a-sfGFP plasmid was highest in the cell-free system when the molar ratio of 2-methylimidazole to zinc nitrate was 60.

Example 3 (Effect of different concentrations of pET-23a-sfGFP plasmid on cell-free response)

Plasmid @ ZIF-8, cell-free system was prepared in the same manner as in example 1, example 3 differing from example 1 in the concentration of pET-23a-sfGFP plasmid, pET-23a-sfGFP plasmid concentration of 0, 0.5mg/mL, 1mg/mL, 1.5mg/mL, 2mg/mL, 2.5mg/mL, pET-23a-sfGFP plasmid solution of varying concentration was packaged into the structure of ZIF-8. mu.L of the plasmid solution was taken for cell-free reaction at 30℃overnight expression, and the same concentration of plasmid solution was used for cell-free reaction as a positive control, and the fluorescence value was measured by a microplate reader. The results are shown in FIG. 6:

from FIG. 6, it is seen that plasmid @ ZIF-8 shows a high yield of protein when subjected to cell-free reaction compared to the dispersed plasmid solution. When the plasmid concentration is low, the protein expression amount is low, and as the plasmid concentration increases, the protein yield increases continuously. When the plasmid concentration was 2mg/mL, the protein expression amount was increased by 2.7 times. When the plasmid concentration is higher than 2mg/mL, the expression level starts to decrease.

Example 4 (Effect of plasmids of different sizes @ ZIF-8 on the Synthesis of proteins in cell-free systems)

A cell-free system was prepared in the same manner as in example 1, and example 4 differs from example 1 in the size of plasmid @ ZIF-8 by the following steps:

743.75mg of Zn (NO) ₃ ) ₂ ·6H ₂ O (0.25M) was dissolved in 10mL of deionized water to form a zinc nitrate solution, and then 1.23g of 2-methylimidazole (2-Melm, 0.938M) was dissolvedThe solution was dissolved in 16mL of deionized water to form a 2-methylimidazole solution. The product was collected by mixing a zinc nitrate solution (0.2 mL, 0.25M), pET-23a-sfGFP plasmid solution (70. Mu.L, 1.5 mg/. Mu.L) and a 2-methylimidazole solution (1.6 mL, 0.938M) at a molar ratio of 2-methylimidazole to zinc nitrate of 30), stirring at room temperature for about 0.5 hours, centrifuging at 12000rpm for 10 minutes, and washing with deionized water 3 times. The product was dried overnight in a vacuum freeze dryer to give the product as a powder.

The synthesis of cell-free system proteins is shown in FIG. 7. FIG. 7a is a plasmid @ ZIF-8 prepared after down-regulating the concentration of 2-methylimidazole, wherein the synthesized plasmid @ ZIF-8 is significantly increased to 700-800 nm when the molar ratio of 2-methylimidazole to zinc nitrate is 30; FIG. 7b is a plasmid @ ZIF-8 prepared after upregulation of 2-methylimidazole concentration, and the synthesized plasmid @ ZIF-8 was reduced to about 80nm when the molar ratio of 2-methylimidazole to zinc nitrate was 90. From example 4, it is known that a series of plasmids @ ZIF-8 with different particle sizes can be obtained quickly and conveniently by controlling the molar ratio of 2-methylimidazole to zinc nitrate, and the plasmids @ ZIF-8 can be used for protein synthesis of a cell-free system.

Example 5

(one) preparation of ZIF-8 carrying the pET-23a-sfGFP plasmid and glucose oxidase (plasmid & GOx@ZIF-8)

743.75mg of Zn (NO) ₃ ) ₂ ·6H ₂ O was dissolved in 10mL of deionized water to form a zinc nitrate solution (0.25M), and then 2.46g of 2-methylimidazole was dissolved in 16mL of deionized water to form a 2-methylimidazole solution (1.875M). Zinc nitrate solution (0.2 mL, 0.25M), pET-23a-sfGFP plasmid solution (80. Mu.L, 100 ng/. Mu.L), glucose oxidase solution (50. Mu.L, 20 mg/ml) and 2-methylimidazole solution (1.6 mL, 1.875M) were mixed (molar ratio of 2-methylimidazole to zinc nitrate 60) and stirred at room temperature, after about 0.5 hour, the product was collected by centrifugation at 12000rpm for 10 minutes and washing with deionized water 3 times. The product was dried overnight in a vacuum freeze dryer to give the product as a powder.

To confirm that the powdered product still maintains its original ZIF-8 structure, the powdered product was structurally characterized. The prepared powdery product and ZIF-8 were subjected to Scanning Electron Microscope (SEM) imaging, electron transmission microscope (TEM) and X-ray diffraction (XRD) characterization, and the morphology and diffraction peaks thereof were observed, and the results are shown in FIGS. 10 and 11.

From FIGS. 10 and 11, it can be seen that the powdered product has the same morphology and the same diffraction peak as ZIF-8. This also demonstrates that the plasmid does not affect the structure of ZIF-8.

To confirm successful embedding of the plasmid into ZIF-8, a confocal laser microscope test was performed. The fluorescein-labeled plasmid solution was reacted according to the above experimental procedure to obtain a powdery product. Deionized water was added to the prepared powdery product for resuspension, diluted to a concentration of 10mg/mL, and the mixture was dropped onto a glass slide, and observed with a Zeiss LSM-780 inverted laser confocal microscope. The results are shown in FIG. 12. A uniform plasmid distribution can be seen inside ZIF-8.

In summary, the powdered product was plasmid & GOx@ZIF-8.

(II) preparation of cell-free systems

Preparation of cell-free System in reference example 1

(III) Synthesis of proteins in cell-free System

To the cell-free system, 5. Mu.L of 10mg/mL of the plasmid & GOx@ZIF-8 was added, followed by glucose (50 mM 1.7. Mu.L) and then cell-free reaction was performed overnight at 30 ℃. mu.L of pET-23a-sfGFP plasmid solution of the same concentration was taken and used as a positive control for cell-free reaction. The fluorescence value was measured by using an enzyme-labeled instrument, and the results are shown in FIG. 13.

Example 6

The synthesis of protein in the cell-free system was performed in the same manner as in example 5, except that in example 6, glucose was replaced with hydrochloric acid, and the amount of hydrochloric acid added was 1.2M 0.7. Mu.L, and the results are shown in FIG. 13.

As is clear from fig. 13, after glucose and hydrochloric acid were added to examples 5 and 6, respectively, at 1 hour, the fluorescence expression values started to rise significantly, which is far higher than that of the plasmid @ ZIF-8 alone, and it was thus found that glucose and hydrochloric acid did act to disrupt the structure of the metal-organic framework compound, releasing the gene encoding the target protein to be synthesized, and the gene encoding the target protein to be synthesized was synthesized.

Example 7 (toxicity test of MOF Material on cell-free System)

743.75mg of Zn (NO) ₃ ) ₂ ·6H ₂ O (0.25M) was dissolved in 10mL of deionized water to form a zinc nitrate solution, and then 1.23g of 2-methylimidazole (2-Melm, 0.938M) was dissolved in 16mL of deionized water to form a 2-methylimidazole solution. The product was collected by mixing a zinc nitrate solution (0.2 ml,0.25 m) and a 2-methylimidazole solution (1.6 ml,0.938 m) together (molar ratio of 2-methylimidazole to zinc nitrate 60), stirring at room temperature, after about 0.5 hours, centrifuging at 12000rpm for 10 minutes, and washing with deionized water 3 times. The product was dried overnight in a vacuum freeze dryer to give the product as a powder (ZIF-8 as a powder).

mu.L of 10 was added to the cell-free system separately ^-6 mg/mL、10 ^-4 mg/mL、10 ^-6 ZIF-8 at mg/mL, 0.01mg/mL, 1mg/mL, 100mg/mL, followed by cell-free reaction at 30℃overnight. The fluorescence value was measured by using an enzyme-labeled instrument, and the results are shown in FIG. 14.

As can be seen from FIG. 14, when the MOF material (ZIF-8) was directly added to the cell-free system, the MOF material (ZIF-8) had no effect on the cell-free system when the concentration was less than 0.1 mg/mL.

Although embodiments of the present application have been described above with reference to the accompanying drawings, the present application is not limited to the specific embodiments and fields of application described above, which are merely illustrative, instructive, and not restrictive. Those skilled in the art, having the benefit of this disclosure, may make numerous forms, and equivalents thereof, without departing from the scope of the invention as defined by the claims.

Sequence listing

<110> university of Qinghua

<120> a cell-free protein Synthesis method

<130> PD01053

<141> 2020-11-24

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 1

cgatcccgcg aaattaatac gactcac 27

<210> 2

<211> 36

<212> DNA

<213> Artificial Sequence

<400> 2

ttaatgatgg tgatggtgat gtttgtacag ttcatc 36

Claims

1. A cell-free system protein synthesis method, comprising adding a metal-organic framework compound carrying a gene encoding a target protein to be synthesized to a cell-free system to synthesize the target protein;

The metal organic framework compound carrying the gene for encoding the target protein to be synthesized is prepared by mixing a metal salt solution, an organic ligand solution and the gene for encoding the target protein to be synthesized, and embedding the gene for encoding the target protein to be synthesized into pores of the metal organic framework compound formed by the metal salt solution and the organic ligand solution by adopting a coprecipitation method;

the metal salt solution is zinc nitrate solution, the organic ligand solution is 2-methylimidazole, and the molar ratio of the 2-methylimidazole to the zinc nitrate is (30-90): 1, a step of;

the metal framework compound is ZIF-8;

in the metal-organic framework compound carrying the gene encoding the target protein to be synthesized, the gene encoding the target protein to be synthesized and the metal-organic frameworkThe mass ratio of the compounds is (1X 10) ^-3 ～9×10 ^-3 )：1；

In a cell-free synthesis system, the concentration of the metal-organic framework compound is less than 1mg/ml.

2. The method of cell-free protein synthesis system according to claim 1, wherein the molar ratio of 2-methylimidazole to zinc nitrate is 60:1.

3. The method for synthesizing a cell-free protein according to claim 1, wherein the mass ratio of the 2-methylimidazole, zinc nitrate and the gene encoding the target protein to be synthesized is (1000 to 10000): 248:1.

4. The method for synthesizing a cell-free protein according to claim 1, wherein the mass ratio of the 2-methylimidazole, zinc nitrate and the gene encoding the target protein to be synthesized is 4100:248:1.

5. the method for cell-free protein synthesis system according to claim 1, wherein in the metal-organic framework compound carrying the gene encoding the target protein to be synthesized, the mass ratio of the gene encoding the target protein to be synthesized to the metal-organic framework compound is 6X 10 ^-3 ：1。

6. The method for synthesizing a cell-free protein according to claim 1, wherein the metal-organic framework compound has a particle size of 80 to 800nm; the aperture is 0.2-1.2 nm;

in a cell-free synthesis system, the concentration of the metal-organic framework compound is less than 0.1mg/ml.

7. The method for cell-free protein synthesis system according to claim 1, wherein the metal-organic framework compound has a particle size of 200nm.

8. The method of cell-free protein synthesis system according to claim 1, wherein the pore size of the metal-organic framework compound is 1.2nm.

9. The method for cell-free protein synthesis according to claim 1, wherein the concentration of the gene encoding the target protein to be synthesized in the cell-free system is 25 ng/. Mu.l to 75 ng/. Mu.l.

10. The method for cell-free protein synthesis according to claim 1, wherein the concentration of the gene encoding the target protein to be synthesized in the cell-free system is 50 ng/. Mu.l.

12. The method according to claim 11, wherein the metal framework compound is one or more selected from the group consisting of molecular sieve-like imidazole framework ZIF series, uiO series, and zeolite imidazole ester framework MIL series.

13. The method of claim 12, wherein the metal framework compound is a molecular sieve-like imidazole framework ZIF series.

14. The method according to claim 12, wherein the molecular sieve imidazole skeleton ZIF series is one or more selected from the group consisting of ZIF-8, ZIF-67, ZIF-90 and ZIF-11.

15. The method of claim 14, wherein the molecular sieve imidazole backbone ZIF series is ZIF-8.

16. The cell-free system protein synthesis method according to claim 12, wherein the metal framework compound is UiO series.

17. The cell-free system protein synthesis method according to claim 16, wherein the metal framework compound is UiO-66.

18. The cell-free system protein synthesis method according to claim 12, wherein the metal framework compound is a zeolitic imidazolate framework MIL series.

19. The cell-free system protein synthesis method according to claim 18, wherein the metal framework compound is MIL-101.

20. The method according to any one of claims 11 to 19, wherein the metal-organic framework compound carrying the gene encoding the target protein to be synthesized and glucose oxidase is a metal-organic framework compound formed by mixing a metal salt solution, an organic ligand solution, glucose oxidase and the gene encoding the target protein to be synthesized, and embedding the gene encoding the target protein to be synthesized and glucose oxidase in pores of the metal-organic framework compound formed by the metal salt solution and the organic ligand solution by a coprecipitation method.

21. The method according to claim 20, wherein the metal salt solution is one or more selected from the group consisting of zinc nitrate solution, zinc acetate solution, cobalt nitrate solution, copper sulfate solution, and ferrous sulfate solution;

22. The method of claim 21, wherein when the metal salt solution is a zinc nitrate solution, the organic ligand solution is 2-methylimidazole, and the molar ratio of 2-methylimidazole to zinc nitrate is (30-90): 1.

23. The cell-free system protein synthesis method according to claim 22, wherein the molar ratio of 2-methylimidazole to zinc nitrate is 60:1.

24. The method for synthesizing a cell-free protein according to claim 22, wherein the mass ratio of 2-methylimidazole, zinc nitrate, a gene encoding a target protein to be synthesized, and glucose oxidase is (10000 to 100000): 1860:1:125.

25. the method for cell-free protein synthesis according to claim 22, wherein the mass ratio of 2-methylimidazole, zinc nitrate, gene encoding a target protein to be synthesized, and glucose oxidase is 30750:1860:1:125.

26. the method according to claim 20, wherein the mass ratio of the glucose oxidase, the gene encoding the target protein to be synthesized, and the metal-organic framework compound is 1 (0.002-0.008): 10.

27. The method according to claim 20, wherein the mass ratio of the glucose oxidase, the gene encoding the target protein to be synthesized, and the metal-organic framework compound in the metal-organic framework compound carrying the gene encoding the target protein to be synthesized is 1:0.008:10.

28. The method for cell-free protein synthesis system according to claim 11, wherein the concentration of glucose added to the cell-free system is 0 to 50mM.

29. The method for cell-free protein synthesis system according to claim 11, wherein the concentration of glucose added to the cell-free system is 25mM.

30. The method for synthesizing a protein according to claim 11, wherein the concentration of the hydrochloric acid added to the cell-free system is 1 to 2M.

31. The method for synthesizing a protein according to claim 11, wherein the concentration of the hydrochloric acid added to the cell-free system is 1.2M.

32. The method for cell-free protein synthesis system according to claim 20, wherein the particle size of the metal-organic framework compound carrying the gene encoding the target protein to be synthesized and glucose oxidase is 80 to 800nm; the aperture is 0.2-1.2 nm;

in a cell-free synthesis system, the concentration of the metal-organic framework compound is less than 100mg/ml.

33. The method for cell-free protein synthesis system according to claim 20, wherein the metal-organic framework compound carrying the gene encoding the target protein to be synthesized and glucose oxidase has a particle size of 200nm.

34. The method for cell-free protein synthesis system according to claim 20, wherein the pore size of the metal-organic framework compound carrying the gene encoding the target protein to be synthesized and glucose oxidase is 1.2nm.

35. The method of cell-free protein synthesis system according to claim 20, wherein the concentration of the metal-organic framework compound in the cell-free synthesis system is less than 1mg/ml.

36. The method of cell-free protein synthesis system according to claim 20, wherein the concentration of the metal-organic framework compound in the cell-free synthesis system is less than 0.1mg/ml.

37. The method of cell-free protein synthesis system according to claim 20, wherein the method comprises the steps of,

the concentration of the gene encoding the target protein to be synthesized in a cell-free system is 10 ng/. Mu.l to 30 ng/. Mu.l.

38. The method of cell-free protein synthesis system according to claim 20, wherein the method comprises the steps of,

the concentration of the gene encoding the target protein to be synthesized in the cell-free system was 20 ng/. Mu.l.

39. The method of cell-free protein synthesis according to claim 1 or 11, wherein the method of preparing a cell-free system comprises the steps of: disrupting the cells to obtain a cell extract, and then adding RNA polymerase and cofactors to obtain a cell-free system.

40. The method of cell-free protein synthesis system according to claim 39, wherein the RNA polymerase is T7RNA polymerase.

41. The method of cell-free protein synthesis system according to claim 39, wherein the RNA polymerase is T7RNA polymerase extracted using E.coli BL21 comprising plasmid AR 1219.

42. The method of cell-free protein synthesis according to claim 1 or 11, wherein the gene encoding the protein of interest is in the form of a plasmid or linear DNA.