CN112708624B - DNA fragment with promoter and coding signal peptide functions and application thereof in production of beta-mannase - Google Patents

Abstract

The invention discloses a DNA fragment of bacillus subtilis with a promoter function, which is named as P2454, and the nucleotide sequence of the DNA fragment is shown as a sequence table SEQ ID No. 1. The invention also discloses a signal peptide of the bacillus subtilis efficient secretion expression protein, which is named as SP2454, and the amino acid sequence of the signal peptide is shown as SEQ ID No. 2. The invention also discloses the application of the recombinant vector or the recombinant engineering bacteria containing the DNA segment and the signal peptide in producing the beta-mannase. The promoter and the signal peptide code thereof are used for constructing a protein secretion expression vector, and are successfully applied to the secretion expression of beta-mannase, so that the high-efficiency production is realized. The promoter characteristics provided by the invention reveal that the promoter has important application value in industrial production.

Description

DNA fragment with promoter and coding signal peptide functions and application thereof in production of beta-mannase

Technical Field

The invention belongs to the field of genetic engineering and the technical field of molecular biology, and relates to a DNA fragment, in particular to a DNA fragment of bacillus subtilis with a promoter function and a signal peptide coding function and application thereof in producing beta-mannase.

Background

The bacillus subtilis is an important prokaryotic expression host, has clear genetic background, simple genetic operation, stronger protein secretion capacity, no pathogenicity and mature fermentation process. Is widely used for producing industrial enzymes such as amylase, protease, lipase and the like.

Promoters are important genomic regulatory elements that directly affect the level of gene expression, and in bacteria, RNA polymerase and related sigma factors recognize promoters and are recruited by regulating protein binding to specific sites within the promoter. To date, three promoters have been used for high level expression of heterologous proteins from Bacillus subtilis: constitutive promoters, inducible specific promoters and self-inducible promoters. Constitutive promoters, such as the P43 promoter, affect bacterial growth and are not suitable for the production of substances toxic to the host. Inducible promoters (such as Pspac and Pxyl) are the most widely used types, but inducers such as IPTG and xylose are generally expensive and increase the cost of industrial production. Self-inducible promoters are ideal choices for large-scale protein production. Such promoters can induce the expression of a target gene from late log phase to stationary phase without the need for an inducer, which contributes to efficient production of heterologous proteins at a low cost, however, low activity is an obstacle to the wide application of such promoters at present. Therefore, it is necessary to find a promoter which is more efficient and suitable for industrial medium production expression. In addition to the promoter, elements such as the Ribosome Binding Site (RBS), SD sequence and signal peptide also influence the expression of the protein. Usually, based on the sequencing result of transcriptome, a promoter with higher transcription level can be screened, however, when protein expression is carried out, further optimization of the above elements is required.

The beta-mannase is a hemicellulase capable of hydrolyzing mannan, glucan, galactomannan, galactoglucan and the like connected by beta-1, 4-D mannosidosin bonds, and is widely applied to the feed industry, the food industry, the paper industry and the like. Microorganisms are the most important production source, while beta-mannanases produced by bacteria are more temperature stable than those from fungi, especially those from bacillus. However, the search finds that the research finds that the DNA fragments of the promoter of the protein with higher extracellular content and the coding region of the signal peptide are cloned by utilizing the information of the extracellular proteome of the bacillus subtilis, and the promoter and the coding of the signal peptide thereof are used for constructing a protein secretion expression vector to be applied to the secretion expression of the beta-mannanase, so that the literature or the patent for realizing the high-efficiency production of the beta-mannanase is not reported.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to provide a DNA fragment of bacillus subtilis with the functions of a promoter and a coding signal peptide and application thereof in producing beta-mannase.

The bacillus subtilis has a DNA fragment with a promoter function, and is characterized in that: the DNA fragment is named as a promoter P2454, and the nucleotide sequence of the DNA fragment is any one of the following sequences:

(1) a nucleotide sequence shown as SEQ ID No.1 of the sequence table;

(2) a DNA sequence which has more than 90 percent of homology with the DNA sequence shown by SEQ ID No.1 in the sequence table and has the same function;

(3) a DNA sequence obtained by substituting, deleting and/or adding one or more bases to the DNA sequence shown in (1) or (2) above and having the same promoter function.

The preferred embodiment of the DNA fragment of Bacillus subtilis having promoter function is: the DNA fragment is named as a promoter P2454, and the nucleotide sequence of the DNA fragment is shown as a sequence table SEQ ID No. 1.

The invention also provides a signal peptide of the bacillus subtilis efficient secretion expression protein, which is characterized in that: the signal peptide is named as signal peptide SP2454, and the amino acid sequence of the signal peptide is shown as SEQ ID No. 2.

A gene encoding the above-mentioned signal peptide of Bacillus subtilis, characterized in that: the nucleotide sequence of the coding gene is shown as SEQ ID No. 3.

The invention also provides a recombinant vector, which is characterized in that: the recombinant vector is named as pN-P2454-SP2454 and is obtained by connecting the nucleotide sequence of the promoter P2454 and the nucleotide sequence of the gene for coding the signal peptide SP2454 to a vector pNW 33N; wherein the gene nucleotide sequence coding the signal peptide SP2454 is connected with the downstream of a promoter P2454 and is expressed under the mediation of P254.

The invention also provides a beta-mannase secretion expression vector, which is characterized in that: the secretory expression vector is named as pN-gmuG and is obtained by connecting the gene gmuG for coding the beta-mannase to the downstream of the SP2454 coding gene of a recombinant vector pN-P2454-SP 2454; wherein the nucleotide sequence of the gene for coding the beta-mannase is shown as SEQ ID No. 4.

The invention also provides a recombinant engineering bacterium for producing the beta-mannase, which is characterized in that: is obtained by transforming host cells by using a beta-mannase secretion expression vector pN-gmuG.

In the recombinant engineering bacteria: the host cell is preferably Bacillus subtilis 7-3-3, and the recombinant engineering bacterium obtained by transforming the host cell with the expression vector pN-gmuG is named as BS-OEgmuG.

The recombinant vector or recombinant engineering bacteria containing the DNA fragment of the bacillus subtilis with the promoter function and the signal peptide of the bacillus subtilis efficient secretion expression protein are applied to the production of beta-mannase.

The applicant screens a protein with higher content in the fermentation liquid by carrying out proteome analysis on the supernatant of the fermentation liquid of a bacillus subtilis strain which grows well on a cheap culture medium consisting of bran and corn flour, and clones a promoter and a signal peptide coding sequence of the protein. The promoter and the signal peptide code thereof are used for constructing a protein secretion expression vector, and are successfully applied to the secretion expression of beta-mannase, so that the high-efficiency production is realized. The promoter characteristic reveals that the promoter has important value in the application of industrial production. The outstanding effects of the invention are as follows: under the background that the current bacillus subtilis lacks a promoter which can be industrially applied, the DNA fragment with the functions of the promoter and the signal peptide can realize the secretory expression of a protein gene without adding an inducer, and the DNA fragment is applied to the expression of beta-mannase, provides an effective means for the bacillus subtilis to secrete and express the protein, and has good development prospect.

Drawings

FIG. 1 is an electrophoretogram of PCR amplification products of a DNA fragment containing a promoter and a signal peptide coding sequence, wherein: m is a DNA molecular weight Marker, and lane 1 is a DNA fragment.

FIG. 2 is a schematic diagram of the construction of recombinant vector pN-P2454-SP 2454.

FIG. 3 is a schematic diagram of the construction of the recombinant vector pN-gmuG.

FIG. 4.SDS-PAGE detects β -mannanase expression, wherein: m is a protein molecular weight Marker, Lane 1 is the supernatant of the fermentation broth of the strain BS-OEgumG, and Lane 2 is the supernatant of the fermentation broth of BS-pN.

Detailed Description

The present invention will be described in detail with reference to the following detailed drawings and examples. The following examples are only preferred embodiments of the present invention, and it should be noted that the following descriptions are only for explaining the present invention and not for limiting the present invention in any form, and any simple modifications, equivalent changes and modifications made to the embodiments according to the technical spirit of the present invention are within the scope of the technical solution of the present invention.

In the following examples, materials, reagents and the like used were obtained commercially unless otherwise specified. The contents of the methods described in the examples are, unless otherwise specified, conventional experimental methods.

The experimental conditions are as follows:

1. bacterial strains and vectors

The Bacillus subtilis 7-3-3(Bacillus subtilis 7-3-3) is separated from soil of campus of university in Shandong and stored in China center for type culture Collection with the preservation number of CCTCC NO. M200038; escherichia coli competent cell Trans5 α (available from Beijing Quanjin Biotechnology Ltd.); coli-Bacillus subtilis shuttle vector pNW33N (GenBank: AY237122.1, available from Bacillus Genetic Stock Center, USA).

2. Enzymes and other biochemical reagents

Fastpfu DNA polymerase, Basic nucleic acid Cloning and Assembly Kit Seamless Cloning Kit, T4 DNA ligase, bacterial genome extraction Kit, Tiangen Biotechnology Ltd, DNA gel recovery Kit, plasmid extraction Kit, Omega Bio-Tek, Fastdigest restriction enzyme from ThermoFisher, the reagents were used according to the instructions. LBG (Locus bean gum from Ceratonia siliqua seeds) was purchased from Sigma-Aldrich, and other common analytical chemicals were purchased from the national pharmaceutical group.

3. Culture medium

LB medium (g/L): peptone 10.0, yeast extract 5.0, sodium chloride 10.0, pH 7.0, solid LB medium with additional 1.6% agar powder added.

Seed medium (g/L): 10.0 parts of glucose, 5.0 parts of peptone, 5.0 parts of yeast extract, 5 parts of sodium chloride, 10 parts of dipotassium hydrogen phosphate and 0.5 part of magnesium sulfate.

Fermentation medium (g/L): 5.0 parts of bran, 4.2 parts of corn flour, 0.3 part of ammonium sulfate, 0.1 part of dipotassium phosphate and 0.2 part of magnesium sulfate, and 0.1 part of separately sterilized sodium carbonate is added before use.

Example 1 Bacillus subtilis 7-3-3 exocytosis protein acquisition and proteome identification

Taking out Bacillus subtilis 7-3-3 (preservation number CCTCC NO. M200038) from a glycerol tube at-80 ℃, streaking on an LB solid plate, culturing at 37 ℃ for 12h, selecting a single colony in 5mL of LB liquid culture medium, and culturing at 37 ℃ and 200rpm for 12 h; inoculating to seed culture medium at3 vol% and culturing at 37 deg.C and 200rpm for 4 hr; inoculating the strain into a fermentation medium according to the inoculation amount of 10 percent of the volume ratio, using a 500mL triangular flask, wherein the liquid loading amount of the fermentation medium is 100mL, and carrying out shake flask fermentation culture at 37 ℃ and 200 rpm.

The fermentation broth was sampled at 1mL for 55h and centrifuged at 8000g at 4 ℃ to obtain the supernatant. An acetone solution containing 10% trichloroacetic acid was used, and after precooling at-20 ℃, 3mL of the acetone solution was mixed with 500. mu.L of the supernatant of the fermentation broth, and the mixture was left overnight at-20 ℃. Centrifuging at 4 deg.C for 20min at 8000g, discarding supernatant, washing precipitate with precooled acetone for 2 times, and drying precipitate in air for 15min to obtain Bacillus subtilis 7-3-3 exocytosis protein.

Proteome sequencing entrusted to Hua Daizhi GmbH. And (3) carrying out quantitative analysis on the obtained bacillus subtilis 7-3-3 exocytosis protein by using an LTQ-Orbitrap high-resolution mass spectrometer, wherein the sample processing method refers to the description of the company.

EXAMPLE 2 screening and cloning of promoter and Signal peptide coding sequences

And (3) extracting quantitative information of the extracellular secretory protein of the bacillus subtilis 7-3-3 by adopting a signal intensity method, processing data by adopting a ratio of the quantitative value of the peptide fragment to the sum of the quantitative values of all the peptide fragments as a protein abundance ratio, and screening a protein gene with higher abundance in a protein mass spectrum. The signal peptide is predicted by using an online prediction service of SignalP 5.0 (http:// www.cbs.dtu.dk/services/SignalP /), the protein with higher abundance, "organic group" selects "Gram-positive", and the amino acid sequence of the protein is input for prediction. According to the prediction result, further screening the protein with the signal peptide, finally screening a protein gene 2454 with higher protein expression level and the signal peptide, wherein the promoter is named as P2454 and is 300bp in length, and the nucleotide sequence of the protein gene is shown as SEQ ID No. 1; the signal peptide is named as SP2454, contains 25 amino acid residues, the amino acid sequence of the signal peptide is shown as SEQ ID No.2, the gene sequence of the coding signal peptide SP2454 is 75bp long, and the nucleotide sequence of the coding signal peptide is shown as SEQ ID No. 3.

The total DNA of the bacillus subtilis 7-3-3 is extracted by using a bacterial genome extraction kit, and the extraction method refers to the instruction. The following primers were designed based on the DNA:

an upstream primer: 5'GGGGTACCCATATAAGTGTCCTGCTCGTTTTT3'；

A downstream primer: 5'CGGGATCCTGCTGAAACAGCAGTACTACCAATAG3'；

The restriction sites and the protective base sequences are underlined for subsequent cloning.

Taking the total DNA of bacillus subtilis 7-3-3 as a template, amplifying a DNA fragment with 375bp size by using Fastpfu DNA polymerase, namely a DNA fragment with a promoter function and a signal peptide coding function, wherein the PCR reaction condition is that denaturation is carried out for 5min at 94 ℃; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 30s for 30 cycles; extension at 72 ℃ for 3min, the amplification product size was consistent with that expected (see FIG. 1).

Example 3 construction of secretory expression vector pN-P2454-SP2454

The Escherichia coli-Bacillus subtilis shuttle plasmid pNW33N is used as a framework, restriction enzymes KpnI and BamHI are used for carrying out enzyme digestion on the plasmid, and the enzyme digestion product is purified by a DNA gel recovery kit. The amplified DNA fragment of example 2 was subjected to the same digestion and purification procedures. The purified DNA fragment was ligated with plasmid pNW33N using T4 DNA ligase, the ligation product was transformed into E.coli DH5 α, positive transformants were selected and submitted to the New Biotechnology Co., Ltd, Beijing Onychoku for sequencing verification to obtain the correct recombinant vector, which was named pN-P2454-SP2454, as shown in FIG. 2, the nucleotide sequence of promoter P2454 and the gene encoding signal peptide SP2454 were ligated between KpnI and BamHI cleavage sites of vector pNW33N, the nucleotide sequence of the gene encoding signal peptide SP2454 was ligated downstream of promoter P2454 and expressed under the mediation of P254.

Example 4 construction of beta-mannanase expression vectors

The recombinant vector pN-P2454-SP2454 is subjected to double enzyme digestion by using restriction enzymes BamH I and Sal I, and the enzyme digestion product is purified by a DNA gel recovery kit.

According to the result of website prediction signal peptide by SignalP 5.0 online prediction, the front 93bp of the beta-mannase gene gmuG is a signal peptide coding region, the total DNA of bacillus subtilis 7-3-3 is used as a template, and the gmuG gene without a signal peptide coding region, namely a gene nucleotide sequence (the nucleotide sequence is shown as SEQ ID No. 4) for coding beta-mannase is amplified. Using primer pairs:

an upstream primer: 5'aacagcagtactaccaatagtCATACTGTGTCGCCTGTGAATCC 3'

A downstream primer: 5'aagcttgcatgcctgcag TCATTCAACGATTGGCGTTAAAGAAT3'

Amplifying a 1011bp DNA fragment, and performing PCR reaction at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 1min, and 30 cycles; extension at 72 ℃ for 3min, and recovery and purification of the amplification product. And connecting the purified DNA fragment with the vector by using a Basic Seamless Cloning and Assembly Kit Seamless Cloning Kit, selecting a positive transformant, and performing sequencing verification to obtain a beta-mannase secretion expression vector, which is named as pN-gmuG. The secretion expression vector pN-gmuG is obtained by connecting a gene coding beta-mannanase to the downstream of an SP2454 coding gene of a recombinant vector pN-P2454-SP2454 (see figure 3); wherein the nucleotide sequence of the gene for coding the beta-mannase is shown as SEQ ID No. 4.

Example 5 construction of recombinant engineering bacteria for expression of beta-mannanase

B, B.subtilis 7-3-3 electric shock transformation: picking fresh single colony in 5mL LB culture medium, culturing overnight at 37 deg.C and 200 rpm; inoculating to 50mL GM medium (LB medium supplemented with 0.5M sorbitol) at a volume ratio of 1%, culturing at 37 deg.C and 200rpm for 3-4 hr to OD₆₀₀Is 1.0; cultured bacterial liquid ice-water bath for 10 minutesCentrifuging at 4 deg.C and 5000g for 10 min, collecting thallus, re-suspending 40mL ice-cold ETM (0.5M sorbitol, 0.5M mannitol, 10% glycerol) thallus, centrifuging at 4 deg.C and 5000g for 5min, and washing for three times; taking the thallus after the last washing, and re-suspending the thallus by using EMT with the volume ratio of 1:150 to ensure that the cell density is 10¹⁰Each tube is divided into 1.5mL centrifuge tubes by 60 mu L per tube, and the tube is preserved at minus 80 ℃ for standby, namely the prepared competence is obtained; thawing competence on ice, adding 5. mu.L of vector pN-gmuG or pN-P2454-SP2454, carrying out ice bath for 5 minutes, and transferring to a precooled 1mm electric rotor; shock once at 25 uF, 200 Ω, 1700V for about 4.5ms to 5.0ms, add 1mL of pre-chilled RM medium immediately (LB contains 0.5M sorbitol and 0.38M mannitol); cultured at 37 ℃ for 1 hour at 200prm, spread on plates containing the corresponding antibiotics, cultured overnight at 37 ℃ and transformants picked for validation. The recombinant engineering bacterium containing the vector pN-gmuG is named as BS-OEgmuG, and the recombinant engineering bacterium containing the vector pN-P2454-SP2454 is named as BS-pN.

Example 6 fermentation production of beta-mannanase and expression level detection

The resulting engineered strains BS-OEgmUG and BS-pN were subjected to fermentation culture as in example 1, and additional 5. mu.g/mL chloramphenicol was added, and 1mL was sampled at 24h, 48h, 72h, and 96h, respectively, as a control, and the supernatant was centrifuged at 8000g to obtain a crude enzyme solution for further analysis.

SDS-PAGE: and performing SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) on 72h crude enzyme solutions of the strains BS-OEgmuG and BS-pN, adding 5 Xloading buffer solution to perform boiling water bath treatment on the sample for 10 minutes, wherein the concentration of concentrated gel is 5%, the concentration of separation gel is 12%, and the loading amount is 20 mu L. The protein gel pattern shows that a band is obvious near 38kDa and is consistent with the expected size of the beta-mannase, the band is weaker in the size range of the control, and the experimental result shows that the mannase is expressed (see figure 4).

The enzyme activity determination method comprises the following steps: reference is made to GB/T36861-2018 spectrophotometry for determining the activity of feed additive beta-mannanase, slightly modified. Substrate 0.5% LBG was dissolved in an acetic acid-sodium acetate buffer solution of pH 5.5, and 60. mu.L of the substrate and 20. mu.L of an appropriately diluted enzyme solution were mixed and subjected to water bath at 37 ℃ for 30 minutes. The reaction was stopped by adding 120 μ L of dns, boiled in boiling water for 10 minutes, then the mixture was cooled on ice for 5 minutes, diluted by adding 800 μ L of water, and then the absorption peak was measured at 540nm, and the β -mannanase activity unit was defined as: the amount of enzyme required to release 1. mu. mol of reducing sugars (as D-mannose) per minute from a mannan solution having a concentration of 3mg/mL at 37 ℃ and a pH of 5.5 was one beta-mannanase activity unit (U).

The enzyme activity of the extracellular beta-mannase of the recombinant bacillus subtilis is measured, the enzyme activity is highest after 72h of shake flask fermentation, the enzyme activity of the strain BS-OEgmUG reaches 1788U/mL, and the enzyme activity of the strain BS-pN is 15.4U/mL.

Sequence listing

<110> Shandong university

<120> a DNA fragment having promoter and signal peptide coding functions and its use in producing beta-mannanase

<141>2020-12-31

<160>8

<210>1

<211>300

<212> DNA

<213> Bacillus subtilis 7-3

<221> nucleotide sequence of promoter P2454

<222>（1）…（300）

<400> 1

catataagtg tcctgctcgt tttttccgag gtacttccat gtgaggagat cgccgtttaa 60

agcaatctct tccggaagcc agaactgctt cacgttttgg ttatagaaca tttgggtaaa 120

atcgtcttca tgctttgacc agtttgctgc agtatacagc ttgttttcgt tgagttgtga 180

caaaaatgtg acctcctaaa tattttttcc tccctcacca cctgtaaaaa gaagggaata 240

ttttataaat gttgtaaatt ttataatgca acatattcac tattaaggga ggaataaaaa 300

<210> 2

<211> 25

<212>PRT

<213> Bacillus subtilis 7-3

<221> amino acid sequence of Signal peptide SP2454

<222>（1）…（25）

<400> 2

Met Lys Lys Lys Phe Ile Ala Gly Ala Leu Val Leu Gly Leu Ile Pro

1 5 10 15

Thr Ile Gly Ser Thr Ala Val Ser Ala

20 25

<210> 3

<211> 75

<212> DNA

<213> Bacillus subtilis 7-3

<221> nucleotide sequence of Gene encoding Signal peptide SP2454

<222>（1）…（75）

<400> 3

atgaaaaaga aatttattgc tggtgcttta gttttaggtc taatacctac tattggtagt 60

actgctgttt cagca 75

<210> 4

<211> 1011

<212> DNA

<213> Bacillus subtilis 7-3

<221> nucleotide coding sequence of beta-mannanase

<222>（1）…（1011）

<400> 4

catactgtgt cgcctgtgaa tcctaatgcc cagcagacaa caaaaacagt gatgaactgg 60

cttgcgcacc tgccgaaccg aacggaaaac agagtccttt ccggagcgtt cggaggttac 120

agtcatgaca cattttctat ggctgaggct gatagaatcc gaagcgccac cgggcaatcg 180

cctgctattt atggctgcga ttatgccaga ggatggcttg aaacagcaaa tattgaagat 240

tcaatagatg taagctgcaa cggcgattta atgtcgtatt ggaaaaatgg cggaattccg 300

caaatcagtt tgcacctggc gaaccctgct tttcagtcag ggcattttaa aacaccgatt 360

acaaatgatc agtataaaaa aatactagat tcttcaacag cagaaggaaa gcggctaaat 420

gccatgctca gcaaaattgc tgacggactt caagagctgg agaaccaagg tgtgcctgtt 480

ctgttcaggc cgctgcatga aatgaacggt gaatggtttt ggtggggact tacatcatat 540

aatcaaaagg ataatgaaag aatctcttta tataaacagc tctacaagaa aatctatcat 600

tatatgaccg acacaagagg acttgatcat ttgatttggg tttactctcc cgacgccaac 660

cgagatttta aaactgattt ttacccgggc gcgtcttacg tggatattgt cggattagat 720

gcgtattttc aagatgccta ctcgatcaat ggatacgatc agctaacagc gcttaataaa 780

ccatttgctt ttacagaagt tggcccgcaa acagcaaacg gcagcttcga ttacagcctg 840

ttcatcaatg caataaaaca aaaatatcct aaaaccattt acttcctcgc atggaatgat 900

gaatggagcc cagcagtaaa caagggtgct tcagctttat atcatgacag ctggacactc 960

aataagggag aaatatggaa tggcgattct ttaacgccaa tcgttgaatg a 1011

<210> 5

<211> 32

<212> DNA

<213> Artificial sequence

<221> amplification promoter and Signal peptide coding region upstream primer

<222>（1）…（32）

<400> 5

ggggtaccca tataagtgtc ctgctcgttt tt 32

<210> 6

<211> 34

<212> DNA

<213> Artificial sequence

<221> amplification promoter and Signal peptide coding region downstream primer

<222>（1）…（34）

<400> 6

cgggatcctg ctgaaacagc agtactacca atag 34

<210>7

<211> 44

<212> DNA

<213> Artificial sequence

<221> upstream primer for amplifying beta-mannase coding sequence

<222>（1）…（44）

<400> 7

aacagcagta ctaccaatag tcatactgtg tcgcctgtga atcc 44

<210> 8

<211> 44

<212> DNA

<213> Artificial sequence

<221> downstream primer for amplifying beta-mannase coding sequence

<222>（1）…（44）

<400>8

aagcttgcat gcctgcagtc attcaacgat tggcgttaaa gaat 44

Claims (3)

1. A beta-mannanase secretion expression vector, which is characterized in that: the secretory expression vector is named as pN-gmuG and is obtained by connecting the gene gmuG for coding the beta-mannase to the downstream of the SP2454 coding gene of a recombinant vector pN-P2454-SP 2454; wherein the nucleotide sequence coding the beta-mannanase gene gmuG is shown as SEQ ID No.4, the recombinant vector pN-P2454-SP2454 is obtained by connecting a promoter P2454 nucleotide sequence and a gene nucleotide sequence coding a signal peptide SP2454 to a vector pNW33N, wherein the gene nucleotide sequence coding the signal peptide SP2454 is connected to the downstream of the promoter P2454 and is expressed under the mediation of P2454; wherein the nucleotide sequence of the promoter P2454 is shown as a sequence table SEQ ID No.1, and the nucleotide sequence of the gene coding the signal peptide SP2454 is shown as a sequence table SEQ ID No. 3.

2. A recombinant engineering bacterium for producing beta-mannase is characterized in that: is obtained by transforming a host cell with the beta-mannanase secretion expression vector pN-gmuG as described in claim 1.

3. The recombinant engineered bacterium of claim 2, wherein: the host cell is bacillus subtilis 7-3-3, and the recombinant engineering bacterium obtained by transforming the host cell with the expression vector pN-gmuG is named as BS-OEgmuG.

Images