CN112852808B - DNA fragment with promoter and coding signal peptide functions and application thereof in production of alpha-L-arabinanase - Google Patents

Abstract

The invention discloses a DNA fragment of bacillus subtilis with a promoter function, which is named as P2454, and the nucleotide sequence of the DNA fragment is shown as a sequence table SEQ ID No. 1. The invention also discloses a signal peptide of the bacillus subtilis efficient secretion expression protein, which is named as SP2454, and the amino acid sequence of the signal peptide is shown as SEQ ID No. 2. The invention also discloses the application of the recombinant vector or the recombinant engineering bacteria containing the DNA segment and the signal peptide in the production of alpha-L-arabinanase. The promoter and the signal peptide code thereof are used for constructing a protein secretion expression vector, and are successfully applied to the secretion expression of alpha-L-arabinanase, so that the high-efficiency production is realized. The promoter characteristics provided by the invention reveal that the promoter has important application value in industrial production.

Description

DNA fragment with promoter and coding signal peptide functions and application thereof in production of alpha-L-arabinanase

Technical Field

The invention belongs to the field of genetic engineering and the technical field of molecular biology, and relates to a DNA fragment, in particular to a DNA fragment of bacillus subtilis with a promoter function and a signal peptide coding function and application thereof in producing alpha-L-arabinanase.

Background

The bacillus subtilis is an important prokaryotic expression host, has clear genetic background, simple genetic operation, stronger protein secretion capacity, no pathogenicity and mature fermentation process. Is widely used for producing industrial enzymes such as amylase, protease, lipase and the like.

Promoters are important genomic regulatory elements that directly affect the level of gene expression, and in bacteria, RNA polymerase and related sigma factors recognize promoters and are recruited by regulating protein binding to specific sites within the promoter. To date, three promoters have been used for high level expression of heterologous proteins from Bacillus subtilis: constitutive promoters, inducible specific promoters and self-inducible promoters. Constitutive promoters, such as the P43 promoter, affect bacterial growth and are not suitable for the production of substances toxic to the host. Inducible promoters (such as Pspac and Pxyl) are the most widely used types, but inducers such as IPTG and xylose are generally expensive and increase the cost of industrial production. Self-inducible promoters are ideal choices for large-scale protein production. Such promoters can induce the expression of a target gene from late log phase to stationary phase without the need for an inducer, which contributes to efficient production of heterologous proteins at a low cost, however, low activity is an obstacle to the wide application of such promoters at present. Therefore, it is necessary to find a promoter which is more efficient and suitable for industrial medium production expression. In addition to the promoter, elements such as the Ribosome Binding Site (RBS), SD sequence and signal peptide also influence the expression of the protein. Usually, based on the sequencing result of transcriptome, a promoter with higher transcription level can be screened, however, when protein expression is carried out, further optimization of the above elements is required.

Pectin is a heteropolysaccharide widely present in the primary wall and the middle lamella of plant cell wall, and is mainly formed by connecting D-galacturonic acid with alpha-1, 4-glycosidic bonds. The side chain is composed of a variety of neutral sugars, mainly including galactans, arabinogalactans, and arabinans. The alpha-L-arabinanase can hydrolyze alpha-1, 5-glycosidic bonds in an arabinan straight chain, so that protopectin is changed into soluble pectin, and the pectin can be used for extracting pectin. In addition, alpha-L-arabinanase from Bacillus licheniformis was shown to synergistically degrade lignocellulose. However, the search shows that the research finds that the DNA fragments of the promoter with high extracellular protein content and the coding region of the signal peptide are cloned by utilizing the information of the extracellular protein group of the bacillus subtilis, and the promoter and the coding of the signal peptide are used for constructing a protein secretion expression vector to be applied to the secretion expression of the alpha-L-arabinanase, so that the literature or the patent for efficiently producing the alpha-L-arabinanase is not reported.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to provide a DNA fragment of bacillus subtilis with the functions of a promoter and a coding signal peptide and application thereof in producing alpha-L-arabinanase.

The bacillus subtilis has a DNA fragment with a promoter function, and is characterized in that: the DNA fragment is named as a promoter P2454, and the nucleotide sequence of the DNA fragment is any one of the following sequences:

(1) a nucleotide sequence shown as SEQ ID No.1 of the sequence table;

(2) a DNA sequence which has more than 90 percent of homology with the DNA sequence shown by SEQ ID No.1 in the sequence table and has the same function;

(3) a DNA sequence obtained by substituting, deleting and/or adding one or more bases to the DNA sequence shown in (1) or (2) above and having the same promoter function.

The preferred embodiment of the DNA fragment of Bacillus subtilis having promoter function is: the DNA fragment is named as a promoter P2454, and the nucleotide sequence of the DNA fragment is shown as a sequence table SEQ ID No. 1.

The invention also provides a signal peptide of the bacillus subtilis efficient secretion expression protein, which is characterized in that: the signal peptide is named as signal peptide SP2454, and the amino acid sequence of the signal peptide is shown as SEQ ID No. 2.

A gene encoding the signal peptide of Bacillus subtilis characterized in that: the nucleotide sequence of the coding gene is shown as SEQ ID No. 3.

The invention also provides a recombinant vector, which is characterized in that: the recombinant vector is named as pN-P2454-SP2454 and is obtained by connecting the nucleotide sequence of the promoter P2454 and the nucleotide sequence of the gene for coding the signal peptide SP2454 to a vector pNW 33N; wherein the gene nucleotide sequence coding the signal peptide SP2454 is connected with the downstream of a promoter P2454 and is expressed under the mediation of P254.

The invention also provides an alpha-L-arabinanase secretion expression vector, which is characterized in that: the secretory expression vector is named as pN-abnA and is obtained by connecting a gene abnA for coding alpha-L-arabinanase to the downstream of an SP2454 coding gene of a recombinant vector pN-P2454-SP 2454; wherein the nucleotide sequence of the gene for coding the alpha-L-arabinanase is shown as SEQ ID No. 4.

The invention also provides a recombinant engineering bacterium for producing the alpha-L-arabinanase, which is characterized in that: is obtained by transforming host cells by using an alpha-L-arabinanase secretion expression vector pN-abnA.

In the recombinant engineering bacteria: the host cell is preferably Bacillus subtilis 7-3-3, and the recombinant engineering bacterium obtained by transforming the host cell with the expression vector pN-abnA is named as BS-OEabnA.

The recombinant vector or the recombinant engineering bacteria containing the DNA fragment of the bacillus subtilis with the promoter function and the signal peptide of the bacillus subtilis high-efficiency secretion expression protein are applied to the production of alpha-L-arabinanase.

The applicant screens a protein with higher content in the fermentation liquid by carrying out proteome analysis on the supernatant of the fermentation liquid of a bacillus subtilis strain which grows well on a cheap culture medium consisting of bran and corn flour, and clones a promoter and a signal peptide coding sequence of the protein. The promoter and the signal peptide code thereof are used for constructing a protein secretion expression vector, and are successfully applied to the secretion expression of alpha-L-arabinanase, so that the high-efficiency production is realized. The promoter characteristic reveals that the promoter has important value in the application of industrial production. The outstanding effects of the invention are as follows: under the background that the current bacillus subtilis lacks a promoter which can be industrially applied, the DNA fragment with the functions of the promoter and the signal peptide can realize the secretory expression of a protein gene without adding an inducer, and the DNA fragment is applied to the expression of alpha-L-arabinanase, provides an effective means for the bacillus subtilis to secrete and express the protein, and has good development prospect.

Drawings

FIG. 1 is an electrophoretogram of PCR amplification products of a DNA fragment containing a promoter and a signal peptide coding sequence, wherein: m is a DNA molecular weight Marker, and lane 1 is a DNA fragment.

FIG. 2 is a schematic diagram of the construction of recombinant vector pN-P2454-SP 2454.

FIG. 3 shows the construction of recombinant vector pN-abnA.

FIG. 4.SDS-PAGE detects α -L-arabinanase expression, wherein: m is a protein molecular weight Marker, a lane 1 is a supernatant of a fermentation broth of the strain BS-OEabnA, a lane 2 is a supernatant of a fermentation broth of the strain BS-pN, and a lane 3 is a supernatant of a fermentation broth of the strain 7-3-3.

Detailed Description

The present invention will be described in detail with reference to the following detailed drawings and examples. The following examples are only preferred embodiments of the present invention, and it should be noted that the following descriptions are only for explaining the present invention and not for limiting the present invention in any form, and any simple modifications, equivalent changes and modifications made to the embodiments according to the technical spirit of the present invention are within the scope of the technical solution of the present invention.

In the following examples, materials, reagents and the like used were obtained commercially unless otherwise specified. The contents of the methods described in the examples are, unless otherwise specified, conventional experimental methods.

The experimental conditions are as follows:

1. bacterial strains and vectors

The Bacillus subtilis 7-3-3(Bacillus subtilis 7-3-3) is separated from soil of campus of university in Shandong and stored in China center for type culture Collection with the preservation number of CCTCC NO. M200038; escherichia coli competent cell Trans5 α (available from Beijing Quanjin Biotechnology Ltd.); coli-Bacillus subtilis shuttle vector pNW33N (GenBank: AY237122.1, available from Bacillus Genetic Stock Center, USA).

2. Enzymes and other biochemical reagents

Fastpfu DNA polymerase, Basic nucleic acid Cloning and Assembly Kit Seamless Cloning Kit, T4 DNA ligase was purchased from holotype gold, bacterial genome extraction Kit was purchased from Tiangen Biochemical technology Co., Ltd, DNA gel recovery Kit and plasmid extraction Kit were purchased from Omega Bio-Tek, Fastdigest restriction enzyme was purchased from ThermoFisher, and Bradford protein quantitative detection Kit was purchased from Shanghai, and the methods for using the reagents are described in reference to the description. Other common analytical reagents were purchased from the national pharmaceutical group.

3. Culture medium

LB medium (g/L): peptone 10.0, yeast extract 5.0, sodium chloride 10.0, pH 7.0, solid LB medium with additional 1.6% agar powder added.

Seed medium (g/L): 10.0 parts of glucose, 5.0 parts of peptone, 5.0 parts of yeast extract, 5 parts of sodium chloride, 10 parts of dipotassium hydrogen phosphate and 0.5 part of magnesium sulfate.

Fermentation medium (g/L): 5.0 parts of bran, 4.2 parts of corn flour, 0.3 part of ammonium sulfate, 0.1 part of dipotassium phosphate and 0.2 part of magnesium sulfate, and 0.1 part of separately sterilized sodium carbonate is added before use.

Example 1 Bacillus subtilis 7-3-3 exocytosis protein acquisition and proteome identification

Taking out Bacillus subtilis 7-3-3 (preservation number CCTCC NO. M200038) from a glycerol tube at-80 ℃, streaking on an LB solid plate, culturing at 37 ℃ for 12h, selecting a single colony in 5mL of LB liquid culture medium, and culturing at 37 ℃ and 200rpm for 12 h; inoculating to seed culture medium at 3 vol% and culturing at 37 deg.C and 200rpm for 4 hr; inoculating the strain into a fermentation medium according to the inoculation amount of 10 percent of the volume ratio, using a 500mL triangular flask, wherein the liquid loading amount of the fermentation medium is 100mL, and carrying out shake flask fermentation culture at 37 ℃ and 200 rpm.

The fermentation broth was sampled at 1mL for 55h and centrifuged at 8000g at 4 ℃ to obtain the supernatant. An acetone solution containing 10% trichloroacetic acid was used, and after precooling at-20 ℃, 3mL of the acetone solution was mixed with 500. mu.L of the supernatant of the fermentation broth, and the mixture was left overnight at-20 ℃. Centrifuging at 4 deg.C for 20min at 8000g, discarding supernatant, washing precipitate with precooled acetone for 2 times, and drying precipitate in air for 15min to obtain Bacillus subtilis 7-3-3 exocytosis protein.

Proteomic sequencing was entrusted to Hua Dacth science and technology, Inc. And (3) carrying out quantitative analysis on the obtained bacillus subtilis 7-3-3 exocytosis protein by using an LTQ-Orbitrap high-resolution mass spectrometer, wherein the sample processing method refers to the description of the company.

EXAMPLE 2 screening and cloning of promoter and Signal peptide coding sequences

And (3) extracting quantitative information of the extracellular secretory protein of the bacillus subtilis 7-3-3 by adopting a signal intensity method, processing data by adopting a ratio of the quantitative value of the peptide fragment to the sum of the quantitative values of all the peptide fragments as a protein abundance ratio, and screening a protein gene with higher abundance in a protein mass spectrum. The signal peptide is predicted by using an online prediction service of SignalP 5.0 (http:// www.cbs.dtu.dk/services/SignalP /), the protein with higher abundance, "organic group" selects "Gram-positive", and the amino acid sequence of the protein is input for prediction. According to the prediction result, further screening the protein with the signal peptide, finally screening a protein gene 2454 with higher protein expression level and the signal peptide, wherein the promoter is named as P2454 and is 300bp in length, and the nucleotide sequence of the protein gene is shown as SEQ ID No. 1; the signal peptide is named as SP2454, contains 25 amino acid residues, the amino acid sequence of the signal peptide is shown as SEQ ID No.2, the gene sequence of the coding signal peptide SP2454 is 75bp long, and the nucleotide sequence of the coding signal peptide is shown as SEQ ID No. 3.

The total DNA of the bacillus subtilis 7-3-3 is extracted by using a bacterial genome extraction kit, and the extraction method refers to the instruction. The following primers were designed based on the DNA:

an upstream primer: 5'GGGGTACCCATATAAGTGTCCTGCTCGTTTTT3'；

A downstream primer: 5'CGGGATCCTGCTGAAACAGCAGTACTACCAATAG3'；

The restriction sites and the protective base sequences are underlined for subsequent cloning.

Taking the total DNA of bacillus subtilis 7-3-3 as a template, amplifying a DNA fragment with 375bp size by using Fastpfu DNA polymerase, namely a DNA fragment with a promoter function and a signal peptide coding function, wherein the PCR reaction condition is that denaturation is carried out for 5min at 94 ℃; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 30s for 30 cycles; extension at 72 ℃ for 3min, the amplification product size was consistent with that expected (see FIG. 1).

Example 3 construction of secretory expression vector pN-P2454-SP2454

The Escherichia coli-Bacillus subtilis shuttle plasmid pNW33N is used as a framework, restriction enzymes KpnI and BamHI are used for carrying out enzyme digestion on the plasmid, and the enzyme digestion product is purified by a DNA gel recovery kit. The amplified DNA fragment of example 2 was subjected to the same digestion and purification procedures. The purified DNA fragment was ligated with plasmid pNW33N using T4 DNA ligase, the ligation product was transformed into E.coli DH5 α, positive transformants were selected and submitted to the New Biotechnology Co., Ltd, Beijing Onychoku for sequencing verification to obtain the correct recombinant vector, which was named pN-P2454-SP2454, as shown in FIG. 2, the nucleotide sequence of promoter P2454 and the gene encoding signal peptide SP2454 were ligated between KpnI and BamHI cleavage sites of vector pNW33N, the nucleotide sequence of the gene encoding signal peptide SP2454 was ligated downstream of promoter P2454 and expressed under the mediation of P254.

Example 4 construction of alpha-L-arabinanase expression vector

The recombinant vector pN-P2454-SP2454 is subjected to double enzyme digestion by using restriction enzymes BamH I and Sal I, and the enzyme digestion product is purified by a DNA gel recovery kit.

According to the result of website prediction signal peptide on-line prediction by SignalP 5.0, 96bp before the alpha-L-arabinanase gene abnA is a signal peptide coding region, and the abnA gene without a signal peptide coding region, namely a gene nucleotide sequence (the nucleotide sequence is shown as SEQ ID No. 4) of the alpha-L-arabinanase is amplified by taking the total DNA of bacillus subtilis 7-3-3 as a template. Using primer pairs:

an upstream primer: 5'aacagcagtactaccaatagtGCGTTTTGGGGTGCATCCAAT 3'

A downstream primer: 5'aagcttgcatgcctgcagTCAATAGGACGGCCAGCCCGAA3'

Amplifying a 876bp DNA fragment, and performing PCR reaction for 5min at 94 ℃; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 1min, and 30 cycles; extension at 72 ℃ for 3min, and recovery and purification of the amplification product. And connecting the purified DNA fragment with the vector by using a Basic Seamless Cloning and Assembly Kit Seamless Cloning Kit, selecting a positive transformant, and performing sequencing verification to obtain the alpha-L-arabinanase secretion expression vector, which is named as pN-abnA. The secretory expression vector pN-abnA is obtained by connecting a gene coding alpha-L-arabinanase to the downstream of an SP2454 coding gene of a recombinant vector pN-P2454-SP2454 (shown in figure 3); wherein the nucleotide sequence of the gene for coding the alpha-L-arabinanase is shown as SEQ ID No. 4.

Example 5 construction of recombinant engineering bacteria expressing alpha-L-arabinanase

B, B.subtilis 7-3-3 electric shock transformation: picking fresh single colony in 5mL LB culture medium, culturing overnight at 37 deg.C and 200 rpm; inoculating to 50mL GM medium (LB medium supplemented with 0.5M sorbitol) at a volume ratio of 1%, culturing at 37 deg.C and 200rpm for 3-4 hr to OD₆₀₀Is 1.0; after the cultured bacterial liquid is subjected to ice-water bath for 10 minutes, centrifuging the bacterial liquid for 10 minutes at 4 ℃ at 5000g, collecting the bacterial cells, taking 40mL of ice-cold ETM (0.5M sorbitol, 0.5M mannitol and 10% glycerol) to re-suspend the bacterial cells, centrifuging the bacterial cells for 5 minutes at 4 ℃ at 5000g, and repeatedly washing the bacterial cells for three times; taking the thallus after the last washing, and re-suspending the thallus by using EMT with the volume ratio of 1:150 to ensure that the cell density is 10¹⁰Each tube is divided into 1.5mL centrifuge tubes by 60 mu L per tube, and the tube is preserved at minus 80 ℃ for standby, namely the prepared competence is obtained; thawing competence on ice, adding 5. mu.L of vector pN-abnA or pN-P2454-SP2454, ice-cooling for 5 minutes, and transferring to a precooled 1mm electric rotor; shock once at 25 uF, 200 Ω, 1700V for about 4.5ms to 5.0ms, add 1mL of pre-chilled RM medium immediately (LB contains 0.5M sorbitol and 0.38M mannitol); cultured at 37 ℃ for 1 hour at 200prm, spread on plates containing the corresponding antibiotics, cultured overnight at 37 ℃ and transformants picked for validation. The recombinant engineering bacterium containing the vector pN-abnA is named as BS-OEabnA, and the recombinant engineering bacterium containing the vector pN-P2454-SP2454 is named as BS-pN.

Example 6 fermentative production of alpha-L-arabinanase and expression level detection

The obtained engineering strains BS-OEabnA and BS-pN were subjected to fermentation culture according to the method of example 1, and additional 5 μ/mL chloramphenicol was added, and strains 7-3-3 were used as controls, and 1mL was sampled at 24h, 48h, 72h, and 96h, respectively, and centrifuged at 8000g to obtain a supernatant, which was subjected to further analysis.

SDS-PAGE: and (3) carrying out SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) on 72h crude enzyme solutions of the strains BS-OEabnA and BS-pN, adding 5 Xloading buffer solution to carry out boiling water bath treatment on the sample for 10 minutes, wherein the concentration of concentrated gel is 5%, the concentration of separation gel is 12%, and the loading amount is 30 mu L. The protein gel diagram shows that the strain BS-OEabnA has obvious bands near 32kDa, the sizes of the bands are consistent with the expected sizes of the alpha-L-arabinanase, the bands of the strain 7-3-3 and the BS-pN transferred into an empty vector are weaker in the size range, and the experimental result shows that the alpha-L-arabinanase is expressed (see figure 4).

And (3) carrying out protein quantitative detection on the crude enzyme solution by using a Bradford method protein quantitative detection kit, drawing a standard curve by using Bovine Serum Albumin (BSA) as a standard protein according to an instruction, detecting the sample, and calculating the protein concentration in the sample.

The result of the determination of the protein concentration of the extracellular alpha-L-arabinanase of the recombinant bacillus subtilis shows that the protein concentration is highest in 72h of shake flask fermentation, the protein concentration of the strain BS-OEabnA reaches 0.79 +/-0.04/mL, the protein concentration of the strain BS-pN is 0.48 +/-0.03 mg/mL, and the protein concentration of the alpha-L-arabinanase is about 0.31 mg/mL.

Sequence listing

<110> Shandong university

<120> a DNA fragment having promoter and signal peptide coding functions and its use in producing alpha-L-arabinanase

<141>2020-12-31

<160>8

<210>1

<211>300

<212> DNA

<213> Bacillus subtilis 7-3

<221> nucleotide sequence of promoter P2454

<222>（1）…（300）

<400> 1

catataagtg tcctgctcgt tttttccgag gtacttccat gtgaggagat cgccgtttaa 60

agcaatctct tccggaagcc agaactgctt cacgttttgg ttatagaaca tttgggtaaa 120

atcgtcttca tgctttgacc agtttgctgc agtatacagc ttgttttcgt tgagttgtga 180

caaaaatgtg acctcctaaa tattttttcc tccctcacca cctgtaaaaa gaagggaata 240

ttttataaat gttgtaaatt ttataatgca acatattcac tattaaggga ggaataaaaa 300

<210> 2

<211> 25

<212>PRT

<213> Bacillus subtilis 7-3

<221> amino acid sequence of Signal peptide SP2454

<222>（1）…（25）

<400> 2

Met Lys Lys Lys Phe Ile Ala Gly Ala Leu Val Leu Gly Leu Ile Pro

1 5 10 15

Thr Ile Gly Ser Thr Ala Val Ser Ala

20 25

<210> 3

<211> 75

<212> DNA

<213> Bacillus subtilis 7-3

<221> nucleotide sequence of Gene encoding Signal peptide SP2454

<222>（1）…（75）

<400> 3

atgaaaaaga aatttattgc tggtgcttta gttttaggtc taatacctac tattggtagt 60

actgctgttt cagca 75

<210> 4

<211> 876

<212> DNA

<213> Bacillus subtilis 7-3

<221> alpha-L-arabinanase nucleotide coding sequence

<222>（1）…（876）

<400> 4

gcgttttggg gtgcatccaa tgaactgctt catgacccga ctatgattaa agaggggagc 60

tcatggtatg cgctcggaac agggcttact gaagaacggg gactgcgggt tttgaagtct 120

tcagacgcta aaaattggac cgtacaaaaa tccattttca ctacaccgct atcgtggtgg 180

tccaattatg tgccgaatta tggccaaaac cagtgggcgc cggacatcca atactataac 240

ggcaagtact ggctgtatta ttccgtttct tcttttggaa gcaatacatc tgccattggc 300

ctggcatctt caacaagcat cagttcgggg agctggaagg acgagggctt ggtgattcgt 360

tcgacaagct caaataatta taacgccatt gatccggagc tgacattcga caaggatggc 420

aacccgtggc ttgcattcgg ctcgttttgg agcggcatta agctgactaa gctcgataag 480

agtacgatga agcctacagg ctcgctctat tcgattgcag ctagaccgaa taatggaggt 540

gccttagaag ctcctactct tacgtatcaa aatgggtatt actatttaat ggtttcattt 600

gataaatgct gtgacggggt aaacagtacg tacaaaattg cttacggaag gtccaaaaac 660

attacaggcc cttatcttga taaaagcgga aaaagcatgc ttgaaggcgg aggcaccatt 720

ttggattcgg gcaatgacca atggaaagga cctggaggcc aggatattgt gaacggaaac 780

attcttgttc gccatgccta tgatgccaat gacaacggca ttccaaagct tcttatcaat 840

gatttgaatt ggagttcggg ctggccgtcc tattga 876

<210> 5

<211> 32

<212> DNA

<213> Artificial sequence

<221> amplification promoter and Signal peptide coding region upstream primer

<222>（1）…（32）

<400> 5

ggggtaccca tataagtgtc ctgctcgttt tt 32

<210> 6

<211> 34

<212> DNA

<213> Artificial sequence

<221> amplification promoter and Signal peptide coding region downstream primer

<222>（1）…（34）

<400> 6

cgggatcctg ctgaaacagc agtactacca atag 34

<210>7

<211> 42

<212> DNA

<213> Artificial sequence

<221> amplification of upstream primer of alpha-L-arabinanase coding sequence

<222>（1）…（42）

<400> 7

aacagcagta ctaccaatag tgcgttttgg ggtgcatcca at 42

<210> 8

<211> 40

<212> DNA

<213> Artificial sequence

<221> downstream primer for amplifying alpha-L-arabinanase coding sequence

<222>（1）…（40）

<400>8

aagcttgcat gcctgcagtc aataggacgg ccagcccgaa 40

Claims (3)

1. An alpha-L-arabinanase secretion expression vector, characterized in that: the secretory expression vector is named as pN-abnA and is obtained by connecting a gene coding alpha-L-arabinanase to the downstream of an SP2454 coding gene of a recombinant vector pN-P2454-SP 2454; wherein the gene nucleotide sequence for coding alpha-L-arabinanase is shown as SEQ ID No.4, the recombinant vector pN-P2454-SP2454 is obtained by connecting a promoter P2454 nucleotide sequence and a gene nucleotide sequence for coding a signal peptide SP2454 to a vector pNW33N, wherein the gene nucleotide sequence for coding the signal peptide SP2454 is connected to the downstream of the promoter P2454 and is expressed under the mediation of P2454; wherein the nucleotide sequence of the promoter P2454 is shown as a sequence table SEQ ID No.1, and the nucleotide sequence of the gene coding the signal peptide SP2454 is shown as a sequence table SEQ ID No. 3.

2. A recombinant engineering bacterium for producing alpha-L-arabinanase is characterized in that: is obtained by transforming a host cell with the α -L-arabinanase secretion expression vector pN-abnA according to claim 1.

3. The recombinant engineered bacterium of claim 2, wherein: the host cell is 7-3-3 of bacillus subtilis, and the recombinant engineering bacterium obtained by transforming the host cell by the expression vector pN-abnA is named as BS-OEabnA.

Images