CN110964686A - Recombinant pseudomonas proteus and construction method and application thereof - Google Patents
Recombinant pseudomonas proteus and construction method and application thereof Download PDFInfo
- Publication number
- CN110964686A CN110964686A CN201911365330.XA CN201911365330A CN110964686A CN 110964686 A CN110964686 A CN 110964686A CN 201911365330 A CN201911365330 A CN 201911365330A CN 110964686 A CN110964686 A CN 110964686A
- Authority
- CN
- China
- Prior art keywords
- gndl
- seq
- jsu01
- nucleotide sequence
- 2kgdh
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/58—Aldonic, ketoaldonic or saccharic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/99—Oxidoreductases acting on the CH-OH group of donors (1.1) with other acceptors (1.1.99)
- C12Y101/99004—Dehydrogluconate dehydrogenase (1.1.99.4)
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Mycology (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention provides a recombinant pseudomonas proteus and a construction method and application thereof, and relates to the technical field of bioengineering, wherein a double knockout strain of gndL (gndC or gndS) and 2kgdH of pseudomonas is constructed by utilizing overlapping PCR, traceless knockout and homologous recombination technologies, the conversion of glucose or gluconic acid to 2-ketogluconic acid in the glucose metabolism process is blocked, and then the strain is utilized to convert the glucose into the gluconic acid. In the embodiment of the invention, the seed culture solution of the pseudomonas proteus JSU01 delta gndL delta 2kgdH is inoculated into a fermentation culture medium, and after 20 hours of fermentation, the gluconic acid accumulated in the fermentation solution of the pseudomonas proteus JSU01 delta gndL delta 2kgdH is 60.04 g/L.
Description
Technical Field
The invention belongs to the technical field of bioengineering, and particularly relates to recombinant pseudomonas proteus as well as a construction method and application thereof.
Background
Gluconic acid is an organic acid generated by oxidizing aldehyde group of glucose, and is widely applied to industries such as food, beverage, chemical industry, pharmacy, textile, detergent, leather, building and the like.
The gluconic acid production methods reported in the literature mainly include homogeneous chemical oxidation, heterogeneous catalytic oxidation, electrolytic oxidation, enzymatic oxidation, biological fermentation, and the like. Among them, the fermentation method is the most economical, efficient and environmentally friendly method for producing gluconic acid at present, and is widely used in domestic and foreign industrial production.
In the fermentation production of gluconic acid, the commonly used strain is the filamentous fungus aspergillus niger (aspergillus niger), i.e. glucose is catalyzed and oxidized into gluconolactone by using glucose oxidase, and then the gluconolactone is hydrolyzed to generate gluconic acid.
Bacteria of the genus Pseudomonas (Pseudomonas) have properties of better adaptation to different physicochemical and nutritional environments, tolerance to endogenous and exogenous stresses, relative to aspergillus niger. Meanwhile, the pseudomonas has a high-efficiency glucose extracellular oxidation system, and can quickly and economically oxidize glucose into gluconic acid and further into 2-ketogluconic acid under a proper culture condition. Therefore, if the conversion of glucose or gluconic acid into 2-ketogluconic acid can be blocked by using metabolic engineering means, the pseudomonas can be transformed into an engineering strain with high-yield gluconic acid.
Disclosure of Invention
In view of the above, the present invention aims to provide a recombinant pseudomonas proteus, a construction method and an application thereof, wherein a double knockout strain of a gluconate dehydrogenase structural gene and a 2-ketogluconate dehydrogenase gene of pseudomonas is constructed, the conversion of glucose or gluconic acid to 2-ketogluconate in a glucose metabolism process is blocked, and the strain can be applied to the conversion production of glucose to gluconic acid.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a recombinant pseudomonas proteus, which takes pseudomonas proteus (pseudomonas plecoglossicida) JSU01 as a basic strain, and knocks out a gluconate dehydrogenase structural gene and a 2-ketogluconate dehydrogenase gene 2kgdH of the basic strain;
the structural gene of the gluconate dehydrogenase comprises gndL, gndC or gndS, and the nucleotide sequence of the gndL is shown in SEQ ID NO. 1; the nucleotide sequence of the gndC is shown as SEQ ID NO. 2; the nucleotide sequence of the gndS is shown as SEQ ID NO. 3;
the nucleotide sequence of the 2-ketogluconate dehydrogenase gene 2kgdH is shown in SEQ ID NO. 4.
The invention also provides a construction method of the recombinant pseudomonas proteus, which comprises the following steps: knocking out the structural gene of the gluconate dehydrogenase in the basic strain by using overlapping PCR, traceless knocking out and homologous recombination respectively, and then knocking out the 2-ketogluconate dehydrogenase gene 2 kgdH.
Preferably, the primers used in knocking out the structural gene of gluconate dehydrogenase in the basic strain include L1, L2, L3 and L4; the nucleotide sequence of the L1 is shown as SEQ ID NO.5, the nucleotide sequence of the L2 is shown as SEQ ID NO.6, the nucleotide sequence of the L3 is shown as SEQ ID NO.7, and the nucleotide sequence of the L4 is shown as SEQ ID NO. 8.
Preferably, after knocking out the structural gene of the gluconate dehydrogenase in the basic strain, verifying the obtained recombinant strain JSU01 Δ gndL.
Preferably, the verification is that the PCR verification is carried out by taking the genomic DNA of the recombinant strain JSU01 delta gndL as a template and taking L1 and L4 as primers.
Preferably, primers used in knocking out the 2-ketogluconate dehydrogenase gene 2kgdH in the base strain include H1, H2, H3 and H4; the nucleotide sequence of H1 is shown as SEQ ID NO.9, the nucleotide sequence of H2 is shown as SEQ ID NO.10, the nucleotide sequence of H3 is shown as SEQ ID NO.11, and the nucleotide sequence of H4 is shown as SEQ ID NO. 12.
Preferably, after knocking out the structural gene of the gluconate dehydrogenase in the basic strain, verifying the obtained recombinant strain JSU01 Δ gndL Δ 2 kgdH.
Preferably, the verification is that the PCR verification is carried out by taking the genomic DNA of the recombinant strain JSU01 delta gndL delta 2kgdH as a template and H1 and H4 as primers.
The invention also provides application of the recombinant pseudomonas proteus in fermentation production of gluconic acid.
Preferably, in the fermentative production of gluconic acid, the fermentation medium used comprises: 140.0g/L starch hydrolysis sugar, 1.0g/L urea and 40.0g/L light CaCO3(ii) a The conditions for the fermentative production comprise: the stirring speed is 430r/min, the temperature is 33 ℃, the tank pressure is 0.02MPa, and the air flow is 42.0L/min.
The invention provides a recombinant pseudomonas proteus, which utilizes overlapping PCR, traceless knockout and homologous recombination technologies to construct a double knockout strain of a structural gene gndL (gndC or gndS) of a gluconate dehydrogenase and a 2-ketogluconate dehydrogenase gene 2kgdH of the pseudomonas, block the conversion of glucose or gluconic acid to 2-ketogluconate in the glucose metabolism process, and then convert the glucose into the gluconic acid by utilizing the strain. In the embodiment of the invention, the seed culture solution of the pseudomonas proteus JSU01 delta gndL delta 2kgdH, JSU01 delta gndL, JSU01 delta 2kgdH and JSU01 is inoculated into the same fermentation culture medium by decomposition with the same inoculation amount, and the fermentation is carried out for 20 hours under the same condition, except that the 2-ketogluconate cannot be detected in the JSU01 delta gndL delta 2kgdH fermentation solution, a large amount of 2-ketogluconate can be detected in the fermentation solution of other strains, and a large amount of gluconate is accumulated in the JSU01 delta gndL delta 2kgdH fermentation solution.
Biological preservation information
Pseudomonas proteorum (Pseudomonas plecoglossicida) JSU01, which is preserved in China general microbiological Culture Collection Center (CCCES), wherein the specific address is the institute of microbiology, China academy of sciences, No.3, West Lu 1, North Cheng, south China, in Beijing, the preservation time is 1 month and 18 days in 2013, and the preservation number is CGMCC No. 7150.
Drawings
FIG. 1 is an agarose gel electrophoresis analysis of the homology arms around the GndL gene of Pseudomonas pseudoalternifolia amplified by PCR;
FIG. 2 is a diagram of agarose gel electrophoresis analysis of the overlap PCR amplified gene deletion fragment Δ gndL;
FIG. 3 is an agarose gel electrophoresis analysis of the digested product of recombinant suicide plasmid pK18mobsacB- Δ gndL;
FIG. 4 is a PCR validation graph of Pseudomonas proteus JSU01 Δ gndL;
FIG. 5 is an agarose gel electrophoresis analysis of the homology arms around the 2kgdH gene of Pseudomonas proteus amplified by PCR;
FIG. 6 is an agarose gel electrophoresis analysis of the overlap PCR amplified gene deletion fragment Δ 2 kgdH;
FIG. 7 is an agarose gel electrophoresis analysis of the cleavage product of recombinant suicide plasmid pK18 mobsacB-delta 2 kgdH;
FIG. 8 is a PCR validation graph of Pseudomonas proteus JSU01 Δ 2kgdH and JSU01 Δ gndL Δ 2 kgdH;
FIG. 9 is a graph of Pseudomonas proteus JSU01 Δ gndL Δ 2kgdH, JSU01, JSU01 Δ gndL, and JSU01 Δ 2kgdH fermentation processes.
Detailed Description
The invention provides a recombinant pseudomonas proteus, which takes pseudomonas proteus (pseudomonas plecoglossicida) JSU01 as a basic strain, and knocks out a gluconate dehydrogenase structural gene and a 2-ketogluconate dehydrogenase gene 2kgdH of the basic strain; the structural gene of the gluconate dehydrogenase comprises gndL, gndC or gndS, and the nucleotide sequence of the gndL is shown as SEQ ID NO.1 (1788 bp); the nucleotide sequence of the gndC is shown as SEQ ID NO.2 (1314 bp); the nucleotide sequence of the gndS is shown as SEQ ID NO.3 (753 bp); the nucleotide sequence of the 2-ketogluconate dehydrogenase gene 2kgdH is shown in SEQ ID NO.4 (1317 bp).
The JSU01 is preserved with the preservation number of CGMCC No. 7150.
The invention also provides a construction method of the recombinant pseudomonas proteus, which comprises the following steps: knocking out the structural gene of the gluconate dehydrogenase in the basic strain by using overlapping PCR, traceless knocking out and homologous recombination respectively, and then knocking out the 2-ketogluconate dehydrogenase gene 2 kgdH.
In the knockout of the structural gene of the gluconate dehydrogenase in the basic strain, taking knockout of gndL as an example, the primers used preferably include L1, L2, L3 and L4; the nucleotide sequence of the L1 is shown as SEQ ID NO. 5: gGAATTCCGTCACCTTCTTCGCCAT (the transverse line part is EcoR I restriction enzyme cutting site), the nucleotide sequence of L2 is shown in SEQ ID NO. 6: GTAGCGGTTGATGGCACTTGCCTCGGTCAGTTCCTT, the nucleotide sequence of L3 is shown in SEQ ID NO. 7: AAGGAACTGACCGAGGCAAGTGCCATCAACCGCTAC, the nucleotide sequence of L4 is shown in SEQ ID NO. 8: CG (CG)GGATCCCAGGTATTCGCCCTTCTTG (the horizontal line is BamH I site). The method specifically comprises the following steps: (1) amplifying the left and right homologous arms of the gndL gene by PCR; (2) amplifying a gndL gene deletion fragment (Δ gndL) by overlap PCR; (3) constructing a recombinant suicide plasmid pK18 mobsacB-delta gndL; (4) knockout of gndL gene of pseudomonas proteus JSU 01.
When the invention utilizes PCR to amplify the left and right homologous arms of the gndL gene, the system for PCR amplification is preferably a 25 mu L system, and comprises the following components: 1.0. mu.L of genomic DNA of JSU01 strain, 1.0. mu.L of each of primers L1 and L2 or L3 and L4 (10.0. mu. mol/L), 2 XPfu Mastermix 12.5. mu.L, using sterile ddH2O to 25.0. mu.L, wherein the primer pair L1 and L2 or L3 and L4 were used to amplify the left and right homology arms of the gndL gene, respectively. The procedure for PCR amplification is preferably: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s and annealing at 75 DEG CThe fire was 30s (after each cycle was reduced by 1 ℃), the extension was 1min at 75 ℃ and the cycle was 20 times; denaturation at 94 deg.C for 30s, annealing at 55 deg.C for 30s, extension at 72 deg.C for 1min, and circulation for 20 times; extension at 72 ℃ for 5 min. The obtained PCR products (the left and right homologous arms of the gndL gene) are separated by agarose gel electrophoresis, and after cutting the gel, the target fragments are recovered by a gel recovery kit to respectively obtain the left and right homologous arms of the gndL gene.
The overlap PCR of the invention amplifies the deletion fragment (Δ gndL) of the gndL gene, and the reaction system (25.0 μ L) of the overlap PCR preferably comprises: 100ng each of the left and right homology arms of the gndL gene, 1.0. mu.L each of primers L1 and L4 (10.0. mu. mol/L), 12.5. mu.L of 2 XPfu MasterMix, using sterile ddH2O is added to a constant volume of 25 mu L. The reaction procedure of the overlapping PCR is preferably: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 deg.C for 30s, annealing at 75 deg.C for 30s (reducing 1 deg.C per cycle), extension at 75 deg.C for 2min, and cycling for 20 times; denaturation at 94 deg.C for 30s, annealing at 55 deg.C for 30s, extension at 72 deg.C for 2min, and circulation for 25 times; extension at 72 ℃ for 5 min. Separating the products of the overlapped PCR by using agarose gel electrophoresis to obtain a target gene deletion fragment delta gndL which is consistent with the prediction, and cutting the gel to recover the target gene deletion fragment delta gndL.
The preferable steps for constructing the recombinant suicide plasmid pK18 mobsacB-delta gndL comprise: plasmid pK18mobsacB and gene deletion fragment Δ gndL were subjected to conventional double digestion treatment with restriction endonucleases BamH I and EcoR I, respectively. The double digestion products were separated by agarose gel electrophoresis, the gel was cut to recover the desired fragment, and the recovered Δ gndL and linearized pK18mobsacB were ligated to the recombinant suicide plasmid pK18mobsacB- Δ gndL. After the recombinant suicide plasmid is obtained, the invention preferably further comprises the steps of transferring the recombinant suicide plasmid into a competent cell of Escherichia coli (Escherichia coli) JM109, carrying out screening culture on the competent cell by an LB culture medium containing kanamycin, and extracting the plasmid to obtain the recombinant suicide plasmid pK18 mobsacB-delta gndL.
The knockout of the gndL gene of the Pseudomonas proteus JSU01 of the present invention preferably comprises: the recombinant plasmid pK18 mobsacB-delta gndL is used for transforming competent cells of pseudomonas proteus JSU01, the transformed bacterial liquid is taken and coated on an LB plate containing 50 mu g/mL kanamycin, and inverted culture is carried out for 16-18 h at 33 ℃. Positive single clones were picked from the plate, inoculated in LB medium containing 50. mu.g/mL kanamycin, and cultured with shaking at 30 ℃ and 200r/min for 12 hours. Taking a proper amount of culture solution, and carrying out colony PCR verification by taking L1 and L4 as primers to obtain the recombinant strain JSU01/pK18 mobsacB-delta gndL.
Taking a proper amount of diluted JSU01/pK18 mobsacB-delta gndL bacterial liquid, uniformly coating the bacterial liquid on an LB plate containing 10% of cane sugar, carrying out inverted culture at 33 ℃ for 16-18 h, then selecting a single colony, inoculating the single colony into an LB liquid culture medium, and carrying out shake culture at 30 ℃ and 200r/min for 10-12 h. Genomic DNA was extracted from the cultured bacterial suspension by referring to the genomic DNA extraction kit instructions, and PCR amplification was carried out using this as a template and primers L1 and L4. According to the result of electrophoretic analysis of the PCR amplification product, a gndL knockout strain (or JSU 01. delta. gndL) of Pseudomonas proteus JSU01 was selected.
According to the invention, after the structural gene of the gluconate dehydrogenase in the basic strain is knocked out, the obtained recombinant strain JSU01 delta gndL is preferably verified, and the verification preferably comprises the steps of performing PCR verification by taking the genomic DNA of the recombinant strain JSU01 delta gndL as a template and taking L1 and L4 as primers. The PCR-validated system (25.0. mu.L) according to the invention preferably comprises: LATaqTMVersion 2.012.5 μ L, L1(10.0 μmol/L)1.0 μ L, L4(10.0 μmol/L)1.0 μ L, genomic DNA1.0 μ L, ddH2O9.5 mu L; the procedure for PCR verification is preferably: denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 4min, and amplification for 30 cycles.
The primers used in knocking out the 2-ketogluconate dehydrogenase gene 2kgdH in the basic strain preferably comprise H1, H2, H3 and H4; the nucleotide sequence of H1 is shown in SEQ ID NO. 9: gGAATTCATGGACAGGATGCGAACT (the transverse line part is EcoR I restriction enzyme cutting site), the nucleotide sequence of H2 is shown in SEQ ID NO. 10: ACTGTGCGGCTTGCGATTGTAGCCGATTTGGGTTTG, the nucleotide sequence of H3 is shown in SEQ ID NO. 11: CAAACCCAAATCGGCTACAATCGCAAGCCGCACAGT, the nucleotide sequence of H4 is shown in SEQ ID NO. 12: CG (CG)GGATCCCACATCATCCGCCACCAA (the horizontal line is BamH I site). The method specifically comprises the following steps: (1) takes the genome DNA of JSU01 strain as a templateRespectively carrying out PCR amplification on left and right homologous arms of the 2kgdH gene by taking H1 and H2 or H3 and H4 as primers; (2) using left and right homologous arms of the 2kgdH gene as templates, and using H1 and H4 as primers, and carrying out PCR amplification on the 2kgdH gene deletion fragment delta 2 kgdH; (3) constructing a recombinant suicide plasmid pK18 mobsacB-delta 2 kgdH; (4) knocking out 2kgdH gene of pseudomonas proteus JSU01 delta gndL to obtain JSU01 delta gndL delta 2 kgdH. In the present invention, when the 2-ketogluconate dehydrogenase gene 2kgdH in the basic strain is knocked out, the system and method used are preferably the same as the method for knocking out the structural gene of the gluconate dehydrogenase in the basic strain, and are not described herein again. According to the invention, after the structural gene of the gluconate dehydrogenase in the basic strain is knocked out, the verification of the obtained recombinant strain JSU01 delta gndL delta 2kgdH is preferably carried out. The verification is preferably performed by taking the genomic DNA of the recombinant strain JSU01 delta gndL delta 2kgdH as a template and H1 and H4 as primers. The PCR-validated system (25.0. mu.L) according to the invention preferably comprises: LATaqTMVersion 2.012.5 μ L, H1(10.0 μmol/L)1.0 μ L, H4(10.0 μmol/L)1.0 μ L, genomic DNA1.0 μ L, ddH2O9.5 mu L; the procedure for PCR verification is preferably: denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 4min, and amplification for 30 cycles.
The invention also provides application of the recombinant pseudomonas proteus in fermentation production of gluconic acid.
In the invention, when the gluconic acid is produced by fermentation, the preferred method also comprises the enlarged culture, and the enlarged culture is that the recombinant pseudomonas proteus JSU01 delta gndL delta 2kgdH is inoculated to the culture medium containing 20.0g/L glucose, 10.0g/L corn steep liquor, 2.0g/L urea and 2.0g/L KH2PO4、0.5g/L MgSO4·7H2O and 0.5g/L light CaCO3(pH6.7 before sterilization), the culture was carried out for 14 hours at a stirring speed of 400r/min, a temperature of 30 ℃, a pot pressure of 0.03MPa and a ventilation of 1.75L/min.
The fermentation production of the invention is preferably to inoculate the bacterial liquid after the expanded culture into the culture medium containing 140.0g/L starch hydrolysis sugar (calculated by glucose), 1.0g/L urea and 40.0g/L light CaCO with the inoculation amount of 10 percent3In the fermentation medium of (1), the stirring speed is 430r/min, the temperature is 33 ℃, and the tank pressure isFermenting under 0.02MPa and 42.0L/min ventilation.
The recombinant Pseudomonas proteus provided by the present invention, and the construction method and application thereof, will be described in detail with reference to the following examples, but they should not be construed as limiting the scope of the present invention.
Example 1
Knockout of the gndL Gene of Pseudomonas proteus JSU01
(1) Extraction of Pseudomonas proteus JSU01 genomic DNA
Pseudomonas proteus JSU01 was inoculated into 5.0mL of LB medium, cultured with shaking at 30 ℃ and 200r/min for 12h, and then centrifuged (8000r/min,2min) to collect the cells, and the cells were washed 2 times with sterile water. According to the operation method of the bacterial genome DNA extraction kit, the total DNA of the pseudomonas proteus JSU01 is extracted and stored at-20 ℃ for later use.
(2) PCR primers L1, L2, L3 and L4 for knocking out the gndL gene are designed according to the nucleotide sequence of the pseudomonas proteus gndL gene and the upstream and downstream sequences thereof, and are used for amplifying the gndL gene deletion fragment to construct a recombinant suicide plasmid. The PCR primers were designed as follows:
L1：5′-GGAATTCCGTCACCTTCTTCGCCAT-3' (containing EcoR I cleavage site, SEQ ID NO.5)
L2：5′-GTAGCGGTTGATGGCACTTGCCTCGGTCAGTTCCTT-3′(SEQ ID NO.6)
L3：5′-AAGGAACTGACCGAGGCAAGTGCCATCAACCGCTAC-3′(SEQ ID NO.7)
L4：5′-CGGGATCCCAGGTATTCGCCCTTCTTG-3' (containing BamH I cleavage site, SEQ ID NO.8)
(3) PCR amplification of left and right homology arms of the gndL Gene
And (3) PCR reaction system: 1.0. mu.L of genomic DNA of JSU01 strain, 1.0. mu.L of each of primers L1/L2 or L3/L4 (10.0. mu. mol/L), 2 XPfu Mastermix 12.5. mu.L, using sterile ddH2And O is metered to 25.0 mu L.
PCR reaction procedure: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 deg.C for 30s, annealing at 75 deg.C for 30s (reducing 1 deg.C per cycle), extension at 75 deg.C for 1min, and cycling for 20 times; denaturation at 94 deg.C for 30s, annealing at 55 deg.C for 30s, extension at 72 deg.C for 1min, and circulation for 20 times; extension at 72 ℃ for 5 min.
The PCR products (left and right homology arms of the gndL gene) were separated by agarose gel electrophoresis (FIG. 1, lane 1: left and right homology arms of gndL gene; lane 2: right homology arms of gndL gene), and the target fragment was recovered by a gel recovery kit after cutting.
(4) Amplification of a gndL Gene deletion fragment (Δ gndL) by overlap PCR
PCR reaction (25.0. mu.L): 100ng each of the left and right homology arms of the gndL gene, 1.0. mu.L each of primers L1/L4 (10.0. mu. mol/L), 12.5. mu.L of 2 XPfu MasterMix, using sterile ddH2O is added to a constant volume of 25 mu L.
PCR reaction procedure: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 deg.C for 30s, annealing at 75 deg.C for 30s (reducing 1 deg.C per cycle), extension at 75 deg.C for 2min, and cycling for 20 times; denaturation at 94 deg.C for 30s, annealing at 55 deg.C for 30s, extension at 72 deg.C for 2min, and circulation for 25 times; extension at 72 ℃ for 5 min.
The PCR product was separated by agarose gel electrophoresis to obtain a deletion fragment Δ gndL of the target gene (FIG. 2, lane 1: Δ gndL fragment) that matches the prediction, and the deletion fragment Δ gndL of the target gene was recovered by cutting the gel and stored at-20 ℃ for further use.
(5) Construction of recombinant suicide plasmid pK18 mobsacB-delta gndL
Plasmid pK18mobsacB and gene deletion fragment Δ gndL were subjected to conventional double digestion treatment with restriction endonucleases BamH I and EcoR I, respectively. Separating the double digestion products by agarose gel electrophoresis, then cutting the gel to recover a target fragment, and storing the recovered delta gndL and the linearized pK18mobsacB at the temperature of-20 ℃ for later use.
According to the DNA Ligation kit instructions, Δ gndL and linearized pK18mobsacB were mixed at a molar ratio of 5: 1, then an equal volume of DNA ligase Ligation Mix was added and ligated overnight at 16 ℃ to give recombinant suicide plasmid pK18mobsacB- Δ gndL.
The recombinant plasmid pK18 mobsacB-. DELTA.gndL was transformed into competent cells of Escherichia coli (Escherichia coli) JM 109. An appropriate amount of the transformed bacterial suspension was applied to LB plate containing 50. mu.g/mL kanamycin and cultured at 37 ℃ for about 12 hours. Positive single clones were picked from the plate, inoculated in LB medium containing 50. mu.g/mL kanamycin, and cultured with shaking at 30 ℃ and 200r/min for 12 hours. Extracting recombinant plasmids from the amplified positive monoclonals by using a plasmid DNA extraction kit, and then performing enzyme digestion verification and sequencing verification, wherein the enzyme digestion verification result is shown in figure 3, wherein a lane 1: pK18mobsacB- Δ gndL single enzyme digestion product; 2: pK18 mobsacB-. DELTA.gndL double cleavage product.
(6) Knockout of the gndL Gene of Pseudomonas proteus JSU01
Competent cells of Pseudomonas proteorus JSU01 were transformed with the recombinant plasmid pK18 mobsacB-. DELTA.gndL. An appropriate amount of the transformed bacterial liquid is taken and coated on an LB plate containing 50 mu g/mL kanamycin, and inverted culture is carried out for 16-18 h at 33 ℃. Positive single clones were picked from the plate, inoculated in LB medium containing 50. mu.g/mL kanamycin, and cultured with shaking at 30 ℃ and 200r/min for 12 hours. Taking a proper amount of culture solution, and carrying out colony PCR verification by taking L1 and L4 as primers to obtain the recombinant strain JSU01/pK18 mobsacB-delta gndL.
Taking a proper amount of diluted JSU01/pK18 mobsacB-delta gndL bacterial liquid, uniformly coating the bacterial liquid on an LB plate containing 10% of cane sugar, carrying out inverted culture at 33 ℃ for 16-18 h, then selecting a single colony, inoculating the single colony into an LB liquid culture medium, and carrying out shake culture at 30 ℃ and 200r/min for 10-12 h. Genomic DNA was extracted from the cultured bacterial suspension by referring to the genomic DNA extraction kit instructions, and PCR amplification was carried out using this as a template and primers L1 and L4. The results of electrophoretic analysis of the PCR amplification products are shown in FIG. 4, in which 1: primer L1/L4, template is JSU01 genome DNA; 2: primer L1/L4, the template is JSU01 delta gndL genome DNA, and the gndL knockout strain of Pseudomonas proteus JSU01 (JSU01 delta gndL) can be obtained.
Example 2
Knockout of 2kgdH gene of Pseudomonas proteorjs JSU01 and JSU 01. delta. gndL
(1) According to the nucleotide sequence of the pseudomonas proteus 2kgdH gene and the upstream and downstream sequences thereof, PCR primers H1, H2, H3 and H4 for knocking out the 2kgdH gene are designed and used for amplifying the 2kgdH gene deletion fragment so as to construct a recombinant suicide plasmid. The PCR primers were designed as follows:
H1：5′-GGAATTCATGGACAGGATGCGAACT-3' (the transverse line part is EcoR I enzyme cutting site, SEQ ID NO.9)
H2：5′-ACTGTGCGGCTTGCGATTGTAGCCGATTTGGGTTTG-3′(SEQ ID NO.10)
H3：5′-CAAACCCAAATCGGCTACAATCGCAAGCCGCACAGT-3′(SEQ ID NO.11)
H4：5′-CGGGATCCCACATCATCCGCCACCAA-3' (the horizontal line part is BamH I restriction site SEQ ID NO.12)
(2) PCR amplification of the left and right homology arms of the 2kgdH Gene
In analogy to the procedure described in example 1, the left and right homologous arms of the 2kgdH gene were PCR amplified using genomic DNA of JSU01 strain as template and H1/H2 or H3/H4 as primers, and the results are shown in fig. 5, where lane 1: 2kgdH left homology arm; 2: 2kgdH right homology arm.
(3) Overlap PCR amplification of 2kgdH Gene deletion fragment (. DELTA.2kgdH)
The 2kgdH gene deletion fragment, Δ 2kgdH, was PCR amplified using the left and right homology arms of the 2kgdH gene as templates and H1 and H4 as primers, in analogy to the procedure described in example 1. The results are shown in FIG. 6, where lane 1: a.DELTA.2 kgdH fragment.
(4) Construction of recombinant suicide plasmid pK18 mobsacB-delta 2kgdH
The recombinant suicide plasmid pK18 mobsacB-. DELTA.2kgdH was constructed in analogy to the construction of recombinant suicide plasmid pK18 mobsacB-. DELTA.gndL described in example 1. The results are shown in FIG. 7, where lane 1: pK18 mobsacB-. DELTA.2 kgdH single cleavage product; 2: pK18 mobsacB-. DELTA.2 kgdH double cleavage product.
(5) Knockout of 2kgdH gene of Pseudomonas proteorjs JSU01 and JSU 01. delta. gndL
In analogy to the procedure described in example 1, the 2kgdH gene of Pseudomonas proteorns JSU01 and JSU01- Δ gndL was knocked out. The PCR identification results are shown in fig. 8, where lane 1: primer H1/H4, the template is JSU01 genome DNA; 2: primer primers H1/H4, wherein the template is JSU01 delta 2kgdH genomic DNA; 3: primer H1/H4, and template JSU01 delta gndL delta 2kgdH genomic DNA.
Example 3
Production of gluconic acid by fermentation of pseudomonas proteus JSU01 delta gndL delta 2kgdH
Pseudomonas proteorus JSU01 Δ gndL Δ 2kgdH, JSU01 Δ gndL, JSU01 Δ 2kgdH and JSU01 were inoculated into 3.5L of a culture medium containing 20.0g/L glucose, 10.0g/L corn steep liquor, 2.0g/L urea and 2.0g/LKH2PO4、0.5g/LMgSO4·7H2O and 0.5g/L light CaCO3(pH6.7 before sterilization), the culture was carried out for 14 hours at a stirring speed of 400r/min, a temperature of 30 ℃, a pot pressure of 0.03MPa and a ventilation of 1.75L/min.
The seed culture broth of the cultured Pseudomonas proteus JSU 01. DELTA.gndL. DELTA.2 kgdH, JSU 01. DELTA.gndL, JSU 01. DELTA.2 kgdH and JSU01 was inoculated in 35L of a medium containing 140.0g/L starch-hydrolyzing sugar (calculated as glucose), 1.0g/L urea and 40.0g/L light CaCO at an inoculum size of 10%3The fermentation medium of (2) is fermented at a stirring speed of 430r/min, a temperature of 33 ℃, a tank pressure of 0.02MPa, and a ventilation rate of 42.0L/min. The glucose in the fermentation liquor is almost completely consumed in 20 hours of fermentation (<0.5 g/L). At this time, the fermentation broth of JSU01 Δ gndL Δ 2kgdH accumulated gluconic acid at 60.04g/L, and the presence of 2-ketogluconic acid was not detected, whereas the fermentation broths of JSU01 Δ gndL, JSU01 Δ 2kgdH and JSU01 accumulated a large amount of 2-ketogluconic acid (110.11, 123.14 and 130.17g/L, respectively), and the presence of a small amount of gluconic acid was detected (10.12, 7.21 and 6.85g/L, respectively).
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Baijiexin VC sodium Co., Ltd, Dexing, Jiangxi province
Jiangsu university
<120> recombinant pseudomonas proteus and construction method and application thereof
<160>12
<170>SIPOSequenceListing 1.0
<210>1
<211>1788
<212>DNA
<213>Pseudomonas plecoglossicida
<400>1
atggcccagg tgatgaagaa agtcgatgcg gtcatcgtcg ggttcggctg gaccggcgcg 60
atcatggcca aggaactgac cgaggcaggc ctgcaggtgg tcgccctgga gcggggccca 120
gcgcgtgaca cctacccgga cggtgtctac ccgcagacca tggacgagct gacctacaac 180
tcgcgcaaga aactgttcat ggacatttcc cgcgagaccg tgaccctgcg tcacagcctg 240
aacgatgtgg ccgtgccgta ccgccagttc ggcgccttcc tgcctggcac gggcaccggc 300
ggggccgggc tgcactggtc gggcgtgcat tttcgcgtcg acccgatgga gctgcgcatg 360
cgcagccact atgaggaacg ctatggcaag gccttcatcc ccgaaggcat gaccatccag 420
gatttcggcg tcagctacga agagctggaa ccgtacttcg atttcgccga aaaagtcttt 480
ggcacctccg gcaccgcctg gtcgatcaag gggcaggtgg tgggccgcga caagggcggc 540
aacccgttct ccccggaccg ctccgatgat ttcccgctgc cggcgcagaa gaacaccgtc 600
tcggcgcagc tgttcgagaa ggcggcccgc gaggtcggct accaccccta caatttgccg 660
tcggccaaca cctccgggcc ctacaccaac ccctacgggg cacagatggg cccgtgcaat 720
ttctgcggct actgcagcgg ctatgcctgc tacatgtatt ccaaggcctc gcccaacgtg 780
aacatcctgc cggccctgcg ccaagtgccg aacttcgagc tgcgcaacaa tgcccatgtg 840
ttgcgggtca acctcaatgc cgagaagaac ctggccaccg gcgtgaccta cgtcgatgcc 900
caggggcgcg aggtggaaca gccggcggac ctggtgatcc tcggtgcctt ccagttcaac 960
aacgtgcgcc tgatgctgct ttcgggcatc ggcaaaccct acgacccggt cagcaaccag 1020
ggtgtggtgg ggcgtaactt cgccttccag aacctgtcca cggtgagcgc tttcttcgac 1080
aagaacagcc accacaccaa ccccttcatc ggcgctggcg gcaatggcgt ggcggtggac 1140
gatttcaatg ccgacaactt cgaccatggc ccgctcggct tcgtcggcgg ctcgccgttc 1200
tgggtcaacc aggcgggcac caagcccatc tccggcacca agaccccgcc aggcacgccc 1260
aagtggggca gtgcctggaa ggccgcggtg gcggacagct acagccacat gctgtcgatg 1320
gacgcccatg gcgcgcacca gtcctaccgc gacaactacc tggacctgga cccggtgtac 1380
aaggacgcct atggcctgcc gctgctgcgc atgactttcg actggaagga caacgacgtg 1440
aagatgaacc gcttcatggt cgagcagatg cgcaagatcg ccgaagccat ggggcccaag 1500
gcgatcgccg cgtcgatgaa ggcgttcggt cagcacttcg atgccaccgt gtaccagacc 1560
acccacctca acggcggcgc gatcatgggc accgacccca agactagtgc catcaaccgc 1620
tacctgcaga gctgggacgt gcacaacgtc ttcgtgccgg gcgcctcggc gtttccccag 1680
gggctgggct acaaccccac cgggttggtg gcggcgctga cttactggtc ggcgcgggcc 1740
attcgcgagc agtacctgaa gaacccaggt ccactggtgc aggcatag 1788
<210>2
<211>1314
<212>DNA
<213>Pseudomonas plecoglossicida
<400>2
atgaaacgac tgttgaccgc cgccctctgc ctgggcgcca gtaccctgct gcatgccgcc 60
gacgcggccg acccggccct tgtcaagaag ggcgaatacc tggcccgcgc cggcgactgc 120
gtggcctgcc ataccgccaa gggcggcaag ccgttcgccg gcggcctgcc catggagacc 180
cccatcggca cgctctattc caccaacatc accccggacc cgagcggcat cggcgactac 240
agctacgaag acttcgagcg cgccgtacgc cagggcatcg ggctcgatgg cagcactctg 300
tatccggcca tgccataccc gtcctatgcg cgggtcagcg acgaggacat gcaggcgctc 360
tatgcctact tcatgcacgg cgtgcagccg gtggagcagg ccaacaagga cagcgacatc 420
ccttggccgc tgagcatgcg ctggccgctg gcgttctggc gcgggctgtt cgcgcctgag 480
gtcaagccgt tcgaggccgg tgggcgtgac ccggtggtgg cccgcggggc ctatctggtc 540
gagggcctgg gccattgtgg cgcctgccac acgccacggg cgttgaccat gcaggaaaaa 600
gcgctggatg ccgacgacgg cgatgcctac ctggccggca gcgcgccgct ggaaggctgg 660
gtcgccaaga gcctgcgggg cgatcacaaa gatggcctgg gcagctggag cgaggcgcag 720
atcgtggcct ttctcaagac cgggcgcaac gagcgcacgg cggtcttcgg cggcatgagc 780
gatgtggtcg agcacagcat gcagtacatg agcgacgccg acctcagcgc catcgcccgc 840
tacctgaaga ccttgccgcc ggtgaacccg gacgacaagc cgttccagga ggaccgccag 900
gtcgccgatg cgttgtggaa gggcgacgat gccaaacccg gtgccgcgct ctacgtggac 960
aactgcgctg cttgccaccg caccgatggc aagggctacg cgcgggtgtt cccggccctt 1020
gccggcaacc cggtgctgca gggcaaggat gccacttcgc tgatccacat cgtgctcgaa 1080
ggcggcacct tgcctgcaac gcagacggcg ccgtcgacct tcaccatgcc ggccttcgcc 1140
tggcggatga acgaccagca agtggccgat gtggtcaacttcatccgcag cagctggggc 1200
aaccaggccg gtgcggtgac cgcagcccag gtggcgagcc tgcgcaagca gccggcgcct 1260
gtgctcaagg ccgagtcgtt gatcggtgat accacgggga tcgaggaacc ttga 1314
<210>3
<211>753
<212>DNA
<213>Pseudomonas plecoglossicida
<400>3
atgtccaacg acgaacctgc cttcgcgcac ccggcgcgcc gcgagttcct gcgcaagtca 60
ctgaccctca ttccggtggc gaccctcgcc agcaccggca tgggcagcgc ggtgcttgcc 120
gataccgcca cccccgcatc cgccaaggac cccgaacagg gcagggcgcc agcccgcgcc 180
taccaaccga ccttcttcaa tgccgaagag tgggcgttca tctcagctgc ggtcgcggtg 240
ctcattcccg ccgacgcgct cggccccggt gcggtagaag ccggtgtacc ggaattcatc 300
gaccgccagc tcaatacccg ctacggcagt ggtggcctgt ggtacatgca gggccccttc 360
catccggacg caccggccga gttgggctac cagctcaagc tcagccccca ggagatctac 420
cggctgggta tccaggaaac cgacgcctgg tgcaaggcgc agtggagcaa gccgttcgcc 480
cagctggacc cggcccaaca gcagcaagcc ctggaggccc tggacagcgg caaggcggcc 540
ctggcctcgg tgcctgccgt caccttcttc gccatgctct ggctcaatac ccgcgaaggg 600
ttcttcagcg acccgctgca cggcggcaac caaggcctgg ctggctggaa gctgattggc 660
ttccccggcg cgcgtgccga tttcatggat tgggtggaac gcgacgagcg ctatcccttc 720
cctccggtat ccatcagtgg cgagcgaggt tga 753
<210>4
<211>1317
<212>DNA
<213>Pseudomonas plecoglossicida
<400>4
atggacagga tgcgaacttc gatactgctg gccctgttct tcagcctggg cgcctgcggc 60
gagtccgctc gcctggatat cagcgccggc agtggccctt caccacaatt gccggagcca 120
cgaaagacgc tgctccctac cgtgaacatc gcgcccgcca tcggctggcc agagggtgcc 180
aaacccaaat cggctaccgg tacgcaggtg gtcgccttcg ccagaaacct ggaccacccg 240
cgctggctct atgtgctgcc caacggcgat gtactggtgg cagagaccaa cgccccgccc 300
aagcccgagg atggcaaggg gattcgcggc tgggtgatgc gcaaggtcat ggagcgcgct 360
ggcgctggtg tgcccagcgc caatcgcatc actctgctgc gcgatgccga tcatgatggc 420
gttgcggaga tccgtacgac cttcatcgaa gggctcaact caccgttcgg tatggcgttg 480
gtgggcaagg acctgtatgt cgccgatacc gaccggctgc tgcgctttca ttatgagccg 540
ggcgccatgc aactgcgcca ggaaggccgc aaggtggtgg acctgcctgg cggcccgttg 600
aatcaccatt ggaccaagaa cgtgatcgcc agccgcgacg gcaagaagct gtatgtcacg 660
gtcggctcca acagcaacgt gggcgagaac gggctggaca aggaacaggg tcgggcagcg 720
atctgggagg ttgacccggc cgatggcgaa catcggatct tcgcctcagg cctgcgcaac 780
cccaacgggt tggcctggga gccgcgcaca ggggtgttgt ggacagcggt caacgagcgt 840
gacgagatcg gtagcgacct ggtgccggac tacatcacct cggtgaagga tggcgggttc 900
tatggctggc cgtacagcta ctacggccaa catgtggact tgcgggtcga gccgcaggac 960
ccggcgaaag tcgcgcaggc gatcgtgccg gattatgcgg tggggccaca cacggcgtcg 1020
cttgggcttg agttcgccca gccgggggtg ttaccggcgc cgttcgaaca gggggcgttc 1080
gtagggcagc atggctcttg gaatcgcaag ccgcacagtg ggtacaaggt gattttcgtg 1140
ccgttcagtg atgaggggag gcctgccgga aagccggtgg atgtgttgac ggggttcgtc 1200
gacagcaagg gcaaggcgat ggggcggcct gtgggcgtga tcaatgatgg gcgtggcggg 1260
gttttggtgg cggatgatgt gggggatgtg gtttggcggg tcagtcgagg gtcttga 1317
<210>5
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
ggaattccgt caccttcttc gccat 25
<210>6
<211>36
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
gtagcggttg atggcacttg cctcggtcag ttcctt 36
<210>7
<211>36
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
aaggaactga ccgaggcaag tgccatcaac cgctac 36
<210>8
<211>27
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
cgggatccca ggtattcgcc cttcttg 27
<210>9
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
ggaattcatg gacaggatgc gaact 25
<210>10
<211>36
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
actgtgcggc ttgcgattgt agccgatttg ggtttg 36
<210>11
<211>36
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
caaacccaaa tcggctacaa tcgcaagccg cacagt 36
<210>12
<211>26
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
cgggatccca catcatccgc caccaa 26
Claims (10)
1. A recombinant Pseudomonas proteus, which is characterized in that a Pseudomonas proteus (Pseudomonas plecoglossicida) JSU01 is taken as a basic strain, and a gluconate dehydrogenase structural gene and a 2-ketogluconate dehydrogenase gene 2kgdH of the basic strain are knocked out;
the structural gene of the gluconate dehydrogenase comprises gndL, gndC or gndS, and the nucleotide sequence of the gndL is shown as SEQ ID NO. 1; the nucleotide sequence of the gndC is shown as SEQ ID NO. 2; the nucleotide sequence of the gndS is shown as SEQID NO. 3;
the nucleotide sequence of the 2-ketogluconate dehydrogenase gene 2kgdH is shown in SEQ ID NO. 4.
2. The method for constructing recombinant Pseudomonas proteorum according to claim 1, comprising the steps of: knocking out the structural gene of the gluconate dehydrogenase in the basic strain by using overlapping PCR, traceless knocking out and homologous recombination respectively, and then knocking out the 2-ketogluconate dehydrogenase gene 2 kgdH.
3. The method for constructing according to claim 2, wherein the primers used for knocking out the structural gene of gluconate dehydrogenase in the basic strain include L1, L2, L3 and L4; the nucleotide sequence of the L1 is shown as SEQ ID NO.5, the nucleotide sequence of the L2 is shown as SEQ ID NO.6, the nucleotide sequence of the L3 is shown as SEQ ID NO.7, and the nucleotide sequence of the L4 is shown as SEQ ID NO. 8.
4. The construction method according to claim 2 or 3, further comprising verifying the obtained recombinant strain JSU01 Δ gndL after knocking out the structural gene of gluconate dehydrogenase in the basic strain.
5. The construction method according to claim 4, wherein the verification is performed by performing PCR verification by using genomic DNA of the recombinant strain JSU01 Δ gndL as a template and L1 and L4 as primers.
6. The method of constructing according to claim 2, wherein the primers used for knocking out the 2-ketogluconate dehydrogenase gene 2kgdH in the base strain include H1, H2, H3 and H4; the nucleotide sequence of H1 is shown as SEQ ID NO.9, the nucleotide sequence of H2 is shown as SEQ ID NO.10, the nucleotide sequence of H3 is shown as SEQ ID NO.11, and the nucleotide sequence of H4 is shown as SEQ ID NO. 12.
7. The construction method according to claim 2 or 6, further comprising verifying the obtained recombinant strain JSU01 Δ gndL Δ 2kgdH after knocking out the structural gene of gluconate dehydrogenase in the basic strain.
8. The construction method according to claim 7, wherein the verification is performed by performing PCR verification by using genomic DNA of the recombinant strain JSU01 Δ gndL Δ 2kgdH as a template and H1 and H4 as primers.
9. Use of the recombinant Pseudomonas proteorum of claim 1 for the fermentative production of gluconic acid.
10. Use according to claim 9, wherein the fermentation medium used in the fermentative production of gluconic acid comprises: 140.0g/L starch hydrolysis sugar, 1.0g/L urea and 40.0g/L light CaCO3(ii) a Said fermentation productionThe conditions of (a) include: the stirring speed is 430r/min, the temperature is 33 ℃, the tank pressure is 0.02MPa, and the air flow is 42.0L/min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911365330.XA CN110964686B (en) | 2019-12-26 | 2019-12-26 | Recombinant pseudomonas proteus and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911365330.XA CN110964686B (en) | 2019-12-26 | 2019-12-26 | Recombinant pseudomonas proteus and construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110964686A true CN110964686A (en) | 2020-04-07 |
| CN110964686B CN110964686B (en) | 2021-11-12 |
Family
ID=70036722
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911365330.XA Active CN110964686B (en) | 2019-12-26 | 2019-12-26 | Recombinant pseudomonas proteus and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110964686B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112625996A (en) * | 2021-02-04 | 2021-04-09 | 集美大学 | Pseudomonas proteorum znuA gene stable silencing strain and application thereof |
| CN112662608A (en) * | 2021-02-04 | 2021-04-16 | 集美大学 | Pseudomonas proteorexabB gene stable silencing strain and application thereof |
| CN113637622A (en) * | 2021-08-20 | 2021-11-12 | 江苏大学 | Pseudomonas proteorns 2-ketogluconate epimerase deletion mutant strain and construction method and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070231870A1 (en) * | 2006-03-31 | 2007-10-04 | Fundacion Instituto De Estudios Avanzados (Idea) | Process for the upgrading of heavy crude oil, extra-heavy crude oil or bitumens through the addition of a biocatalyst |
| RU2644206C1 (en) * | 2017-07-14 | 2018-02-08 | Федеральное государственное бюджетное учреждение науки Уфимский Институт биологии Российской академии наук (УИБ РАН) | Pseudomonas plecoglossicida bacteria strain, providing biodegradation of perfluoroctanesulfonic acid |
| CN109825464A (en) * | 2019-01-17 | 2019-05-31 | 浙江海洋大学 | The sweetfish pseudomonad fish that kills for knocking out T6SS-1 gene cluster uses attenuated vaccine |
| CN110591979A (en) * | 2019-10-22 | 2019-12-20 | 陕西省微生物研究所 | Compound microbial inoculant for degrading pesticide omethoate and preparation method thereof |
-
2019
- 2019-12-26 CN CN201911365330.XA patent/CN110964686B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070231870A1 (en) * | 2006-03-31 | 2007-10-04 | Fundacion Instituto De Estudios Avanzados (Idea) | Process for the upgrading of heavy crude oil, extra-heavy crude oil or bitumens through the addition of a biocatalyst |
| RU2644206C1 (en) * | 2017-07-14 | 2018-02-08 | Федеральное государственное бюджетное учреждение науки Уфимский Институт биологии Российской академии наук (УИБ РАН) | Pseudomonas plecoglossicida bacteria strain, providing biodegradation of perfluoroctanesulfonic acid |
| CN109825464A (en) * | 2019-01-17 | 2019-05-31 | 浙江海洋大学 | The sweetfish pseudomonad fish that kills for knocking out T6SS-1 gene cluster uses attenuated vaccine |
| CN110591979A (en) * | 2019-10-22 | 2019-12-20 | 陕西省微生物研究所 | Compound microbial inoculant for degrading pesticide omethoate and preparation method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 宋玉玲: "变形假单胞菌葡萄糖酸脱氢酶操纵子的克隆与分析", 《食品科技》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112625996A (en) * | 2021-02-04 | 2021-04-09 | 集美大学 | Pseudomonas proteorum znuA gene stable silencing strain and application thereof |
| CN112662608A (en) * | 2021-02-04 | 2021-04-16 | 集美大学 | Pseudomonas proteorexabB gene stable silencing strain and application thereof |
| CN112662608B (en) * | 2021-02-04 | 2022-06-10 | 集美大学 | Pseudomonas proteorexabB gene stable silencing strain and application thereof |
| CN112625996B (en) * | 2021-02-04 | 2022-06-10 | 集美大学 | Pseudomonas proteorum znuA gene stable silencing strain and application thereof |
| CN113637622A (en) * | 2021-08-20 | 2021-11-12 | 江苏大学 | Pseudomonas proteorns 2-ketogluconate epimerase deletion mutant strain and construction method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110964686B (en) | 2021-11-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110964686B (en) | Recombinant pseudomonas proteus and construction method and application thereof | |
| CN110066777B (en) | Endo-inulase and application thereof in production of fructo-oligosaccharide | |
| CN107012130A (en) | A kind of glucose oxidase mutant and its encoding gene and application | |
| JP2009529905A (en) | Enhancement of ethanol production by microorganisms | |
| WO2022228505A1 (en) | D-amino acid oxidase mutant and application thereof in preparing l-glufosinate | |
| WO2023236638A1 (en) | Thermal stability-improved glucose oxidase goxm10 mutant e361p, derivative mutant thereof, and use thereof | |
| CN107189991A (en) | A kind of glucose oxidase mutant and its encoding gene and application | |
| CN111748535B (en) | Alanine dehydrogenase mutant and application thereof in fermentation production of L-alanine | |
| CN112779203B (en) | Genetically engineered bacterium for high yield of L-cysteine and construction and application thereof | |
| CN113564090A (en) | Construction method and application of recombinant strain for producing tetrahydropyrimidine | |
| CN107299074B (en) | Construction method and application of formate dehydrogenase engineering strain | |
| CN113061563B (en) | Method for synthesizing L-malic acid by utilizing recombinant escherichia coli whole cell catalysis | |
| CN114045293B (en) | Gene Aokap1 for improving kojic acid yield of aspergillus oryzae, method and application | |
| JP4927297B2 (en) | Method for producing ethanol using recombinant coryneform bacteria | |
| CN105969751B (en) | Beta-glucosidase gene and application thereof | |
| JP4294373B2 (en) | New production method of ethanol | |
| CN108410903A (en) | The endo-xylanase and its encoding gene of a kind of resistance to low ph value and application | |
| WO2005123921A1 (en) | Novel glycerol dehydrogenase, gene therefor, and method of utilizing the same | |
| WO2003078635A1 (en) | Gene participating in acetic acid tolerance, acetic acid bacterium bred using the gene, and process for producing vinegar with the use of the acetic acid bacterium | |
| CN112877305B (en) | Glucose dehydrogenase mutant with improved coenzyme affinity | |
| CN114149955B (en) | Genetically engineered bacterium for efficiently producing glycerol and construction method and application thereof | |
| AU2021100409A4 (en) | Recombinant low-temperature catalase, recombinant vector and engineered strain thereof | |
| CN104894048B (en) | A kind of method for improving Clostridium beijerinckii forulic acid resistance | |
| CN110713940B (en) | High-yield heavy oil aureobasidium pullulans strain and construction method and application thereof | |
| CN116179516B (en) | alpha-L-arabinofuranosidase and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |