CN112695126A - Application of miR-210-5p in diagnosis/treatment of cardiac fibrosis caused by high salt - Google Patents
Application of miR-210-5p in diagnosis/treatment of cardiac fibrosis caused by high salt Download PDFInfo
- Publication number
- CN112695126A CN112695126A CN202110134855.3A CN202110134855A CN112695126A CN 112695126 A CN112695126 A CN 112695126A CN 202110134855 A CN202110134855 A CN 202110134855A CN 112695126 A CN112695126 A CN 112695126A
- Authority
- CN
- China
- Prior art keywords
- mir
- salt
- rna
- cardiac fibrosis
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The invention discloses application of micro RNA as a marker of cardiac fibrosis diseases caused by high salt, and provides application of the micro RNA as a therapeutic target in preparation or screening of drugs of the cardiac fibrosis diseases caused by high salt. The invention proves that the increase of miR-210-5p expression level can improve in-vitro myocardial fibrosis injury caused by high salt. The low expression of miR-210-5p is associated with the occurrence of high-salt induced cardiac fibrosis and is likely to be a molecular target for treating the disease.
Description
Technical Field
The invention belongs to the field of genetic engineering, and particularly relates to application of micro RNA-miR-210-5p in diagnosis/treatment of heart fibrosis diseases caused by high salt.
Background
About 300 million people die of cardiovascular diseases each year in China, accounting for 40% of all death reasons. Many current salt-hypertension-related data indicate that salt intake is normal to blood pressure elevation. INTERSALT the last study demonstrated for the first time that sodium salt intake was the most important factor in determining blood pressure levels in large sample size, multi-population. It is emphasized that different individuals exhibit different blood pressure responses to salt load or reduced salt intake, i.e. there is a so-called salt sensitivity problem.
However, the mechanism by which high salt promotes the progression of cardiovascular disease is not completely understood, and the results of several prospective cohort studies and retrospective studies in recent years have shown that excessive sodium intake (>4.6 g/day) can lead to an increased incidence of cardiovascular events in individuals with both age and ethnicity, including interstitial fibrosis, cardiac hypertrophy, and even heart failure, suggesting that a high-salt diet that is not blood pressure dependent is an independent risk factor for cardiovascular morbidity. Through cell functional experiments, the high-salt can induce rat primary heart fibroblast to be fibrotic; animal experimental results demonstrated that a high salt diet, independent of blood pressure changes, caused an increase in the level of heart fibrosis in rats. Although salt-limiting measures are very important for preventing myocardial hypertrophy, the effect is not obvious because of low compliance. Therefore, it is important to elucidate the molecular mechanism of myocardial damage caused by high-salt diet.
In addition to common molecular mechanisms such as water-sodium retention and RAS (renin-angiotensin) system activation, micro rnas (mirnas) have been recently discovered to play an important regulatory role in regulating cardiovascular repair functions. As an important regulator of gene networks, it causes degradation of target mrnas or inhibits their translation by specific binding to the 3' UTR of target gene mrnas, and forms a complex regulatory loop together with transcription factors and histone modification factors, thereby regulating gene expression at the post-transcriptional level through various biological pathways.
Myocardial fibrosis usually occurs in the process of reconstructing pathological myocardium such as myocardial hypertrophy, and is accompanied with proliferation of myocardial fibroblasts and excessive deposition of extracellular matrix among muscle fibers, so that normal structures of the myocardium are damaged, the compliance of the myocardium is reduced, and further cardiac contraction and relaxation dysfunction is caused.
Disclosure of Invention
The invention aims to provide application of micro RNA-miR-210-5p as a cardiac fibrosis disease marker caused by high salt. And provides application of the RNA-miR-210-5p as a therapeutic target in preparation or screening of a medicament for treating the cardiac fibrosis disease caused by high salt.
In order to achieve the purpose, the invention adopts the following technical scheme:
application of RNA-miR-210-5p in preparation of high-salt-induced cardiac fibrosis diagnostic reagent.
Application of RNA-miR-210-5p in preparation of high-salt-induced cardiac fibrosis target drugs.
The application of the RNA-miR-210-5p as a treatment target in preparing a high-salt-induced cardiac fibrosis target drug.
Application of the composition for promoting RNA-miR-210-5p in preparation of high-salt-induced cardiac fibrosis treatment target drugs.
Nucleotide sequences of RNA-miR-210-5p such as Seq ID NO: 1 is shown.
A high-salt induced cardiac fibrosis diagnosis kit is used for detecting the content of RNA-miR-210-5p, wherein the nucleotide sequence of the RNA-miR-210-5p is shown as Seq ID NO: 1 is shown.
SEQ ID NO:1：
CCGGGGCAGUCCCUCCAGGCUCAGGACAGCCACUGCCCACAGCACACUGCGUUGCUCCGGACCCACUGUGCGUGUGACAG CGGCUGAUCUGUCCCUGGGCAGCGCGAACC
In order to further discuss the mechanism of cardiac fibrosis caused by high salt, RT-PCR is utilized to find that the expression level of miR-210-5p in NRCFs induced by high salt is obviously reduced compared with that of a normal control group. Therefore, we designed gain-of-function experiments on NRCFs. By detecting the cell fibrosis level after miR-210-5p agonist (agomir) transfection, the fact that the increase of miR-210-5p expression level can improve high-salt induced myocardial fibrosis injury in vitro is proved. The low expression of miR-210-5p is associated with the occurrence of high-salt induced cardiac fibrosis and is likely to be a molecular target for treating the disease. According to the knowledge, no method for preventing and treating related diseases by using miR-210-5p as a target point exists in the market at present, so that the method has important clinical significance.
Drawings
FIG. 1 is a graph showing the results of blood pressure after 8 weeks of High Salt (HSD)/normal (CD) diet in example 1, and rats fed with high salt were classified into Hypertension (hyper, SBP ≧ 150mmHg), hypertensive tendency (hyper-pro, 130mmHg < SBP <150mmHg), and hypertensive resistance (hyper-resistance, SBP < 130mmHg) groups (CD: control set; HR: hyper-resistance; HP: hyper-pro; HTN: hyper-tension) according to the difference in blood pressure.
FIG. 2 is a graph showing Masson staining results, RT-PCR results and western blot results of heart fibers of rats raised with high salt in example 1, and showing that the fibrosis of the heart of the rats is increased independently of blood pressure, i.e., the fibrosis is increased regardless of the blood pressure (CD: control jet; HR: Hypertension resistance; HP: Hypertension-bone; HTN: Hypertension).
FIG. 3 is a graph of RT-PCR results and western blot results of rat cardiac fibroblasts cultured in high salt of example 2, showing a significant increase in fibrosis of rat cardiac fibroblasts (NRCFs) (Collagen I, α -SMA and TGF- β are markers of fibrosis).
FIG. 4 is a graph showing the results of RT-PCR of rat cardiac fibers cultured in high-salt culture in example 3, wherein the expression level of miR-210-5p in NRCFs cultured in high-salt culture is significantly reduced compared with that in the control group.
FIG. 5 is a graph showing the results of RT-PCR of rat cardiac fibers cultured in high-salt in example 4, wherein miR-210-5p is upregulated by agomir of miR-210-5p, so that high-salt induced fibrosis of NRCFs can be improved.
Detailed Description
In order to make the technical solutions better understood by those skilled in the art, the technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application, and it is obvious that the described embodiments are only partial embodiments of the present application, but not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present application.
It should be noted that the terms "comprises" and "comprising," and any variations thereof, in the description and claims of this application and the above-described drawings, are intended to cover a non-exclusive inclusion, such that a process, method, system, article, or apparatus that comprises a list of steps or elements is not necessarily limited to those steps or elements expressly listed, but may include other steps or elements not expressly listed or inherent to such process, method, article, or apparatus.
General description:
the experimental procedures for specifying conditions in the examples were carried out essentially according to the conditions and methods described in molecular cloning instructions (3 rd edition), molecular cloning, handbook of experiments, scientific Press 2002.8, written by Sambrook, J et al, or according to the conditions and methods suggested by the supplier of the materials, other techniques not described in detail corresponding to standard procedures well known to those skilled in the art.
The material of the invention: the cell lines, agomir and culture medium mentioned in this application are commercially available or otherwise publicly available, and are by way of example only and not exclusive to the present invention, and may be replaced by other suitable means and biological materials, respectively.
Example 1: detecting the change of the blood pressure of the SD rat after the induction of the high-salt diet.
After the SD rats of 160-180 g were randomly grouped, they were fed with high salt diet (HSD, 8% NaCl, Research Diets Inc., NJ, USA) and normal diet (CD, 0.4% NaCl) for 8 weeks, respectively, blood pressure was identified weekly by rat tail vein non-invasive sphygmomanometer (Kent Scientific Corporation, CT, USA), and the degree of heart injury of the rats was examined by pathological staining, Western Blot (WB) and real time-polymerase chain reaction (RT-PCR).
The heart was sonicated and weighed, sacrificed using carbon dioxide asphyxiation, and the material was taken immediately.
When the material was taken, the heart was collected, immediately immersed in ice-cold (4 ℃) 0.9% NaCl, and then subjected to morphological analysis. Left ventricular tissue biopsy samples were obtained and immediately snap frozen in liquid nitrogen and stored at-80 ℃ for subsequent analysis.
Mice were randomly selected for cardiac histopathology experiments. Cardiac tissue was fixed in formalin buffer for at least one week, and the fixed cardiac sections were then transferred to 70% EtOH for subsequent paraffin embedding and cut into 5 μm sections. Cardiac fibrosis was quantitatively analyzed using Hematoxylin and Eosin (HE) staining in combination with sirius red staining.
Mice were randomly selected for molecular biology experiments (western blot and RT-PCR) on cardiac tissue. Selecting the same parts from the cryopreserved heart samples, extracting tissue protein and RNA, and analyzing the degree of heart fibrosis.
Masson staining:
to quantify the fibrotic area, showing how much collagen fibers and inflammatory factors in the tissue, brightfield images of Masson stained sections were captured at 40-fold magnification using a nikon camera, and positive areas in 5 fields/section were quantified using ImageJ software.
western blot：
30mg of the heart tissue after homogenization was lysed using lysine buffer to which phosphatase inhibitor and protease inhibitor were added, and the protein concentration was determined by the bicinchoninic acid (BCA) method. After SDS-PAGE electrophoresis, model conversion and sealing, primary antibody and secondary antibody are incubated in sequence. And finally, exposing in a gel electrophoresis imaging system by using ECL developing solution, quantifying protein expression quantity by using ImageJ software after exposure, and comparing the tissue protein expression quantity of different groups with that of a normal control group respectively, wherein the internal reference is GAPDH. At the end, statistical analysis was performed using a Bonferroni multiple comparison test by Prism software 4. P values <0.05 were considered statistically significant.
RT-PCR：
Total RNA was extracted from the homogenized heart samples using Trizol method, followed by
RT-PCR kit carries out reverse transcription reaction of 0.5 mu gRNA.The reaction was carried out at 37 ℃ for 45 minutes and then at 85 ℃ for 5 seconds. mu.L of cDNA obtained by reverse transcription reaction was diluted with 400. mu.L of dH20 and used
Master Mix was used for RT-PCR. And (3) setting three multiple holes for each PCR reaction, after the amplification is finished, analyzing the dissolution curve of the product, calculating the quantity of the PCR product by using a 2-delta Ct equation, and comparing the expression quantity of mRNA of different groups of tissues with a normal control group respectively, wherein the internal reference is GAPDH. At the end, statistical analysis was performed using a Bonferroni multiple comparison test with Prism software. P value<Statistical significance was considered at 0.05.
The Tritol method specifically comprises the following steps: grinding 0.1g tissue with liquid nitrogen to obtain powder or grinding 1 × 107～5×107The cells were discarded from the medium and rinsed 2 times with pre-cooled PBS. Adding 1mL of Trizol lysate, blowing and uniformly mixing by using an enzyme-free gun head, standing for 5min, and transferring the lysate into a pre-marked centrifuge tube with the volume of 1.5mL without enzyme. Centrifuging at 7500g for 5min at 4 deg.C, collecting supernatant, adding 1/5 volumes of chloroform, mixing by inversion for 30s, and standing for 2 min. Centrifuge at 12000g for 15min at 4 ℃. The solution was divided into three layers (aqueous phase-white precipitate-red organics) and the aqueous layer was transferred to a new 1.5mL centrifuge tube, minimizing the uptake of the white precipitate. Adding equal volume of isopropanol, slightly reversing, mixing, and standing for 5-10 min. Centrifuge at 12000g for 10min at 4 ℃. The supernatant was aspirated off, 1mL of 75% ethanol (Ready) was added, and the RNA pellet was washed. Centrifuge at 7500g for 5min at 4 deg.C, and discard the supernatant. Removing 75% of alcohol as much as possible, and air drying at room temperature for about 15 min. The RNA pellet was dissolved in RNase-free water (20-25. mu.l).
The concentration of RNA was determined by the UV absorbance assay described above. RNA concentration and purity were determined using an ultraviolet spectrophotometer, with the RNA dissolved DEPC water being zeroed prior to measurement. The reading value at 260nm is 1, which represents 40 ng/. mu.L, the ratio of A260/A280 of the RNA solution is used for detecting the purity of the RNA, and the ratio ranges from 1.8 to 2.1, which indicates that the requirements are met.
Blood pressure results:
rats fed with high salt were classified into Hypertension (hyper, SBP ≧ 150mmHg), Hypertension-prone (hyper-prone, 130mmHg < SBP <150mmHg), and Hypertension-resistant (hyper-resistant, SBP < 130mmHg) groups according to the difference in blood pressure. Among them, 72 were hypertensive groups, 18 were hypertensive tendency groups, and 25 were hypertensive resistant groups (fig. 1).
Masson staining results:
as shown in fig. 2A, the percentage of the fibrotic regions (positive regions) increased significantly in cardiomyocytes from Masson-stained cardiac sections in each group compared to CD (P <0.05,. P <0.01,. P < 0.001).
RT-PCR results:
mRNA expression of Collagen I, alpha-SMA and TGF-beta
As shown in fig. 2B, mRNA expression levels of Collagen I, α -SMA and TGF- β were significantly up-regulated in each group compared to the CD group (P <0.05, P <0.01, P < 0.001).
western blot results:
protein expression of Collagen I, alpha-SMA and TGF-beta
As shown in fig. 2C, the levels of protein expression of Collagen I, α -SMA and TGF- β were significantly up-regulated in each group compared to the CD group (P <0.05, P <0.01, P < 0.001).
To summarize example 1:
blood pressure measurements, histomorphometry and molecular biology results show that high salt diets can cause fibrotic damage to the rat heart independent of blood pressure levels.
Example 2: detecting the fibrosis level of NRCFs after high salt induction.
This example isolated cultures NRCDs in vitro.
SD rats of 1-3 days of age were used in this example. After the material of the suckling mouse is taken, the obtained heart is put into 1 XPBS (pH7.4) containing 1% P/S, the atrium is cut off, and the heart is repeatedly washed until the ventricle has no bloodstain and the washing liquid is clear. Shearing ventricular muscle to 1mm with ophthalmic scissors3Adding 15mL of digestive juice into the tissue blocks with different sizes, digesting the tissue blocks for 5min in a shaking table at 37 ℃, absorbing the upper suspension and abandoning the tissue blocks. Adding 20mL of digestive juice into the remaining tissue, and digesting for 15min at 37 ℃ by a shaking table; sucking the upper suspension and stopping the reaction; the remaining precipitateThen adding digestive juice to digest for 3-5 times until the tissue blocks are completely digested. And collecting the digestion solution after termination in a centrifuge tube at 1200rpm, centrifuging for 5min, discarding the supernatant, and adding a culture solution for resuspension. After differential adherence for 2h, the non-adherent cells were discarded. When the cells were fully passaged, the cells were counted and the cell density was adjusted to 5X 105one/mL, inoculated into a petri dish.
Preferably, the cell digestive juice comprises 10mL of 10 × ADS solution, 90mL of PBS, 60mg of collagenase II and 40mg of pancreatin per 100 mL.
The above-mentioned 10 × ADS solution contains 1.38g of Na per 1 liter2HPO4,2.05g MgSO4.7H2O,4g of KCl,6g of glucose, 47.6g of HEPES and 68g of NaCl, and adjusting the pH value to 7.35-7.45.
In this example, NRCFs were induced for 24 hours using different concentrations of NaCl (25mM/50mM/100 mM).
western blot：
30mg of the heart tissue after homogenization was lysed using lysine buffer to which phosphatase inhibitor and protease inhibitor were added, and the protein concentration was determined by the bicinchoninic acid (BCA) method. After SDS-PAGE electrophoresis, model conversion and sealing, primary antibody and secondary antibody are incubated in sequence. And finally, exposing in a gel electrophoresis imaging system by using ECL developing solution, quantifying protein expression quantity by using ImageJ software after exposure, and comparing the tissue protein expression quantity of different groups with that of a normal control group respectively, wherein the internal reference is GAPDH. At the end, statistical analysis was performed using a Bonferroni multiple comparison test by Prism software 4. P values <0.05 were considered statistically significant.
RT-PCR：
Total RNA was extracted from the homogenized heart samples using Trizol method, followed by
RT-PCR kit carries out reverse transcription reaction of 0.5 mu gRNA. The reaction was carried out at 37 ℃ for 45 minutes and then at 85 ℃ for 5 seconds. mu.L of cDNA obtained by reverse transcription reaction was diluted with 400. mu.L of dH20 and used
Master Mix was used for RT-PCR. And (3) setting three multiple holes for each PCR reaction, after the amplification is finished, analyzing the dissolution curve of the product, calculating the quantity of the PCR product by using a 2-delta Ct equation, and comparing the expression quantity of mRNA of different groups of tissues with a normal control group respectively, wherein the internal reference is GAPDH. At the end, statistical analysis was performed using a Bonferroni multiple comparison test by Prism software 4. P value<Statistical significance was considered at 0.05. RNA extraction and quantitative PCR analysis:
total RNA was isolated using Trizol reagent according to the instructions for use of the reagent. Reverse transcription was performed using TaKaRa Prime Script kit (TaKaRa, Dalian, China). The reverse transcription kit reverse-transcribes 1. mu.g of total RNA to a final volume of 20. mu.l. And (4) analyzing results: analyzing the specificity and the amplification efficiency of the primer, and judging the reaction specificity of the primer according to the dissolution curve. And (5) obtaining a Ct value according to the amplification curve, and analyzing the relative expression quantity of the target gene by adopting a relative quantity method and an internal reference GAPDH. The calculation formula is as follows: 2^ (-. DELTA.Ct), and [ Delta ] Ct is Ct gene-Ct control.
RT-PCR results:
mRNA expression of Collagen I, alpha-SMA and TGF-beta
As shown in fig. 3, mRNA expression levels of Collagen I, α -SMA and TGF- β were significantly up-regulated dose-dependently in each group compared to the PBS group ([ P <0.05, [ P <0.01, [ P <0.001 ]).
western blot results
Protein expression of Collagen I, alpha-SMA and TGF-beta
As shown in fig. 3, the protein expression levels of Collagen I, α -SMA and TGF- β were significantly up-regulated dose-dependently in each group compared to the PBS group ([ P ] 0.05, [ P ] 0.01, [ P ] 0.001).
To summarize example 2:
molecular biological results show that high salt energy induces NRCFs fibrosis dose-dependently.
Example 3: change of expression of miR-210-5p in NRCFs before and after high salt induction.
In this example, NRCFs were isolated and cultured in vitro, and the expression of miR-210-5p in the NRCFs before and after high-salt induction was detected by RT-PCR.
In this example, SD rats aged 1 to 3 days were selected. After the material of the suckling mouse is taken, the obtained heart is put into 1 XPBS (pH7.4) containing 1% P/S, the atrium is cut off, and the heart is repeatedly washed until the ventricle has no bloodstain and the washing liquid is clear. Shearing ventricular muscle to 1mm with ophthalmic scissors3Adding 15mL of digestive juice into the tissue blocks with different sizes, digesting the tissue blocks for 5min in a shaking table at 37 ℃, absorbing the upper suspension and abandoning the tissue blocks. Adding 20mL of digestive juice into the remaining tissue, and digesting for 15min at 37 ℃ by a shaking table; sucking the upper suspension and stopping the reaction; and adding digestive juice into the residual precipitate for digesting for 3-5 times until the tissue mass is completely digested. And collecting the digestion solution after termination in a centrifuge tube at 1200rpm, centrifuging for 5min, discarding the supernatant, and adding a culture solution for resuspension. After differential adherence for 2h, the non-adherent cells were discarded. When the cells were fully passaged, the cells were counted and the cell density was adjusted to 5X 105one/mL, inoculated into a petri dish.
The above-mentioned cell digest solution contained 10mL of 10 × ADS solution, 90mL of PBS, 60mg of collagenase II and 40mg of pancreatin per 100 mL.
The above-mentioned 10 × ADS solution contains 1.38g of Na per 1 liter2HPO4,2.05g MgSO4.7H2O,4g of KCl,6g of glucose, 47.6g of HEPES and 68g of NaCl, and adjusting the pH value to 7.35-7.45.
In this example, NRCFs were induced for 24 hours using different concentrations of NaCl (25mM/50mM/100 mM).
RT-PCR：
Total RNA was extracted from the homogenized heart samples using Trizol method, followed by
RT-PCR kit carries out reverse transcription reaction of 0.5 mu gRNA. The reaction was carried out at 37 ℃ for 45 minutes and then at 85 ℃ for 5 seconds. mu.L of cDNA obtained by reverse transcription reaction was diluted with 400. mu.L of dH20 and used
Master Mix was used for RT-PCR. Each PCR reaction is provided with three multiple holes, and after amplification is finished, the dissolution curve of the product is analyzed, and then the 2-delta Ct equation is usedCalculating the amount of PCR product, comparing the expression amount of mRNA of different groups of tissues with that of a normal control group, wherein the internal reference is GAPDH. At the end, statistical analysis was performed using a Bonferroni multiple comparison test by Prism software 4. P value<Statistical significance was considered at 0.05.
RNA extraction and quantitative PCR analysis:
total RNA was isolated using Trizol reagent according to the instructions for use of the reagent. Reverse transcription was performed using TaKaRa Prime Script kit (TaKaRa, Dalian, China). The reverse transcription kit reverse-transcribes 1. mu.g of total RNA to a final volume of 20. mu.l. And (4) analyzing results: analyzing the specificity and the amplification efficiency of the primer, and judging the reaction specificity of the primer according to the dissolution curve. And (5) obtaining a Ct value according to the amplification curve, and analyzing the relative expression quantity of the target gene by adopting a relative quantity method and an internal reference GAPDH. The calculation formula is as follows: 2^ (-. DELTA.Ct), and [ Delta ] Ct is Ct gene-Ct control.
RT-PCR results:
after high-salt induction, the expression level of miR-210-5p in NRCFs is obviously reduced compared with that of a control group (figure 4).
To summarize example 3:
the molecular biological result shows that the expression of miR-210-5p in NRCFs can be reduced through high-salt induction.
Example 4: role of miR-210-5p in high-salt-induced fibrosis of NRCFs.
This example isolated cultures NRCFs in vitro, transfected with miR-210-5p agomir or a control agent, prior to high-salt induction.
Cell transfection
All reagents used for transfection include miR-210-5p agomir, et al, available from Ruibo, Guangzhou. NRCFs cells were plated at 2X 10 per well5Planting the cells on a 6-hole culture plate, and after the cells adhere to the wall, discarding the original culture medium 12h before transfection, and replacing the original culture medium with a double-antibody-free culture medium; diluting 10 μ L liposome in 250 μ L OPTI-MEM, gently pumping, mixing, and incubating at room temperature for 5 min; respectively diluting 100pmol of agomir in 250 mu L of OPTI-MEM, uniformly mixing by blowing, and incubating for 5min at room temperature; mixing the incubated diluents, gently whipping and uniformly mixing, and continuously incubating for 20min at room temperature; uniformly dripping the mixture into the containerAdding 1.5mL OPTI-MEM into 6-well culture plate, mixing, and further placing at 37 deg.C with 5% CO2Culturing in a cell culture box; culturing for 6 hr, discarding the OPTI-MEM culture medium, replacing with complete culture medium, and continuously placing at 37 deg.C under 5% CO2Culturing in a cell culture box; collecting cells and extracting total RNA or protein 24-48 h after transfection to carry out RT-PCR detection or western blot analysis.
The nucleotide sequence of the miR-210-5p mature body is shown in SEQ ID NO.2,
miR-210-5p(SEQ ID NO：2)：5'AGCCACUGCCCACAGCACACUG 3'。
the nucleotide sequence of the miR-210-5p agomir is shown as SEQ ID NO.3,
miR-210-5p agomir(SEQ ID NO：3)：5’CAGUGUGCUGUGGGCAGUGGC 3’。
in this example, SD rats aged 1 to 3 days were selected.
After the material of the suckling mouse is taken, the obtained heart is put into 1 XPBS (pH7.4) containing 1% P/S, the atrium is cut off, and the heart is repeatedly washed until the ventricle has no bloodstain and the washing liquid is clear. Shearing ventricular muscle to 1mm with ophthalmic scissors3Adding 15mL of digestive juice into the tissue blocks with different sizes, digesting the tissue blocks for 5min in a shaking table at 37 ℃, absorbing the upper suspension and abandoning the tissue blocks. Adding 20mL of digestive juice into the remaining tissue, and digesting for 15min at 37 ℃ by a shaking table; sucking the upper suspension and stopping the reaction; and adding digestive juice into the residual precipitate for digesting for 3-5 times until the tissue mass is completely digested. And collecting the digestion solution after termination in a centrifuge tube at 1200rpm, centrifuging for 5min, discarding the supernatant, and adding a culture solution for resuspension. After differential adherence for 2h, the non-adherent cells were discarded. When the cells were fully passaged, the cells were counted and the cell density was adjusted to 5X 105one/mL, inoculated into a petri dish.
The above-mentioned cell digest solution contained 10mL of 10 × ADS solution, 90mL of PBS, 60mg of collagenase II and 40mg of pancreatin per 100 mL.
The above-mentioned 10 × ADS solution contains 1.38g of Na per 1 liter2HPO4,2.05g MgSO4.7H2O,4g of KCl,6g of glucose, 47.6g of HEPES and 68g of NaCl, and adjusting the pH value to 7.35-7.45.
In this example, NRCFs were induced for 24 hours using different concentrations of NaCl (25mM/50mM/100 mM).
RT-PCR：
Total RNA was extracted from the homogenized heart samples using Trizol method, followed by
PrimeScriptTM RT-PCR kit performed a reverse transcription reaction of 0.5. mu.gRNA. The reaction was carried out at 37 ℃ for 45 minutes and then at 85 ℃ for 5 seconds. mu.L of cDNA obtained by reverse transcription reaction was diluted with 400. mu.L of dH20 and used
Green Master Mix to perform RT-PCR. And (3) setting three multiple holes for each PCR reaction, after the amplification is finished, analyzing the dissolution curve of the product, calculating the quantity of the PCR product by using a 2-delta Ct equation, and comparing the expression quantity of mRNA of different groups of tissues with a normal control group respectively, wherein the internal reference is GAPDH. At the end, statistical analysis was performed using a Bonferroni multiple comparison test by Prism software 4. P value<Statistical significance was considered at 0.05.
RNA extraction and quantitative PCR analysis:
total RNA was isolated using Trizol reagent according to the instructions for use of the reagent. Reverse transcription was performed using TaKaRa Prime Script kit (TaKaRa, Dalian, China). The reverse transcription kit reverse-transcribes 1. mu.g of total RNA to a final volume of 20. mu.l. And (4) analyzing results: analyzing the specificity and the amplification efficiency of the primer, and judging the reaction specificity of the primer according to the dissolution curve. And (5) obtaining a Ct value according to the amplification curve, and analyzing the relative expression quantity of the target gene by adopting a relative quantity method and an internal reference GAPDH. The calculation formula is as follows: 2^ (-. DELTA.Ct), and [ Delta ] Ct is Ct gene-Ct control.
western blot：
30mg of the heart tissue after homogenization was lysed using lysine buffer to which phosphatase inhibitor and protease inhibitor were added, and the protein concentration was determined by the bicinchoninic acid (BCA) method. After SDS-PAGE electrophoresis, model conversion and sealing, primary antibody and secondary antibody are incubated in sequence. And finally, exposing in a gel electrophoresis imaging system by using ECL developing solution, quantifying protein expression quantity by using ImageJ software after exposure, and comparing the tissue protein expression quantity of different groups with that of a normal control group respectively, wherein the internal reference is GAPDH. At the end, statistical analysis was performed using a Bonferroni multiple comparison test by Prism software 4. P values <0.05 were considered statistically significant.
RT-PCR results:
mRNA expression of Collagen I, alpha-SMA and TGF-beta
As shown in FIG. 5, the mRNA expression levels of Collagen I, α -SMA and TGF- β were significantly up-regulated in the NaCl + NC agomir group compared to the PBS + NC agomir group. Compared to the NaCl + NC agomir group, mRNA expression levels of Collagen I, α -SMA and TGF- β were down-regulated in the NaCl + miR-210-5P agomir group (. P <0.05,. P <0.01,. P < 0.001).
western blot results:
protein expression of Collagen I, alpha-SMA and TGF-beta
As shown in FIG. 5, the protein expression levels of Collagen I, α -SMA and TGF- β were significantly up-regulated in the NaCl + NC agomir group compared to the PBS + NC agomir group. Compared to the NaCl + NC agomir group, the protein expression levels of Collagen I, α -SMA and TGF- β were down-regulated in the NaCl + miR-210-5P agomir group (. P <0.05,. P <0.01,. P < 0.001).
To summarize example 4:
the molecular biological result shows that the expression of miR-210-5p is up-regulated, so that the high-salt induced NRCFs fibrosis can be obviously improved.
In conclusion, the invention discovers for the first time that the micro RNA-miR-210-5p can be used as a target for predicting the occurrence of high-salt induced cardiac fibrosis injury and treating the disease.
It should be understood that the above-mentioned examples only represent several embodiments of the present invention, and therefore, the scope of the present invention should not be construed as being limited thereby, and the present invention should not be limited thereby. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
It is to be understood that this invention has been described by way of example only and that modifications may be made within the scope and spirit of the invention. The foregoing detailed description of the preferred embodiments of the invention has been presented. It should be understood that numerous modifications and variations could be devised by those skilled in the art in light of the present teachings without departing from the inventive concepts. Therefore, the technical solutions available to those skilled in the art through logic analysis, reasoning and limited experiments based on the prior art according to the concept of the present invention should be within the scope of protection defined by the claims.
Sequence listing
<110> Jiangsu province national hospital (the first subsidiary hospital of Nanjing medical university)
Application of <120> miR-210-5p in diagnosis/treatment of cardiac fibrosis caused by high salt
<141> 2021-01-27
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 110
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ccggggcagy cccyccaggc ycaggacagc cacygcccac agcacacygc gyygcyccgg 60
acccacygyg cgygygacag cggcygaycy gycccygggc agcgcgaacc 110
<210> 2
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
agccacygcc cacagcacac yg 22
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cagygygcyg ygggcagygg c 21
Claims (6)
- Application of RNA-miR-210-5p in preparation of high-salt-induced cardiac fibrosis diagnostic reagent.
- Application of RNA-miR-210-5p in preparation of high-salt-induced cardiac fibrosis target drugs.
- Application of RNA-miR-210-5p as a treatment target in preparation of high-salt-induced cardiac fibrosis target drugs.
- 4. Application of the composition for promoting RNA-miR-210-5p in preparation of high-salt-induced cardiac fibrosis treatment target drugs.
- 5. Use according to any one of claims 1 to 4, characterized in that: the nucleotide sequence of the RNA-miR-210-5p is shown as Seq ID NO: 1 is shown.
- 6. A diagnostic kit for high-salt induced cardiac fibrosis, comprising: the kit is used for detecting the content of RNA-miR-210-5p, and the nucleotide sequence of the RNA-miR-210-5p is shown as Seq ID NO: 1 is shown.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110134855.3A CN112695126B (en) | 2021-02-01 | 2021-02-01 | Application of miR-210-5p in diagnosis/treatment of cardiac fibrosis caused by high salt content |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110134855.3A CN112695126B (en) | 2021-02-01 | 2021-02-01 | Application of miR-210-5p in diagnosis/treatment of cardiac fibrosis caused by high salt content |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112695126A true CN112695126A (en) | 2021-04-23 |
| CN112695126B CN112695126B (en) | 2022-12-23 |
Family
ID=75516523
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110134855.3A Active CN112695126B (en) | 2021-02-01 | 2021-02-01 | Application of miR-210-5p in diagnosis/treatment of cardiac fibrosis caused by high salt content |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112695126B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113061661A (en) * | 2021-03-29 | 2021-07-02 | 中国人民解放军东部战区总医院 | Application of MiR-125a-5p in early development of embryo |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140228228A1 (en) * | 2004-05-28 | 2014-08-14 | Asuragen, Inc. | Methods and Compositions Involving MicroRNA |
-
2021
- 2021-02-01 CN CN202110134855.3A patent/CN112695126B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140228228A1 (en) * | 2004-05-28 | 2014-08-14 | Asuragen, Inc. | Methods and Compositions Involving MicroRNA |
Non-Patent Citations (2)
| Title |
|---|
| 曹润峰，等: "miRNA在心肌梗死中的作用及其机制研究进展", 《中华细胞与干细胞杂志(电子版)》 * |
| 李玲，等: "干细胞源外泌体在治疗心肌梗死中的作用机制研究进展", 《医学研究生学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113061661A (en) * | 2021-03-29 | 2021-07-02 | 中国人民解放军东部战区总医院 | Application of MiR-125a-5p in early development of embryo |
| CN113061661B (en) * | 2021-03-29 | 2023-02-17 | 中国人民解放军东部战区总医院 | Application of MiR-125a-5p in early development of embryo |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112695126B (en) | 2022-12-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | Exosomes derived from alveolar epithelial cells promote alveolar macrophage activation mediated by miR-92a-3p in sepsis-induced acute lung injury | |
| KR20160006673A (en) | Mirna biogenesis in exosomes for diagnosis and therapy | |
| JP2020096595A (en) | Cardiac stem cell, and method for identifying and using the cell | |
| EP2208798A1 (en) | MicroRNA (miRNA) for the diagnosis and treatment of heart diseases | |
| Gao et al. | Brain endothelial cell-derived exosomes induce neuroplasticity in rats with ischemia/reperfusion injury | |
| Li et al. | MiR-181a mediates Ang II-induced myocardial hypertrophy by mediating autophagy. | |
| WO2018024034A1 (en) | Circular rna circ-nfatc3 and application thereof | |
| CN110373416B (en) | Application of RBP1 gene in sow ovarian granulosa cells | |
| CN107519194B (en) | Applications of the miR-21 in the drug for the treatment of Asherman's syndrom and/or slim inner membrance is prepared | |
| CN109195637A (en) | For treating the pharmaceutical carrier comprising miRNA of the fibrotic disease as caused by hyperglycemia | |
| CN112695126B (en) | Application of miR-210-5p in diagnosis/treatment of cardiac fibrosis caused by high salt content | |
| Chen et al. | Cardiac-specific microRNA-125b deficiency induces perinatal death and cardiac hypertrophy | |
| US9499851B2 (en) | Wound healing metakaryotic stem cells and methods of use thereof | |
| CN111455056A (en) | lncRNA marker derived from adipose cell exosome and application and product thereof | |
| CN108660212B (en) | Application of WDR1 gene in preparation of non-small cell lung cancer treatment and detection products | |
| CN115645408A (en) | Drug for improving myocardial hypertrophy and cardiac fibrosis by targeting MrgD | |
| CN110643707B (en) | ESCC (persistent resonant cell) -related lncRNA LLNLR-299G3.1 and application thereof | |
| CN111202847B (en) | Application of PAX6 gene or its expression product in preparing medicine for inhibiting fibrosis | |
| CN111118007B (en) | Application of long non-coding RNA in preparation of medicine for treating cervical cancer | |
| CN105688227B (en) | Application of miR-127 in preparation of medicine for treating muscle diseases | |
| CN111154858B (en) | Long non-coding RNA and application thereof in diagnosis/treatment of preeclampsia | |
| CN114099546A (en) | Application of gene-modified human umbilical cord mesenchymal stem cell preparation in preparation of medicine for treating diabetic nephropathy | |
| CN106754908B (en) | Molecular target for preparing medicine for diagnosing and treating colon cancer and application thereof | |
| US20220354805A1 (en) | Cannabidiol (CBD) as Chemical for Treating Aging-related Degenerative Diseases and Promoting Health Aging | |
| CN104031987B (en) | MiRNA application in myocardial fibrosis disease treatment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |