CN112695051A - Genetically engineered bacterium for producing ethanol by using xylose and construction method and application thereof - Google Patents

Abstract

The invention relates to a construction method of a recombinant bacterium, which comprises the following steps of carrying out A1-A6 transformation on a receptor bacterium to obtain the recombinant bacterium; a1, knocking out a ribulose phosphate isomerase gene of the recipient bacterium; a2, knocking out the pyruvate oxidase gene of the recipient bacterium; a3, knocking out the acetate kinase gene of the recipient bacterium; a4, increasing the expression level of the protein coded by the xylulose lyase gene in the recipient bacterium; a5, increasing the expression level of protein coded by phosphotransacetylase in the recipient bacterium; a6, increasing the expression level of bifunctional acetaldehyde ethanol dehydrogenase gene encoding protein in the recipient strain; the recipient bacterium is a bacterium or fungus containing the ribulose phosphate isomerase gene, the pyruvate oxidase gene and the acetate kinase gene. The recombinant strain constructed by the invention can improve the efficiency of producing ethanol by using xylose.

Description

Genetically engineered bacterium for producing ethanol by using xylose and construction method and application thereof

Technical Field

The invention belongs to the fields of biotechnology, genetic engineering and fermentation engineering, relates to a genetic engineering bacterium for producing ethanol and a construction method and application thereof, and more particularly relates to a genetic engineering bacterium for producing ethanol by using xylose and a construction method and application thereof.

Background

Xylose (D-xylose) is the main constituent unit of xylan, is stored in large amounts in plants, and has the molecular formula C₅H₁₀O₅. Xylose is widespread and exists mainly in the form of aggregates. Lignocellulosic feedstocks, in which about 30% of the components are composed of xylose, are abundant and the second largest carbohydrate in nature after glucose. The content of xylose in the corncobs is high, and the process for preparing xylose by using the corncobs as the raw material is mature.

Most microorganisms in nature can metabolize glucose, but only a small fraction of them can metabolize xylose. Thus, the use of xylose in the fermentation industry is very limited compared to glucose. The development of metabolic pathways that efficiently utilize xylose will have a significant driving role in its industrial application. There are three major pathways of xylose metabolism that have been found in nature: (1) in microorganisms such as Escherichia coli, xylose is first converted to xylulose by xylose isomerase, and xylulose-5-phosphate is produced by xylulokinase, and is degraded by the pentose phosphate pathway. (2) In microorganisms such as yeast, xylose is firstly reduced into xylitol by xylose reductase, then is oxidized into xylulose by xylitol dehydrogenase, and then xylulokinase catalyzes to generate xylulose-5-phosphate which enters a pentose phosphate pathway for decomposition. (3) In the Bacillus crescentus, xylose is catalyzed by xylose dehydrogenase, xylonolactose and xylonate dehydratase to generate 2-keto-3-deoxy-xylonic acid, and alpha-ketoglutaric acid is formed through dehydration and dehydrogenation reactions and enters tricarboxylic acid cycle decomposition.

Xylose is used as a renewable biomass resource with huge storage capacity, microorganisms are modified by utilizing synthetic biology and metabolic engineering technology, so that the xylose is used as a carbon source to produce chemicals with high added value and wide application, and the method has extremely wide market prospect.

Disclosure of Invention

The invention aims to solve the technical problems of how to carry out high-efficiency metabolism of xylose to produce ethanol and provide a recombinant bacterium which can be used for producing ethanol by xylose metabolism.

In order to solve the technical problems, the invention provides a construction method of a recombinant bacterium capable of producing ethanol by using xylose.

The construction method of the recombinant bacterium provided by the invention comprises the following steps of carrying out A1-A7 transformation on a receptor bacterium to obtain the recombinant bacterium;

a1, knocking out ribulose phosphate isomerase gene of the recipient bacterium or inhibiting the expression of the ribulose phosphate isomerase gene or inhibiting the activity of the protein encoded by the ribulose phosphate isomerase gene;

a2, knocking out the pyruvate oxidase gene of the recipient bacterium or inhibiting the expression of the pyruvate oxidase gene or inhibiting the activity of a protein encoded by the pyruvate oxidase gene;

a3, knocking out the acetate kinase gene of the receptor bacterium or inhibiting the expression of the acetate kinase gene or inhibiting the activity of a protein encoded by the acetate kinase gene;

a4, increasing the expression level of a protein encoded by a xylulose lyase gene in the recipient bacterium or enhancing the activity of a protein encoded by a xylulose lyase gene;

a5, increasing the expression level of a protein encoded by phosphotransacetylase in the recipient bacterium or enhancing the activity of the protein encoded by phosphotransacetylase;

a6, increasing the expression level of the protein coded by the bifunctional acetaldehyde ethanol dehydrogenase gene in the recipient bacterium or enhancing the activity of the protein coded by the bifunctional acetaldehyde ethanol dehydrogenase gene;

the recipient bacterium is a bacterium or fungus containing the ribulose phosphate isomerase gene, the pyruvate oxidase gene and the acetate kinase gene.

Further, the recipient bacterium is escherichia coli.

Further, the recipient bacterium is Escherichia coli MG1655 or Escherichia coli JM 109.

In the above method, the ribulose phosphate isomerase gene may encode proteins of b1 and b 2:

b1, GenBank accession No.: NC _000913.3, Gene ID: 947896, or a pharmaceutically acceptable salt thereof;

b2, GenBank accession No.: NC _000913.3, Gene ID: 947896 by substitution and/or deletion and/or addition of one or several amino acid residues in the amino acid sequence coded by the protein with ribulose phosphate isomerase activity and derived from b 1).

In the above method, the pyruvate oxidase gene may encode proteins of c1 and c 2:

c1, by GenBank No.: NC _000913.3, Gene ID: 946132, or a pharmaceutically acceptable salt thereof;

c2, in GenBank accession No.: NC _000913.3, Gene ID: 946132 by substitution and/or deletion and/or addition of one or more amino acid residues in the amino acid sequence encoded by the protein with pyruvate oxidase activity and derived from c 1).

In the above method, the acetate kinase gene may encode proteins of d1 and d 2:

d1, by GenBank No.: NC _000913.3, Gene ID: 946775, or a pharmaceutically acceptable salt thereof;

d2, in GenBank accession No.: NC _000913.3, Gene ID: 946775 by substitution and/or deletion and/or addition of one or more amino acid residues in the amino acid sequence encoded by the protein with the activity of the acetate kinase and derived from d 1).

In the above method, the xylulose lyase gene may encode proteins of e1 and e 2:

e1, a protein consisting of the amino acid sequence shown in SEQ ID No. 7;

e2, a protein derived from e1) having xylulose lyase activity obtained by substitution and/or deletion and/or addition of one or several amino acid residues in the amino acid sequence shown in SEQ ID No. 7.

In the above method, the bifunctional acetaldehyde ethanol dehydrogenase gene may encode proteins of f1 and f 2:

f1, a protein consisting of the amino acid sequence shown in SEQ ID No. 8;

f2, and the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No.8 and is derived from f1) and has the activity of the bifunctional acetaldehyde ethanol dehydrogenase.

In the above method, the phosphotransacetylase gene may encode proteins of g1 and g 2:

g1, a protein consisting of the amino acid sequence shown in SEQ ID No. 9;

g2, protein with phosphotransacetylase activity obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No.9 and derived from g 1).

In the above method, the ribulose phosphate isomerase gene is rpe gene, and the nucleotide sequence thereof is as shown in GenBank No.: NC _000913.3, Gene ID: 947896 (update: 10-Oct-2019).

The pyruvate oxidase gene is poxB gene, and the nucleotide sequence of the gene is shown as GenBank number: NC _000913.3, Gene ID: 946132 (update: 10-Oct-2019).

The acetate kinase gene is ackA gene, and the nucleotide sequence of the acetate kinase gene is shown as GenBank number: NC _000913.3, Gene ID: 946775 (update: 10-Oct-2019).

The xylulose lyase gene is any one DNA molecule of e11-e 13:

e11) the coding sequence is cDNA or genome DNA of 70 th to 2458 th nucleotides of SEQ ID NO. 1;

e12) cDNA or genomic DNA hybridizing under stringent conditions to the DNA molecule defined in e11) and encoding said xylulose cleaving enzyme;

e13) a cDNA or genomic DNA having 90% identity to the DNA molecule defined in e11) or e12) and encoding said xylulose lyase;

the phosphotransacetylase is any one DNA molecule of f11-f 13:

f11) the coding sequence is cDNA or genome DNA of 70 th-2215 th nucleotide of SEQ ID NO. 2;

f12) cDNA or genomic DNA hybridizing under stringent conditions to the DNA molecule defined in f11) and encoding said phosphotransacetylase;

f13) a cDNA or genomic DNA having 90% identity to the DNA molecule defined in f11) or f12) and encoding the phosphotransacetylase;

the acetaldehyde ethanol dehydrogenase is any one DNA molecule of g11-g 13:

g11) the coding sequence is cDNA or genome DNA of 70 th-2746 th nucleotide of SEQ ID NO. 3;

g12) cDNA or genomic DNA which hybridizes under stringent conditions with the DNA molecule defined in g11) and codes for the acetaldehyde ethanol dehydrogenase;

g13) cDNA or genomic DNA having 90% identity to the DNA molecule defined in g11) or g12) and encoding the acetaldehyde ethanol dehydrogenase.

The recombinant bacteria constructed by the above recombinant bacteria construction method also fall within the protection scope of the invention.

The application of the recombinant bacterium in the production of ethanol is also within the protection scope of the invention.

The invention also provides a method for preparing ethanol by using the recombinant bacterium, which comprises the step of preparing ethanol by using xylose as a carbon source and carrying out biotransformation by using the recombinant bacterium.

The medium for biotransformation is MM liquid medium, and the conditions for biotransformation are as follows: shaking culture is carried out for 24-96h at the temperature of 30-37 ℃ in a bottle, and the rotating speed of the shaking bottle is 100-200 rpm.

The composition of the MM liquid medium is as follows: the culture medium contains 10g xylose and 2g NH per liter₄Cl、5g(NH₄)₂SO₄、6g KH₂PO₄8g of 3-morpholine propanesulfonic acid, 0.5g of NaCl, 1mL of trace element solution and the balance of water. Wherein the concentration of xylose can be adjusted as desired.

The composition of the trace element solution is as follows: the solution of trace elements contains 3.6g FeCl per liter₂·4H₂O、5g CaCl₂·2H₂O、1.3g MnCl₂·2H₂O、0.38g CuCl₂·2H₂O、0.5g CoCl₂·6H₂O、0.94g ZnCl₂、0.03g H₃BO₃、0.4g Na₂EDTA·2H₂O, 1g of thiamine-HCl, the remainder being 0.5M HCl.

The invention has the beneficial effects that: according to the invention, 3 metabolic pathway related genes are expressed in escherichia coli, 3 endogenous genes are knocked out, an engineering strain capable of synthesizing ethanol by using xylose is obtained, and the ethanol yield and the conversion rate of the recombinant strain in shake flask culture can reach higher levels. The recombinant strain constructed by the invention has a good application prospect.

Drawings

FIG. 1 is a vector map;

fig. 2 is a graph of xylose consumption and growth curves of e.coli JM109 and e.coli JM 109-1;

FIG. 3 shows the bacterial growth, xylose consumption and product synthesis of four genetically engineered bacteria.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The experimental procedures in the following examples are conventional unless otherwise specified. Materials, reagents, instruments and the like used in the following examples are commercially available unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged. In the following examples, unless otherwise specified, the 1 st position of each nucleotide sequence in the sequence listing is the 5 'terminal nucleotide of the corresponding DNA, and the last position is the 3' terminal nucleotide of the corresponding DNA.

The enzymes used in the following examples relating to molecular biological manipulations are all NEB (New England Biolabs, http:// www.neb-china. com /) products; the kits used for plasmid extraction and DNA fragment recovery are all products of the Beijing Bomaide Gene technology Co., Ltd (http:// www.biomed168.com /); the DNA synthesis and sequencing work described in the examples was carried out by Beijing Bomaide Gene technology, Inc.

Colijm 109: from Promega corporation (https:// www.promega.com.cn), cat # P9751.

Coli mg1655: derived from E.coli Genetic Resources at Yale CGSC, The Coli Genetic Stock Center (http:// CGSC2.biology. Yale. edu /), numbered CGSC # 6300.

Coli NEB 5-alpha: from NEB (New England Biolabs), cat # C2987I.

Plasmid pKD 13: from E.coli Genetic Resources at Yale CGSC, The Coli Genetic Stock Center, accession number CGSC # 7633.

Plasmid pKD 46: derived from E.coli Genetic Resources at Yale CGSC, The Coli Genetic Stock Center, accession number CGSC # 7739.

Plasmid pCP 20: from E.coli Genetic Resources at Yale CGSC, The Coli Genetic Stock Center, accession number CGSC # 7637.

Plasmid pUC 19: from NEB (New England Biolabs) under the designation N3041S.

The composition of the MM liquid medium is as follows: the culture medium contains 10g xylose and 2g NH per liter₄Cl、5g(NH₄)₂SO₄、6g KH₂PO₄8g of 3-morpholine propanesulfonic acid, 0.5g of NaCl, 1mL of trace element solution and the balance of water. Wherein the concentration of xylose can be adjusted as desired.

The composition of the trace element solution is as follows: the solution of trace elements contains 3.6g FeCl per liter₂·4H₂O、5g CaCl₂·2H₂O、1.3g MnCl₂·2H₂O、0.38g CuCl₂·2H₂O、0.5g CoCl₂·6H₂O、0.94g ZnCl₂、0.03g H₃BO₃、0.4g Na₂EDTA·2H₂O, 1g of thiamine-HCl, the remainder being 0.5M HCl.

Example 1 construction of recombinant bacterium E.coli JM109-1(pUC19-xpk)

Firstly, construction of recombinant expression vector pUC19-xpk

1. The DNA shown in sequence 1 in the sequence table is artificially synthesized, and contains an xpk expression cassette, wherein the upstream is a SacI site, the downstream is an XmaI site, the 9 th to 69 th nucleotides are promoter sequences, and the 70 th to 2538 th nucleotides are xpk gene sequences.

2. Using the DNA sequence synthesized in the SacI and XmaI double-restriction enzyme sequence 1 to recover a DNA fragment with the size of about 2532 bp; the plasmid pUC19 was digested with SacI and XmaI, and a DNA fragment of approximately 2680bp was recovered; the two DNA fragments are connected to obtain a connection product, the connection product is introduced into E.coli NEB5-alpha by a chemical conversion method, and the connection product is spread on an LB solid culture medium containing ampicillin and cultured for 16h at 37 ℃ to obtain a transformant. The plasmid of the transformant was extracted, and the digestion was verified by SacI and XmaI, and the plasmid with the size of about 2532bp and 2680bp as the digestion product was the positive plasmid, which was designated as recombinant plasmid pUC 19-xpk. The recombinant plasmid pUC19-xpk was sequenced, and the results showed that: pUC19-xpk is a recombinant plasmid obtained by replacing the DNA fragment between SacI and XmaI recognition sequences of plasmid pUC19 with xpk expression cassette shown in the 9 th-2538 th position of sequence 1 in the sequence table.

Second, construction of E.coli JM109-1

3. Knock-out of rpe Gene

The rpe gene is a ribulose phosphate isomerase gene whose nucleotide sequence is as defined by GenBank No.: NC _000913.3, Gene ID: 947896, update: 10-Oct-2019.

1) Primers rpeF and rpeR for synthesizing rpe gene knockout, wherein the sequences of the primers are as follows:

rpeF：

5’-ATGAAACAGTATTTGATTGCCCCCTCAATTCTGTCGGCTGATTTTGCCCGCCTGGGTGAAGTGTAGG

CTGGAGCTGCTTCG-3’；

rpeR：

5’-TTATTCATGACTTACCTTTGCCAGTTCACTGCGCATTTCATCAATGACTTTTTTGTAGTCATTCCGG

GGATCCGTCGACC-3’。

2) the plasmid pKD13 is used as a template, primers rpeF and rpeR are adopted, a DNA fragment of about 1500bp is obtained by PCR amplification and named as rpe homologous recombination fragment, and the obtained DNA fragment is purified by agarose gel electrophoresis. Through sequencing, the nucleotide sequence of the rpe homologous recombination fragment is sequence 4, wherein, the 1 st to 81 th sites are the upstream homologous arm of the rpe gene, the 82 th to 1383 th sites are the FRT sequence and the Kan resistance gene, and the 1384 th and 1465 th sites are the downstream homologous arm of the rpe gene.

3) Plasmid pKD46 is transformed into a receptor strain E.coli JM109 by an electric transformation method, and spread on LB solid medium containing ampicillin, and cultured for 24h at 30 ℃ to obtain a transformant, and quality improvement granules are verified to obtain a recombinant bacterium containing plasmid pKD46, which is marked as E.coli JM109(pKD 46).

4) E.coli JM109(pKD46) was inoculated into LB liquid medium containing ampicillin, cultured at 30 ℃ for 1 hour, arabinose was added to a final concentration of 5g/L, culture was continued for 1.5 hours, and then competent cells of E.coli JM109(pKD46) were prepared, the DNA fragment obtained in step 2) was transferred into competent cells of E.coli JM109(pKD46) and spread on LB solid medium containing kanamycin, and cultured at 37 ℃ for 24 hours to obtain transformants.

5) Using colony PCR method, taking rpeF and rpeR as primers, purifying PCR product, sequencing, screening the clone with correct rpe gene replaced by Kan resistance gene, and obtaining E.coli JM109rpe-K (pKD 46).

6) Inoculating E.coli JM109rpe-K (pKD46) into LB liquid medium, culturing at 42 ℃ for three passages, and removing pKD46 plasmid to obtain E.coli JM109 rpe-K; coli JM109rpe-K is E.coli JM109 in which the rpe gene is replaced with a Kan gene.

7) E.coli JM109rpe-K competent cells were prepared by inoculating E.coli JM109rpe-K to LB liquid medium containing kanamycin, culturing at 37 ℃ for 24 hours, transferring to LB liquid medium containing kanamycin, and culturing at 37 ℃ for 3 hours.

8) Plasmid pCP20 was transformed into E.coli JM109rpe-K competent cells by the electrotransformation method, plated on LB solid medium containing ampicillin and chloramphenicol, and cultured at 30 ℃ for 48 hours to obtain transformants. Transformants were verified by colony PCR using rpeF and rpeR as primers to obtain positive clones with a 202bp fragment. The positive clone was subjected to sequencing, which was a bacterium obtained by knocking out the rpe gene on the genome of e.coli JM109, and this bacterium was inoculated into LB liquid medium, passaged three times at 42 ℃, and pCP20 was removed, and the obtained strain was named mutant e.coli JM 109-1.

Thirdly, construction of recombinant bacterium E.coli JM109-1(pUC19-xpk)

4. Coli JM109-1 obtained in the second step was transformed with the recombinant plasmid pUC19-xpk obtained in the first step by electrotransformation, spread on LB solid medium containing ampicillin, and cultured at 37 ℃ for 24 hours.

5. The single clone was picked up in LB liquid medium containing ampicillin and cultured at 37 ℃ for 24 hours.

6. Plasmid of the transformant was extracted, and the correctness of transformation was verified to obtain recombinant bacterium E.coli JM109-1(pUC19-xpk) containing plasmid pUC 19-xpk. The E.coli JM109-1(pUC19-xpk) is a recombinant bacterium which knocks out the E.coli JM109 chromosomal gene rpe and contains an exogenous expression cassette of the gene xpk.

Example 2 construction of recombinant bacterium E.coli JM109-1(pUC19-xpk-pta)

Firstly, construction of recombinant expression vector pUC19-xpk-pta

1. The DNA shown in sequence 2 in the sequence table is artificially synthesized, and contains a pta expression cassette, wherein the upstream is an XmaI site, the downstream is an XbaI site, the 9 th to 69 th nucleotides are promoter sequences, and the 70 th to 2214 th nucleotides are pta gene sequences.

2. Using XmaI and XbaI to double-enzyme-cut the DNA sequence synthesized in the sequence 2, and recovering a DNA fragment with the size of about 2222 bp; the plasmid pUC19-xpk was digested with XmaI and XbaI, and a DNA fragment of about 5201bp was recovered; the two DNA fragments are connected to obtain a connection product, the connection product is introduced into E.coli NEB5-alpha by a chemical conversion method, and the connection product is spread on an LB solid culture medium containing ampicillin and cultured for 16h at 37 ℃ to obtain a transformant. The plasmid of the transformant was extracted and verified by digestion with EcoRI and XbaI, and the plasmid having the size of about 4754bp and 2659bp as the digestion product was a positive plasmid, and this recombinant plasmid was designated as recombinant plasmid pUC 19-xpk-pta. The recombinant plasmid pUC19-xpk-pta was sequenced, and the results showed that: pUC19-xpk-pta is a recombinant plasmid obtained by replacing the DNA fragment between XmaI and XbaI recognition sequences of plasmid pUC19-phaC with a pta expression cassette shown at positions 9-2214 of sequence 2 in the sequence table.

Secondly, construction of recombinant bacterium E.coli JM109-1(pUC19-xpk-pta)

3. Coli JM109-1 obtained in the second step of example 1 was transformed with the recombinant plasmid pUC19-xpk-pta obtained in the first step by electrotransformation, spread on LB solid medium containing ampicillin, and cultured at 37 ℃ for 24 hours.

4. The single clone was picked up in LB liquid medium containing ampicillin and cultured at 37 ℃ for 24 hours.

5. Plasmid of the transformant was extracted, and the correctness of transformation was verified to obtain recombinant E.coli JM109-1(pUC19-xpk-pta) containing plasmid pUC 19-xpk-pta. The E.coli JM109-1(pUC19-xpk-pta) is a recombinant bacterium which knocks out the E.coli JM109 chromosomal gene rpe and contains a foreign expression cassette of the gene xpk and pta.

Example 3 construction of recombinant bacterium E.coli JM109-1(pUC19-xpk-pta-adhE)

Firstly, construction of recombinant expression vector pUC19-xpk-pta-adhE

1. The DNA shown in sequence 3 in the sequence table is artificially synthesized, and contains an adhE expression cassette, wherein the upstream is an XbaI site, the downstream is a SalI site, the 9 th to 69 th nucleotides are promoter sequences, and the 70 th to 2745 th nucleotides are adhE gene sequences.

2. The DNA sequence synthesized in the sequence 3 is digested by XbaI and SalI, and a DNA fragment with the size of about 2743bp is recovered; double digestion of plasmid pUC19-xpk-pta with XbaI and SphI to recover a 7407bp DNA fragment; the two DNA fragments were ligated to each other to obtain a ligated product, which was introduced into E.coli NEB5-alpha by chemical transformation, spread on LB solid medium containing ampicillin, and cultured at 37 ℃ for 16 hours to obtain a transformant. The plasmid of the transformant was extracted, and the digestion with XbaI and SalI was carried out to verify that the plasmid having the size of about 2743bp and 7407bp was a positive plasmid, and the recombinant plasmid was named as recombinant plasmid pUC 19-xpk-pta-adhE. The recombinant plasmid pUC19-xpk-pta-adhE was sequenced, and the results showed that: pUC19-xpk-pta-adhE is a recombinant plasmid obtained by replacing the DNA fragment between the XbaI and SalI recognition sequences of plasmid pUC19-xpk-pta with the adhE expression cassette shown in position 9-2745 of sequence 3 in the sequence Listing. That is, the plasmid pUC19-xpk-pta-adhE contains the genes of xpk, pta and adhE simultaneously.

Secondly, construction of recombinant bacterium E.coli JM109-1(pUC19-xpk-pta-adhE)

3. The recombinant plasmid pUC19-xpk-pta-adhE obtained in the first step was transformed into E.coli JM109-1 obtained in the second step of the first step by the method of electrotransformation, spread on LB solid medium containing ampicillin, and cultured at 37 ℃ for 24 hours.

4. The single clone was picked up in LB liquid medium containing ampicillin and cultured at 37 ℃ for 24 hours.

5. Plasmid of the transformant was extracted, and the correctness of transformation was verified to obtain recombinant E.coli JM109-1(pUC19-xpk-pta-adhE) containing plasmid pUC 19-xpk-pta-adhE. The E.coli JM109-1(pUC19-xpk-pta-adhE) is a recombinant strain which knocks out E.coli JM109 chromosome gene rpe and contains exogenous expression cassettes of genes adhE, xpk and pta.

Example 4 construction of recombinant bacterium E.coli JM109-3(pUC19-xpk-pta-adhE)

First, construction of Escherichia coli E.coli JM109-3

1. Knock-out of poxB Gene

The poxB gene is pyruvate oxidase gene, and the nucleotide sequence of the poxB gene is shown as GenBank number: NC _000913.3, Gene ID: 946132 (update: 10-Oct-2019).

Basically the same method as that for constructing E.coli JM109-1 by knocking out rpe gene in the first embodiment is as follows:

the poxB gene knockout primer sequences are as follows:

poxBF：5’-

atgaaacaaacggttgcagcttatatcgccaaaacactcgaatcggcaggggtgaaacgcGTGTAGGCTGG AGCTGCTTCG-3’；

poxBR：5’

-TTACCTTAGCCAGTTTGTTTTCGCCAGTTCGATCACTTCATCACCGCGTCCGCTGATGATATTCCGGGGATCCG TCGACC-3’；

the nucleotide sequence of the poxB homologous recombination fragment obtained by using the poxB gene knockout primer is sequence 5, wherein the 1 st to 81 th sites are the upstream homology arm of the poxB gene, the 82 th to 1383 th sites are an FRT sequence and a Kan resistance gene, and the 1384 th and 1465 th sites are the downstream homology arm of the poxB gene. Coli JM109-1, mutant obtained in example one. Transformants were verified by colony PCR, and 202bp fragment-positive clones were obtained using poxBF and poxBR primers. The positive clone was subjected to sequencing, which was a bacterium obtained by knocking out the poxB gene on the E.coli JM109-1 genome, and this bacterium was inoculated into LB liquid medium, passaged three times at 42 ℃ to remove pCP20, and the obtained strain was named as mutant E.coli JM 109-2.

2. Knock-out of ackA Gene

The ackA gene is an acetate kinase gene, and the nucleotide sequence thereof is shown in GenBank number: NC _000913.3, Gene ID: 946775 (update: 10-Oct-2019).

Basically the same method as that for constructing E.coli JM109-1 by knocking out rpe gene in the first embodiment is as follows:

the ackA knockout primer sequence is as follows:

ackAF：

5’-atgtcgagtaagttagtactggttctgaactgcggtagttcttcactgaaatttgccatcGTGTAG

GCTGGAGCTGCTTCG-3’；

ackAR：

5’-TCAGGCAGTCAGGCGGCTCGCGTCTTGCGCGATAACCAGTTCTTCGTTGGTTGGGATAACATTCCG

GGGATCCGTCGACC-3’；

the nucleotide sequence of the ackA homologous recombination fragment obtained by using the ackA gene knockout primer is sequence 6, wherein the 1 st to 81 th sites are the upstream homologous arm of the ackA gene, the 82 th to 1383 th sites are an FRT sequence and a Kan resistance gene, and the 1384 th and 1465 th sites are the downstream homologous arm of the ackA gene. Transforming the receptor strain into the mutant E.coli JM109-2 obtained in the step 1. Transformants were verified by colony PCR using ackAF and ackAR as primers to obtain a 202bp fragment positive clone. The positive clone was sequenced, and it was a bacterium obtained by knocking out the ackA gene on the e.coli JM109-2 genome, and this bacterium was inoculated into LB liquid medium, passaged three times at 42 ℃, and pCP20 was removed, and the obtained strain was named mutant e.coli JM 109-3.

Secondly, construction of recombinant bacterium E.coli JM109-3(pUC19-xpk-pta-adhE)

3. The recombinant plasmid pUC19-xpk-pta-adhE obtained in the first step of example 3 was transformed into E.coli JM109-3 obtained in the first step of this example by the method of electrotransformation, spread on LB solid medium containing ampicillin, and cultured at 37 ℃ for 24 hours.

4. The single clone was picked up in LB liquid medium containing ampicillin and cultured at 37 ℃ for 24 hours.

5. Plasmid of the transformant was extracted, and the correctness of transformation was verified to obtain recombinant E.coli JM109-3(pUC19-xpk-pta-adhE) containing plasmid pUC 19-xpk-pta-adhE.

Coli JM109-3(pUC19-xpk-pta-adhE) is a recombinant bacterium that knocks out e. coli JM109 chromosomal genes rpe, poxB and ackA, and contains exogenous expression cassettes for the genes adhE, xpk and pta.

Example 5 Shake flask experiment to verify that E.coli JM109-1 is unable to utilize xylose

1. E.coli JM109-1 prepared in step one of example 1 was cultured in LB liquid medium at 37 ℃ and 200rpm for 16 hours, respectively, to prepare a seed solution, and E.coli JM109 was cultured under the same conditions as a control.

2. Inoculating the seed solution into MM liquid culture medium containing 10g xylose per liter of culture medium at an inoculation amount of 4% by volume, adding 50ml of solution into a 250ml shake flask, and culturing at 37 ℃ and 200rpm for 72h, during which the fermentation liquid is collected.

3. The growth of the cells and the xylose consumption were quantitatively determined by high performance liquid chromatography. The specific conditions are as follows:

the instrument comprises the following steps: the Shimadzu corporation Essentia LC series HPLC instrument is equipped with a DGU-20A degasser, an LC-16 liquid pump, an SIL-16 type autosampler and an RID-20A detector.

Chromatographic conditions are as follows: Bio-Rad

HPX-87H (7.8X 300 mm); the flow rate is 0.60 mL/min; the column temperature is 55 ℃; the mobile phase was 5mM aqueous sulfuric acid.

The detection method comprises the following steps: taking xylose standard aqueous solution (xylose, Sigma-Aldrich, product number X1500) with xylose concentration of 0, 1, 2, 3, 4, 5g/L respectively, filtering with 0.22 μm microporous membrane, injecting 10 μ L of sample, performing HPLC detection, and drawing standard curve with chromatographic peak areas of xylose standard solutions with different concentrations as ordinate and concentrations of different substances as abscissa.

Centrifuging 2mL fermentation liquid at 12000rpm for 10min, transferring the fermentation supernatant into a new centrifuge tube, filtering with 0.22 μm microporous membrane, injecting 10 μ L, and performing HPLC detection. And substituting the xylose chromatographic peak area of the fermentation supernatant of the sample to be detected into the corresponding standard curve, and calculating to obtain the residual xylose content of the fermentation supernatant of the sample to be detected.

The change of xylose content of e.coli JM109 and e.coli JM109-1 under the experimental conditions was examined as shown in fig. 2. Coli JM109-1 shows a constant concentration of xylose and OD as compared with E.coli JM109₆₀₀The growth is not increased, which indicates that the E.coli JM109-1 mutant can not utilize xylose for growth in a culture medium, and the invention completely blocks the xylose metabolic pathway of Escherichia coli so that the Escherichia coli can not grow in a minimal medium taking xylose as a unique carbon source.

Example 6 shaking flask experiment of recombinant bacteria Using xylose

1. E.coli JM109-1(pUC19-xpk) prepared in the third step of example 1, E.coli JM109-1(pUC19-xpk-pta) prepared in the second step of example 2, E.coli JM109-1(pUC19-xpk-pta-adhE) prepared in the second step of example 3, and E.coli JM109-3(pUC19-xpk-pta-adhE) prepared in the second step of example 4 were cultured in LB liquid medium at 37 ℃ and 200rpm for 16 hours, respectively, as seed solutions.

2. Inoculating the seed solution into MM liquid culture medium containing 10g xylose per liter of culture medium at an inoculation amount of 4% by volume, adding 50ml of solution into a 250ml shake flask, and culturing at 37 ℃ and 200rpm for 72h, during which the fermentation liquid is collected.

3. And quantitatively detecting the growth of the thalli, the consumption of xylose and the synthesis condition of the product by high performance liquid chromatography. The specific conditions were as described in example 5, acetic acid (Sigma-Aldrich, product No. A6283) and ethanol (Sigma-Aldrich, product No. 459844) were prepared in the same manner as xylose, and the results are shown in FIG. 3.

When the mutant E.coli JM109-1 overexpresses xpk gene, the E.coli JM109-1(pUC19-xpk) can grow by using xylose, but the growth is slow and the xylose is not completely used. The strain cannot synthesize ethanol.

On this basis, the pta gene was overexpressed. The recombinant bacterium E.coli JM109-1(pUC19-xpk-pta) has obviously improved xylose utilization efficiency, can completely consume xylose, but accumulates more acetic acid to reach 4.18 g/L. OD of E.coli JM109-1(pUC19-xpk-pta) due to accumulation of acetic acid₆₀₀There was a significant drop indicating that acetic acid inhibited bacterial growth. The strain cannot synthesize ethanol.

On the basis of over-expressing the adhE gene, the recombinant bacterium E.coli JM109-1(pUC19-xpk-pta-adhE) can produce ethanol by using xylose, but the final yield is only 0.52g/L, most products are acetic acid, and the acetic acid yield is 3.82 g/L.

To reduce acetate accumulation, poxB and ackA genes were knocked out. The acetic acid synthesis pathway of the recombinant strain JM109-3(pUC19-xpk-pta-adhE) is blocked, and acetic acid is hardly accumulated and is only 0.07g/L at most. Meanwhile, the ethanol yield of the recombinant bacterium JM109-3(pUC19-xpk-pta-adhE) is greatly improved, and the final yield is 4.52 g/L.

Sequence listing

<110> Beijing university of chemical industry

<120> genetic engineering bacterium for producing ethanol by using xylose and construction method and application thereof

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2546

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aagagctctt gacagctagc tcagtcctag gtataatgct agctactaga gaaagaggag 60

aaatatacca tgaccgagta taacagcgaa gcgtatctga aaaagctgga taaatggtgg 120

cgcgcggcga cttatttagg cgcgggcatg atttttctga aagagaaccc gctgtttagc 180

gttaccggca ccccgattaa agcggaaaac ctgaaagcga acccgattgg ccattggggt 240

acggttagcg gtcagacctt tctgtatgcg catgcgaacc gcctgattaa caaatatgac 300

cagaagatgt tttatatggg cggaccgggt catggtggtc aagcgatggt tgttccgagc 360

tatctggatg gcagctatac cgaagcgtat ccggaaatta cccaggatct ggaaggtatg 420

agccgcctgt ttaaacgctt tagctttccg ggtggcattg gctcacacat gaccgcacaa 480

acccctggca gcttacatga aggtggcgaa ctgggctatg ttctgagcca tgcgaccggt 540

gcgattttag atcagccgga acagattgcg tttgcggtgg tgggtgatgg tgaagcggaa 600

accggccctt taatgaccag ctggcacagc attaaattca tcaacccgaa aaacgatggc 660

gcgattctgc cgattctgga tctgaacggc tttaaaatta gcaacccgac cctgtttgcg 720

cgtaccagcg atgtggatat tcgcaagttt tttgaaggcc tgggctatag cccgcgctat 780

attgaaaacg atgacatcca tgactatatg gcgtatcata aactggcggc ggaagtgttt 840

gataaagcga tcgaggatat tcaccagatt cagaaagatg cgcgcgaaga taaccgctat 900

cagaacggcg aaattccggc gtggccgatt gttattgcgc gcctgcctaa aggttggggc 960

ggtccgcgtt ataatgattg gagcggcccg aaatttgatg gcaaaggcat gccgattgaa 1020

catagctttc gcgcgcatca ggttccttta ccgctgagca gcaaaaacat gggcaccctg 1080

ccggaatttg tgaaatggat gaccagctat cagccggaaa ccctgtttaa cgcggatggc 1140

agcctgaaag aagaactgcg cgattttgcg ccgaaaggcg aaatgcgcat ggcgagcaac 1200

cctgttacca acggcggcgt tgatagcagc aatctggtgt taccggattg gcaggaattt 1260

gcgaacccga ttagcgaaaa caaccgcggc aaactgctgc cggataccaa cgataacatg 1320

gatatgaacg tgctgagcaa atactttgcg gagatcgtga aattaaaccc gacccgcttt 1380

cgcttatttg gcccggatga aaccatgagc aaccgctttt gggaaatgtt taaagtgacc 1440

aaccgccagt ggatgcaggt gattaaaaac ccgaacgacg aatttatttc gccggaaggc 1500

cgcattattg atagccagct gagcgaacat caagcggaag gctggttaga aggctatacc 1560

ttaaccggtc gcactggtgc gtttgcgagc tatgagagct ttctgcgcgt ggtggatagc 1620

atgctgaccc agcattttaa atggattcgc caggcggcgg atcaaaaatg gcgccatgat 1680

tatccgagcc tgaacgtgat tagcaccagc accgtgtttc agcaggatca taacggctat 1740

acccatcaag atccgggcat gttaacccat ctggcggaaa aaaaaagcga tttcatccgc 1800

cagtatctgc cggcggatgg taatactctg ctggcggttt ttgatcgcgc gtttcaggat 1860

cgcagcaaga ttaaccatat tgtggcgagc aaacagcctc gccaacagtg gtttaccaaa 1920

gaagaagcgg aaaaactggc gaccgatggc attgcgacca ttgattgggc gagcaccgcg 1980

aaagatggcg aagcggtgga tctggttttt gcgagcgcgg gtgcggaacc taccattgaa 2040

accctggcgg cgttacatct ggtgaacgaa gtgtttccgc aggcgaaatt tcgctatgtg 2100

aacgtggttg aattaggccg cctgcaaaaa aaaaaaggcg cgctgaacca ggaacgcgaa 2160

ctgagcgatg aagagtttga gaaatatttt ggcccgagcg gtacgcctgt gatttttggc 2220

tttcatggct acgaagatct gattgagagc attttttatc agcgcggcca tgatggttta 2280

attgtgcatg gctatcgcga agatggcgat attaccacca cctatgatat gcgcgtgtat 2340

agcgaactgg atcgctttca tcaggcgatt gatgcgatgc aggtgctgta tgtgaaccgc 2400

aaagtgaatc agggcctggc gaaagcgttt attgatcgca tgaaacgcac cctggtgaaa 2460

cattttgaag tgacccgcaa cgaaggcgtg gatattccgg attttaccga atgggtgtgg 2520

agcgatctga agaaatgacc cgggaa 2546

<210> 2

<211> 2222

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aacccgggtt gacagctagc tcagtcctag gtataatgct agctactaga gaaagaggag 60

aaatatacca tgtcccgtat tattatgctg atccctaccg gaaccagcgt cggtctgacc 120

agcgtcagcc ttggcgtgat ccgtgcaatg gaacgcaaag gcgttcgtct gagcgttttc 180

aaacctatcg ctcagccgcg taccggtggc gatgcgcccg atcagactac gactatcgtg 240

cgtgcgaact cttccaccac gacggccgct gaaccgctga aaatgagcta cgttgaaggt 300

ctgctttcca gcaatcagaa agatgtgctg atggaagaga tcgtcgcaaa ctaccacgct 360

aacaccaaag acgctgaagt cgttctggtt gaaggtctgg tcccgacacg taagcaccag 420

tttgcccagt ctctgaacta cgaaatcgct aaaacgctga atgcggaaat cgtcttcgtt 480

atgtctcagg gcactgacac cccggaacag ctgaaagagc gtatcgaact gacccgcaac 540

agcttcggcg gtgccaaaaa caccaacatc accggcgtta tcgttaacaa actgaacgca 600

ccggttgatg aacagggtcg tactcgcccg gatctgtccg agattttcga cgactcttcc 660

aaagctaaag taaacaatgt tgatccggcg aagctgcaag aatccagccc gctgccggtt 720

ctcggcgctg tgccgtggag ctttgacctg atcgcgactc gtgcgatcga tatggctcgc 780

cacctgaatg cgaccatcat caacgaaggc gacatcaata ctcgccgcgt taaatccgtc 840

actttctgcg cacgcagcat tccgcacatg ctggagcact tccgtgccgg ttctctgctg 900

gtgacttccg cagaccgtcc tgacgtgctg gtggccgctt gcctggcagc catgaacggc 960

gtagaaatcg gtgccctgct gctgactggc ggttacgaaa tggacgcgcg catttctaaa 1020

ctgtgcgaac gtgctttcgc taccggcctg ccggtattta tggtgaacac caacacctgg 1080

cagacctctc tgagcctgca gagcttcaac ctggaagttc cggttgacga tcacgaacgt 1140

atcgagaaag ttcaggaata cgttgctaac tacatcaacg ctgactggat cgaatctctg 1200

actgccactt ctgagcgcag ccgtcgtctg tctccgcctg cgttccgtta tcagctgact 1260

gaacttgcgc gcaaagcggg caaacgtatc gtactgccgg aaggtgacga accgcgtacc 1320

gttaaagcag ccgctatctg tgctgaacgt ggtatcgcaa cttgcgtact gctgggtaat 1380

ccggcagaga tcaaccgtgt tgcagcgtct cagggtgtag aactgggtgc agggattgaa 1440

atcgttgatc cagaagtggt tcgcgaaagc tatgttggtc gtctggtcga actgcgtaag 1500

aacaaaggca tgaccgaaac cgttgcccgc gaacagctgg aagacaacgt ggtgctcggt 1560

acgctgatgc tggaacagga tgaagttgat ggtctggttt ccggtgctgt tcacactacc 1620

gcaaacacca tccgtccgcc gctgcagctg atcaaaactg caccgggcag ctccctggta 1680

tcttccgtgt tcttcatgct gctgccggaa caggtttacg tttacggtga ctgtgcgatc 1740

aacccggatc cgaccgctga acagctggca gaaatcgcga ttcagtccgc tgattccgct 1800

gcggccttcg gtatcgaacc gcgcgttgct atgctctcct actccaccgg tacttctggt 1860

gcaggtagcg acgtagaaaa agttcgcgaa gcaactcgtc tggcgcagga aaaacgtcct 1920

gacctgatga tcgacggtcc gctgcagtac gacgctgcgg taatggctga cgttgcgaaa 1980

tccaaagcgc cgaactctcc ggttgcaggt cgcgctaccg tgttcatctt cccggatctg 2040

aacaccggta acaccaccta caaagcggta cagcgttctg ccgacctgat ctccatcggg 2100

ccgatgctgc agggtatgcg caagccggtt aacgacctgt cccgtggcgc actggttgac 2160

gatatcgtct acaccatcgc gctgactgcg attcagtctg cacagcagca gtaatctaga 2220

aa 2222

<210> 3

<211> 2753

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aatctagatt gacagctagc tcagtcctag gtataatgct agctactaga gaaagaggag 60

aaatatacca tggctgttac taatgtcgct gaacttaacg cactcgtaga gcgtgtaaaa 120

aaagcccagc gtgaatatgc cagtttcact caagagcaag tagacaaaat cttccgcgcc 180

gccgctctgg ctgctgcaga tgctcgaatc ccactcgcga aaatggccgt tgccgaatcc 240

ggcatgggta tcgtcgaaga taaagtgatc aaaaaccact ttgcttctga atatatctac 300

aacgcctata aagatgaaaa aacctgtggt gttctgtctg aagacgacac ttttggtacc 360

atcactatcg ctgaaccaat cggtattatt tgcggtatcg ttccgaccac taacccgact 420

tcaactgcta tcttcaaatc gctgatcagt ctgaagaccc gtaacgccat tatcttctcc 480

ccgcacccgc gtgcaaaaga tgccaccaac aaagcggctg atatcgttct gcaggctgct 540

atcgctgccg gtgctccgaa agatctgatc ggctggatcg atcaaccttc tgttgaactg 600

tctaacgcac tgatgcacca cccagacatc aacctgatcc tcgcgactgg tggtccgggc 660

atggttaaag ccgcatacag ctccggtaaa ccagctatcg gtgtaggcgc gggcaacact 720

ccagttgtta tcgatgaaac tgctgatatc aaacgtgcag ttgcatctgt actgatgtcc 780

aaaaccttcg acaacggcgt aatctgtgct tctgaacagt ctgttgttgt tgttgactct 840

gtttatgacg ctgtacgtga acgttttgca acccacggcg gctatctgtt gcagggtaaa 900

gagctgaaag ctgttcagga tgttatcctg aaaaacggtg cgctgaacgc ggctatcgtt 960

ggtcagccag cctataaaat tgctgaactg gcaggcttct ctgtaccaga aaacaccaag 1020

attctgatcg gtgaagtgac cgttgttgat gaaagcgaac cgttcgcaca tgaaaaactg 1080

tccccgactc tggcaatgta ccgcgctaaa gatttcgaag acgcggtaga aaaagcagag 1140

aaactggttg ctatgggcgg tatcggtcat acctcttgcc tgtacactga ccaggataac 1200

caaccggctc gcgtttctta cttcggtcag aaaatgaaaa cggcgcgtat cctgattaac 1260

accccagcgt ctcagggtgg tatcggtgac ctgtataact tcaaactcgc accttccctg 1320

actctgggtt gtggttcttg gggtggtaac tccatctctg aaaacgttgg tccgaaacac 1380

ctgatcaaca agaaaaccgt tgctaagcga gctgaaaaca tgttgtggca caaacttccg 1440

aaatctatct acttccgccg tggctccctg ccaatcgcgc tggatgaagt gattactgat 1500

ggccacaaac gtgcgctcat cgtgactgac cgcttcctgt tcaacaatgg ttatgctgat 1560

cagatcactt ccgtactgaa agcagcaggc gttgaaactg aagtcttctt cgaagtagaa 1620

gcggacccga ccctgagcat cgttcgtaaa ggtgcagaac tggcaaactc cttcaaacca 1680

gacgtgatta tcgcgctggg tggtggttcc ccgatggacg ccgcgaagat catgtgggtt 1740

atgtacgaac atccggaaac tcacttcgaa gagctggcgc tgcgctttat ggatatccgt 1800

aaacgtatct acaagttccc gaaaatgggc gtgaaagcga aaatgatcgc tgtcaccacc 1860

acttctggta caggttctga agtcactccg tttgcggttg taactgacga cgctactggt 1920

cagaaatatc cgctggcaga ctatgcgctg actccggata tggcgattgt ggacgccaac 1980

ctggttatgg acatgccgaa gtccctgtgt gctttcggtg gtctggacgc agtaactcac 2040

gccatggaag cttatgtttc tgtactggca tctgagttct ctgatggtca ggctctgcag 2100

gcactgaaac tgctgaaaga atatctgcca gcgtcctacc acgaagggtc taaaaatccg 2160

gtagcgcgtg aacgtgttca cagtgcagcg actatcgcgg gtatcgcgtt tgcgaacgcc 2220

ttcctgggtg tatgtcactc aatggcgcac aaactgggtt cccagttcca tattccgcac 2280

ggtctggcaa acgccctgct gatttgtaac gttattcgct acaatgcgaa cgacaacccg 2340

accaagcaga ctgcattcag ccagtatgac cgtccgcagg ctcgccgtcg ttatgctgaa 2400

attgccgacc acttgggtct gagcgcaccg ggcgaccgta ctgctgctaa gatcgagaaa 2460

ctgctggcat ggctggaaac gctgaaagct gaactgggta ttccgaaatc tatccgtgaa 2520

gctggcgttc aggaagcaga cttcctggcg aacgtggata aactgtctga agatgcattc 2580

gatgaccagt gcaccggcgc taacccgcgt tacccgctga tctccgagct gaaacagatt 2640

ctgctggata cctactacgg tcgtgattat gtagaaggtg aaactgcagc gaagaaagaa 2700

gctgctccgg ctaaagctga gaaaaaagcg aaaaaatccg cttaagtcga caa 2753

<210> 4

<211> 1424

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgaaacagt atttgattgc cccctcaatt ctgtcggctg attttgcccg cctgggtgaa 60

gtgtaggctg gagctgcttc gaagttccta tactttctag agaataggaa cttcggaata 120

ggaacttcaa gatcccctta ttagaagaac tcgtcaagaa ggcgatagaa ggcgatgcgc 180

tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc ggtcagccca ttcgccgcca 240

agctcttcag caatatcacg ggtagccaac gctatgtcct gatagcggtc cgccacaccc 300

agccggccac agtcgatgaa tccagaaaag cggccatttt ccaccatgat attcggcaag 360

caggcatcgc catgggtcac gacgagatcc tcgccgtcgg gcatgcgcgc cttgagcctg 420

gcgaacagtt cggctggcgc gagcccctga tgctcttcgt ccagatcatc ctgatcgaca 480

agaccggctt ccatccgagt acgtgctcgc tcgatgcgat gtttcgcttg gtggtcgaat 540

gggcaggtag ccggatcaag cgtatgcagc cgccgcattg catcagccat gatggatact 600

ttctcggcag gagcaaggtg agatgacagg agatcctgcc ccggcacttc gcccaatagc 660

agccagtccc ttcccgcttc agtgacaacg tcgagcacag ctgcgcaagg aacgcccgtc 720

gtggccagcc acgatagccg cgctgcctcg tcctgcagtt cattcagggc accggacagg 780

tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca gccggaacac ggcggcatca 840

gagcagccga ttgtctgttg tgcccagtca tagccgaata gcctctccac ccaagcggcc 900

ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa acgatcctca tcctgtctct 960

tgatcagatc ttgatcccct gcgccatcag atccttggcg gcaagaaagc catccagttt 1020

actttgcagg gcttcccaac cttaccagag ggcgccccag ctggcaattc cggttcgctt 1080

gctgtccata aaaccgccca gtctagctat cgccatgtaa gcccactgca agctacctgc 1140

tttctctttg cgcttgcgtt ttcccttgtc cagatagccc agtagctgac attcatccgg 1200

ggtcagcacc gtttctgcgg actggctttc tacgtgttcc gcttccttta gcagcccttg 1260

cgccctgagt gcttgcggca gcgtgagctt caaaagcgct ctgaagttcc tatactttct 1320

agagaatagg aacttcgaac tgcaggtcga cggatccccg gaatgactac aaaaaagtca 1380

ttgatgaaat gcgcagtgaa ctggcaaagg taagtcatga ataa 1424

<210> 5

<211> 1424

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgaaacaaa cggttgcagc ttatatcgcc aaaacactcg aatcggcagg ggtgaaacgc 60

gtgtaggctg gagctgcttc gaagttccta tactttctag agaataggaa cttcggaata 120

ggaacttcaa gatcccctta ttagaagaac tcgtcaagaa ggcgatagaa ggcgatgcgc 180

tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc ggtcagccca ttcgccgcca 240

agctcttcag caatatcacg ggtagccaac gctatgtcct gatagcggtc cgccacaccc 300

agccggccac agtcgatgaa tccagaaaag cggccatttt ccaccatgat attcggcaag 360

caggcatcgc catgggtcac gacgagatcc tcgccgtcgg gcatgcgcgc cttgagcctg 420

gcgaacagtt cggctggcgc gagcccctga tgctcttcgt ccagatcatc ctgatcgaca 480

agaccggctt ccatccgagt acgtgctcgc tcgatgcgat gtttcgcttg gtggtcgaat 540

gggcaggtag ccggatcaag cgtatgcagc cgccgcattg catcagccat gatggatact 600

ttctcggcag gagcaaggtg agatgacagg agatcctgcc ccggcacttc gcccaatagc 660

agccagtccc ttcccgcttc agtgacaacg tcgagcacag ctgcgcaagg aacgcccgtc 720

gtggccagcc acgatagccg cgctgcctcg tcctgcagtt cattcagggc accggacagg 780

tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca gccggaacac ggcggcatca 840

gagcagccga ttgtctgttg tgcccagtca tagccgaata gcctctccac ccaagcggcc 900

ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa acgatcctca tcctgtctct 960

tgatcagatc ttgatcccct gcgccatcag atccttggcg gcaagaaagc catccagttt 1020

actttgcagg gcttcccaac cttaccagag ggcgccccag ctggcaattc cggttcgctt 1080

gctgtccata aaaccgccca gtctagctat cgccatgtaa gcccactgca agctacctgc 1140

tttctctttg cgcttgcgtt ttcccttgtc cagatagccc agtagctgac attcatccgg 1200

ggtcagcacc gtttctgcgg actggctttc tacgtgttcc gcttccttta gcagcccttg 1260

cgccctgagt gcttgcggca gcgtgagctt caaaagcgct ctgaagttcc tatactttct 1320

agagaatagg aacttcgaac tgcaggtcga cggatccccg gaatatcatc agcggacgcg 1380

gtgatgaagt gatcgaactg gcgaaaacaa actggctaag gtaa 1424

<210> 6

<211> 1424

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgtcgagta agttagtact ggttctgaac tgcggtagtt cttcactgaa atttgccatc 60

gtgtaggctg gagctgcttc gaagttccta tactttctag agaataggaa cttcggaata 120

ggaacttcaa gatcccctta ttagaagaac tcgtcaagaa ggcgatagaa ggcgatgcgc 180

tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc ggtcagccca ttcgccgcca 240

agctcttcag caatatcacg ggtagccaac gctatgtcct gatagcggtc cgccacaccc 300

agccggccac agtcgatgaa tccagaaaag cggccatttt ccaccatgat attcggcaag 360

caggcatcgc catgggtcac gacgagatcc tcgccgtcgg gcatgcgcgc cttgagcctg 420

gcgaacagtt cggctggcgc gagcccctga tgctcttcgt ccagatcatc ctgatcgaca 480

agaccggctt ccatccgagt acgtgctcgc tcgatgcgat gtttcgcttg gtggtcgaat 540

gggcaggtag ccggatcaag cgtatgcagc cgccgcattg catcagccat gatggatact 600

ttctcggcag gagcaaggtg agatgacagg agatcctgcc ccggcacttc gcccaatagc 660

agccagtccc ttcccgcttc agtgacaacg tcgagcacag ctgcgcaagg aacgcccgtc 720

gtggccagcc acgatagccg cgctgcctcg tcctgcagtt cattcagggc accggacagg 780

tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca gccggaacac ggcggcatca 840

gagcagccga ttgtctgttg tgcccagtca tagccgaata gcctctccac ccaagcggcc 900

ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa acgatcctca tcctgtctct 960

tgatcagatc ttgatcccct gcgccatcag atccttggcg gcaagaaagc catccagttt 1020

actttgcagg gcttcccaac cttaccagag ggcgccccag ctggcaattc cggttcgctt 1080

gctgtccata aaaccgccca gtctagctat cgccatgtaa gcccactgca agctacctgc 1140

tttctctttg cgcttgcgtt ttcccttgtc cagatagccc agtagctgac attcatccgg 1200

ggtcagcacc gtttctgcgg actggctttc tacgtgttcc gcttccttta gcagcccttg 1260

cgccctgagt gcttgcggca gcgtgagctt caaaagcgct ctgaagttcc tatactttct 1320

agagaatagg aacttcgaac tgcaggtcga cggatccccg gaatgttatc ccaaccaacg 1380

aagaactggt tatcgcgcaa gacgcgagcc gcctgactgc ctga 1424

<210> 7

<211> 822

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Met Thr Glu Tyr Asn Ser Glu Ala Tyr Leu Lys Lys Leu Asp Lys Trp

1 5 10 15

Trp Arg Ala Ala Thr Tyr Leu Gly Ala Gly Met Ile Phe Leu Lys Glu

20 25 30

Asn Pro Leu Phe Ser Val Thr Gly Thr Pro Ile Lys Ala Glu Asn Leu

35 40 45

Lys Ala Asn Pro Ile Gly His Trp Gly Thr Val Ser Gly Gln Thr Phe

50 55 60

Leu Tyr Ala His Ala Asn Arg Leu Ile Asn Lys Tyr Asp Gln Lys Met

65 70 75 80

Phe Tyr Met Gly Gly Pro Gly His Gly Gly Gln Ala Met Val Val Pro

85 90 95

Ser Tyr Leu Asp Gly Ser Tyr Thr Glu Ala Tyr Pro Glu Ile Thr Gln

100 105 110

Asp Leu Glu Gly Met Ser Arg Leu Phe Lys Arg Phe Ser Phe Pro Gly

115 120 125

Gly Ile Gly Ser His Met Thr Ala Gln Thr Pro Gly Ser Leu His Glu

130 135 140

Gly Gly Glu Leu Gly Tyr Val Leu Ser His Ala Thr Gly Ala Ile Leu

145 150 155 160

Asp Gln Pro Glu Gln Ile Ala Phe Ala Val Val Gly Asp Gly Glu Ala

165 170 175

Glu Thr Gly Pro Leu Met Thr Ser Trp His Ser Ile Lys Phe Ile Asn

180 185 190

Pro Lys Asn Asp Gly Ala Ile Leu Pro Ile Leu Asp Leu Asn Gly Phe

195 200 205

Lys Ile Ser Asn Pro Thr Leu Phe Ala Arg Thr Ser Asp Val Asp Ile

210 215 220

Arg Lys Phe Phe Glu Gly Leu Gly Tyr Ser Pro Arg Tyr Ile Glu Asn

225 230 235 240

Asp Asp Ile His Asp Tyr Met Ala Tyr His Lys Leu Ala Ala Glu Val

245 250 255

Phe Asp Lys Ala Ile Glu Asp Ile His Gln Ile Gln Lys Asp Ala Arg

260 265 270

Glu Asp Asn Arg Tyr Gln Asn Gly Glu Ile Pro Ala Trp Pro Ile Val

275 280 285

Ile Ala Arg Leu Pro Lys Gly Trp Gly Gly Pro Arg Tyr Asn Asp Trp

290 295 300

Ser Gly Pro Lys Phe Asp Gly Lys Gly Met Pro Ile Glu His Ser Phe

305 310 315 320

Arg Ala His Gln Val Pro Leu Pro Leu Ser Ser Lys Asn Met Gly Thr

325 330 335

Leu Pro Glu Phe Val Lys Trp Met Thr Ser Tyr Gln Pro Glu Thr Leu

340 345 350

Phe Asn Ala Asp Gly Ser Leu Lys Glu Glu Leu Arg Asp Phe Ala Pro

355 360 365

Lys Gly Glu Met Arg Met Ala Ser Asn Pro Val Thr Asn Gly Gly Val

370 375 380

Asp Ser Ser Asn Leu Val Leu Pro Asp Trp Gln Glu Phe Ala Asn Pro

385 390 395 400

Ile Ser Glu Asn Asn Arg Gly Lys Leu Leu Pro Asp Thr Asn Asp Asn

405 410 415

Met Asp Met Asn Val Leu Ser Lys Tyr Phe Ala Glu Ile Val Lys Leu

420 425 430

Asn Pro Thr Arg Phe Arg Leu Phe Gly Pro Asp Glu Thr Met Ser Asn

435 440 445

Arg Phe Trp Glu Met Phe Lys Val Thr Asn Arg Gln Trp Met Gln Val

450 455 460

Ile Lys Asn Pro Asn Asp Glu Phe Ile Ser Pro Glu Gly Arg Ile Ile

465 470 475 480

Asp Ser Gln Leu Ser Glu His Gln Ala Glu Gly Trp Leu Glu Gly Tyr

485 490 495

Thr Leu Thr Gly Arg Thr Gly Ala Phe Ala Ser Tyr Glu Ser Phe Leu

500 505 510

Arg Val Val Asp Ser Met Leu Thr Gln His Phe Lys Trp Ile Arg Gln

515 520 525

Ala Ala Asp Gln Lys Trp Arg His Asp Tyr Pro Ser Leu Asn Val Ile

530 535 540

Ser Thr Ser Thr Val Phe Gln Gln Asp His Asn Gly Tyr Thr His Gln

545 550 555 560

Asp Pro Gly Met Leu Thr His Leu Ala Glu Lys Lys Ser Asp Phe Ile

565 570 575

Arg Gln Tyr Leu Pro Ala Asp Gly Asn Thr Leu Leu Ala Val Phe Asp

580 585 590

Arg Ala Phe Gln Asp Arg Ser Lys Ile Asn His Ile Val Ala Ser Lys

595 600 605

Gln Pro Arg Gln Gln Trp Phe Thr Lys Glu Glu Ala Glu Lys Leu Ala

610 615 620

Thr Asp Gly Ile Ala Thr Ile Asp Trp Ala Ser Thr Ala Lys Asp Gly

625 630 635 640

Glu Ala Val Asp Leu Val Phe Ala Ser Ala Gly Ala Glu Pro Thr Ile

645 650 655

Glu Thr Leu Ala Ala Leu His Leu Val Asn Glu Val Phe Pro Gln Ala

660 665 670

Lys Phe Arg Tyr Val Asn Val Val Glu Leu Gly Arg Leu Gln Lys Lys

675 680 685

Lys Gly Ala Leu Asn Gln Glu Arg Glu Leu Ser Asp Glu Glu Phe Glu

690 695 700

Lys Tyr Phe Gly Pro Ser Gly Thr Pro Val Ile Phe Gly Phe His Gly

705 710 715 720

Tyr Glu Asp Leu Ile Glu Ser Ile Phe Tyr Gln Arg Gly His Asp Gly

725 730 735

Leu Ile Val His Gly Tyr Arg Glu Asp Gly Asp Ile Thr Thr Thr Tyr

740 745 750

Asp Met Arg Val Tyr Ser Glu Leu Asp Arg Phe His Gln Ala Ile Asp

755 760 765

Ala Met Gln Val Leu Tyr Val Asn Arg Lys Val Asn Gln Gly Leu Ala

770 775 780

Lys Ala Phe Ile Asp Arg Met Lys Arg Thr Leu Val Lys His Phe Glu

785 790 795 800

Val Thr Arg Asn Glu Gly Val Asp Ile Pro Asp Phe Thr Glu Trp Val

805 810 815

Trp Ser Asp Leu Lys Lys

820

<210> 8

<211> 714

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 8

Met Ser Arg Ile Ile Met Leu Ile Pro Thr Gly Thr Ser Val Gly Leu

1 5 10 15

Thr Ser Val Ser Leu Gly Val Ile Arg Ala Met Glu Arg Lys Gly Val

20 25 30

Arg Leu Ser Val Phe Lys Pro Ile Ala Gln Pro Arg Thr Gly Gly Asp

35 40 45

Ala Pro Asp Gln Thr Thr Thr Ile Val Arg Ala Asn Ser Ser Thr Thr

50 55 60

Thr Ala Ala Glu Pro Leu Lys Met Ser Tyr Val Glu Gly Leu Leu Ser

65 70 75 80

Ser Asn Gln Lys Asp Val Leu Met Glu Glu Ile Val Ala Asn Tyr His

85 90 95

Ala Asn Thr Lys Asp Ala Glu Val Val Leu Val Glu Gly Leu Val Pro

100 105 110

Thr Arg Lys His Gln Phe Ala Gln Ser Leu Asn Tyr Glu Ile Ala Lys

115 120 125

Thr Leu Asn Ala Glu Ile Val Phe Val Met Ser Gln Gly Thr Asp Thr

130 135 140

Pro Glu Gln Leu Lys Glu Arg Ile Glu Leu Thr Arg Asn Ser Phe Gly

145 150 155 160

Gly Ala Lys Asn Thr Asn Ile Thr Gly Val Ile Val Asn Lys Leu Asn

165 170 175

Ala Pro Val Asp Glu Gln Gly Arg Thr Arg Pro Asp Leu Ser Glu Ile

180 185 190

Phe Asp Asp Ser Ser Lys Ala Lys Val Asn Asn Val Asp Pro Ala Lys

195 200 205

Leu Gln Glu Ser Ser Pro Leu Pro Val Leu Gly Ala Val Pro Trp Ser

210 215 220

Phe Asp Leu Ile Ala Thr Arg Ala Ile Asp Met Ala Arg His Leu Asn

225 230 235 240

Ala Thr Ile Ile Asn Glu Gly Asp Ile Asn Thr Arg Arg Val Lys Ser

245 250 255

Val Thr Phe Cys Ala Arg Ser Ile Pro His Met Leu Glu His Phe Arg

260 265 270

Ala Gly Ser Leu Leu Val Thr Ser Ala Asp Arg Pro Asp Val Leu Val

275 280 285

Ala Ala Cys Leu Ala Ala Met Asn Gly Val Glu Ile Gly Ala Leu Leu

290 295 300

Leu Thr Gly Gly Tyr Glu Met Asp Ala Arg Ile Ser Lys Leu Cys Glu

305 310 315 320

Arg Ala Phe Ala Thr Gly Leu Pro Val Phe Met Val Asn Thr Asn Thr

325 330 335

Trp Gln Thr Ser Leu Ser Leu Gln Ser Phe Asn Leu Glu Val Pro Val

340 345 350

Asp Asp His Glu Arg Ile Glu Lys Val Gln Glu Tyr Val Ala Asn Tyr

355 360 365

Ile Asn Ala Asp Trp Ile Glu Ser Leu Thr Ala Thr Ser Glu Arg Ser

370 375 380

Arg Arg Leu Ser Pro Pro Ala Phe Arg Tyr Gln Leu Thr Glu Leu Ala

385 390 395 400

Arg Lys Ala Gly Lys Arg Ile Val Leu Pro Glu Gly Asp Glu Pro Arg

405 410 415

Thr Val Lys Ala Ala Ala Ile Cys Ala Glu Arg Gly Ile Ala Thr Cys

420 425 430

Val Leu Leu Gly Asn Pro Ala Glu Ile Asn Arg Val Ala Ala Ser Gln

435 440 445

Gly Val Glu Leu Gly Ala Gly Ile Glu Ile Val Asp Pro Glu Val Val

450 455 460

Arg Glu Ser Tyr Val Gly Arg Leu Val Glu Leu Arg Lys Asn Lys Gly

465 470 475 480

Met Thr Glu Thr Val Ala Arg Glu Gln Leu Glu Asp Asn Val Val Leu

485 490 495

Gly Thr Leu Met Leu Glu Gln Asp Glu Val Asp Gly Leu Val Ser Gly

500 505 510

Ala Val His Thr Thr Ala Asn Thr Ile Arg Pro Pro Leu Gln Leu Ile

515 520 525

Lys Thr Ala Pro Gly Ser Ser Leu Val Ser Ser Val Phe Phe Met Leu

530 535 540

Leu Pro Glu Gln Val Tyr Val Tyr Gly Asp Cys Ala Ile Asn Pro Asp

545 550 555 560

Pro Thr Ala Glu Gln Leu Ala Glu Ile Ala Ile Gln Ser Ala Asp Ser

565 570 575

Ala Ala Ala Phe Gly Ile Glu Pro Arg Val Ala Met Leu Ser Tyr Ser

580 585 590

Thr Gly Thr Ser Gly Ala Gly Ser Asp Val Glu Lys Val Arg Glu Ala

595 600 605

Thr Arg Leu Ala Gln Glu Lys Arg Pro Asp Leu Met Ile Asp Gly Pro

610 615 620

Leu Gln Tyr Asp Ala Ala Val Met Ala Asp Val Ala Lys Ser Lys Ala

625 630 635 640

Pro Asn Ser Pro Val Ala Gly Arg Ala Thr Val Phe Ile Phe Pro Asp

645 650 655

Leu Asn Thr Gly Asn Thr Thr Tyr Lys Ala Val Gln Arg Ser Ala Asp

660 665 670

Leu Ile Ser Ile Gly Pro Met Leu Gln Gly Met Arg Lys Pro Val Asn

675 680 685

Asp Leu Ser Arg Gly Ala Leu Val Asp Asp Ile Val Tyr Thr Ile Ala

690 695 700

Leu Thr Ala Ile Gln Ser Ala Gln Gln Gln

705 710

<210> 9

<211> 891

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 9

Met Ala Val Thr Asn Val Ala Glu Leu Asn Ala Leu Val Glu Arg Val

1 5 10 15

Lys Lys Ala Gln Arg Glu Tyr Ala Ser Phe Thr Gln Glu Gln Val Asp

20 25 30

Lys Ile Phe Arg Ala Ala Ala Leu Ala Ala Ala Asp Ala Arg Ile Pro

35 40 45

Leu Ala Lys Met Ala Val Ala Glu Ser Gly Met Gly Ile Val Glu Asp

50 55 60

Lys Val Ile Lys Asn His Phe Ala Ser Glu Tyr Ile Tyr Asn Ala Tyr

65 70 75 80

Lys Asp Glu Lys Thr Cys Gly Val Leu Ser Glu Asp Asp Thr Phe Gly

85 90 95

Thr Ile Thr Ile Ala Glu Pro Ile Gly Ile Ile Cys Gly Ile Val Pro

100 105 110

Thr Thr Asn Pro Thr Ser Thr Ala Ile Phe Lys Ser Leu Ile Ser Leu

115 120 125

Lys Thr Arg Asn Ala Ile Ile Phe Ser Pro His Pro Arg Ala Lys Asp

130 135 140

Ala Thr Asn Lys Ala Ala Asp Ile Val Leu Gln Ala Ala Ile Ala Ala

145 150 155 160

Gly Ala Pro Lys Asp Leu Ile Gly Trp Ile Asp Gln Pro Ser Val Glu

165 170 175

Leu Ser Asn Ala Leu Met His His Pro Asp Ile Asn Leu Ile Leu Ala

180 185 190

Thr Gly Gly Pro Gly Met Val Lys Ala Ala Tyr Ser Ser Gly Lys Pro

195 200 205

Ala Ile Gly Val Gly Ala Gly Asn Thr Pro Val Val Ile Asp Glu Thr

210 215 220

Ala Asp Ile Lys Arg Ala Val Ala Ser Val Leu Met Ser Lys Thr Phe

225 230 235 240

Asp Asn Gly Val Ile Cys Ala Ser Glu Gln Ser Val Val Val Val Asp

245 250 255

Ser Val Tyr Asp Ala Val Arg Glu Arg Phe Ala Thr His Gly Gly Tyr

260 265 270

Leu Leu Gln Gly Lys Glu Leu Lys Ala Val Gln Asp Val Ile Leu Lys

275 280 285

Asn Gly Ala Leu Asn Ala Ala Ile Val Gly Gln Pro Ala Tyr Lys Ile

290 295 300

Ala Glu Leu Ala Gly Phe Ser Val Pro Glu Asn Thr Lys Ile Leu Ile

305 310 315 320

Gly Glu Val Thr Val Val Asp Glu Ser Glu Pro Phe Ala His Glu Lys

325 330 335

Leu Ser Pro Thr Leu Ala Met Tyr Arg Ala Lys Asp Phe Glu Asp Ala

340 345 350

Val Glu Lys Ala Glu Lys Leu Val Ala Met Gly Gly Ile Gly His Thr

355 360 365

Ser Cys Leu Tyr Thr Asp Gln Asp Asn Gln Pro Ala Arg Val Ser Tyr

370 375 380

Phe Gly Gln Lys Met Lys Thr Ala Arg Ile Leu Ile Asn Thr Pro Ala

385 390 395 400

Ser Gln Gly Gly Ile Gly Asp Leu Tyr Asn Phe Lys Leu Ala Pro Ser

405 410 415

Leu Thr Leu Gly Cys Gly Ser Trp Gly Gly Asn Ser Ile Ser Glu Asn

420 425 430

Val Gly Pro Lys His Leu Ile Asn Lys Lys Thr Val Ala Lys Arg Ala

435 440 445

Glu Asn Met Leu Trp His Lys Leu Pro Lys Ser Ile Tyr Phe Arg Arg

450 455 460

Gly Ser Leu Pro Ile Ala Leu Asp Glu Val Ile Thr Asp Gly His Lys

465 470 475 480

Arg Ala Leu Ile Val Thr Asp Arg Phe Leu Phe Asn Asn Gly Tyr Ala

485 490 495

Asp Gln Ile Thr Ser Val Leu Lys Ala Ala Gly Val Glu Thr Glu Val

500 505 510

Phe Phe Glu Val Glu Ala Asp Pro Thr Leu Ser Ile Val Arg Lys Gly

515 520 525

Ala Glu Leu Ala Asn Ser Phe Lys Pro Asp Val Ile Ile Ala Leu Gly

530 535 540

Gly Gly Ser Pro Met Asp Ala Ala Lys Ile Met Trp Val Met Tyr Glu

545 550 555 560

His Pro Glu Thr His Phe Glu Glu Leu Ala Leu Arg Phe Met Asp Ile

565 570 575

Arg Lys Arg Ile Tyr Lys Phe Pro Lys Met Gly Val Lys Ala Lys Met

580 585 590

Ile Ala Val Thr Thr Thr Ser Gly Thr Gly Ser Glu Val Thr Pro Phe

595 600 605

Ala Val Val Thr Asp Asp Ala Thr Gly Gln Lys Tyr Pro Leu Ala Asp

610 615 620

Tyr Ala Leu Thr Pro Asp Met Ala Ile Val Asp Ala Asn Leu Val Met

625 630 635 640

Asp Met Pro Lys Ser Leu Cys Ala Phe Gly Gly Leu Asp Ala Val Thr

645 650 655

His Ala Met Glu Ala Tyr Val Ser Val Leu Ala Ser Glu Phe Ser Asp

660 665 670

Gly Gln Ala Leu Gln Ala Leu Lys Leu Leu Lys Glu Tyr Leu Pro Ala

675 680 685

Ser Tyr His Glu Gly Ser Lys Asn Pro Val Ala Arg Glu Arg Val His

690 695 700

Ser Ala Ala Thr Ile Ala Gly Ile Ala Phe Ala Asn Ala Phe Leu Gly

705 710 715 720

Val Cys His Ser Met Ala His Lys Leu Gly Ser Gln Phe His Ile Pro

725 730 735

His Gly Leu Ala Asn Ala Leu Leu Ile Cys Asn Val Ile Arg Tyr Asn

740 745 750

Ala Asn Asp Asn Pro Thr Lys Gln Thr Ala Phe Ser Gln Tyr Asp Arg

755 760 765

Pro Gln Ala Arg Arg Arg Tyr Ala Glu Ile Ala Asp His Leu Gly Leu

770 775 780

Ser Ala Pro Gly Asp Arg Thr Ala Ala Lys Ile Glu Lys Leu Leu Ala

785 790 795 800

Trp Leu Glu Thr Leu Lys Ala Glu Leu Gly Ile Pro Lys Ser Ile Arg

805 810 815

Glu Ala Gly Val Gln Glu Ala Asp Phe Leu Ala Asn Val Asp Lys Leu

820 825 830

Ser Glu Asp Ala Phe Asp Asp Gln Cys Thr Gly Ala Asn Pro Arg Tyr

835 840 845

Pro Leu Ile Ser Glu Leu Lys Gln Ile Leu Leu Asp Thr Tyr Tyr Gly

850 855 860

Arg Asp Tyr Val Glu Gly Glu Thr Ala Ala Lys Lys Glu Ala Ala Pro

865 870 875 880

Ala Lys Ala Glu Lys Lys Ala Lys Lys Ser Ala

885 890

Claims (9)

1. A construction method of a recombinant bacterium comprises the following steps of carrying out A1-A6 transformation on a recipient bacterium to obtain the recombinant bacterium;

a1, knocking out ribulose phosphate isomerase gene of the recipient bacterium or inhibiting the expression of the ribulose phosphate isomerase gene or inhibiting the activity of the protein encoded by the ribulose phosphate isomerase gene;

a2, knocking out the pyruvate oxidase gene of the recipient bacterium or inhibiting the expression of the pyruvate oxidase gene or inhibiting the activity of a protein encoded by the pyruvate oxidase gene;

a3, knocking out the acetate kinase gene of the receptor bacterium or inhibiting the expression of the acetate kinase gene or inhibiting the activity of a protein encoded by the acetate kinase gene;

a4, increasing the expression level of a protein encoded by a xylulose lyase gene in the recipient bacterium or enhancing the activity of a protein encoded by a xylulose lyase gene;

a5, increasing the expression level of a protein encoded by phosphotransacetylase in the recipient bacterium or enhancing the activity of a protein encoded by the phosphotransacetylase gene;

a6, increasing the expression level of the protein coded by the bifunctional acetaldehyde ethanol dehydrogenase gene in the recipient bacterium or enhancing the activity of the protein coded by the bifunctional acetaldehyde ethanol dehydrogenase gene;

the recipient bacterium is a bacterium or fungus containing the ribulose phosphate isomerase gene, the pyruvate oxidase gene and the acetate kinase gene.

2. The method of claim 1, wherein the recipient bacterium is Escherichia coli.

3. The method of claim 1, wherein the recipient bacterium is escherichia coli MG1655 or escherichia coli JM 109.

4. A method according to any one of claims 1 to 3, wherein:

the xylulose lyase gene may encode proteins of e1 and e 2:

e1, a protein consisting of the amino acid sequence shown in SEQ ID No. 7;

e2, a protein derived from e1) having xylulose lyase activity by substitution and/or deletion and/or addition of one or several amino acid residues in the amino acid sequence shown in SEQ ID No. 7;

the phosphotransacetylase gene may encode proteins of f1 and f 2:

f1, a protein consisting of the amino acid sequence shown in SEQ ID No. 8;

f2, protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No.8 and is derived from f1) and has phosphotransacetylase activity;

the bifunctional acetaldehyde ethanol dehydrogenase gene can code proteins of g1 and g 2:

g1, a protein consisting of the amino acid sequence shown in SEQ ID No. 9;

g2, protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No.9 and has bifunctional acetaldehyde ethanol dehydrogenase activity and is derived from g 1).

5. The method according to any one of claims 1 to 4,

the xylulose lyase gene is any one DNA molecule of e11-e 13:

e11) the coding sequence is cDNA or genome DNA of 70 th to 2458 th nucleotides of SEQ ID NO. 1;

e12) cDNA or genomic DNA hybridizing under stringent conditions to the DNA molecule defined in e11) and encoding said xylulose cleaving enzyme;

e13) a cDNA or genomic DNA having 90% identity to the DNA molecule defined in e11) or e12) and encoding said xylulose lyase;

the phosphotransacetylase is any one DNA molecule of f11-f 13:

f11) the coding sequence is cDNA or genome DNA of 70 th-2215 th nucleotide of SEQ ID NO. 2;

f12) cDNA or genomic DNA hybridizing under stringent conditions to the DNA molecule defined in f11) and encoding said phosphotransacetylase;

f13) a cDNA or genomic DNA having 90% identity to the DNA molecule defined in f11) or f12) and encoding the phosphotransacetylase;

the acetaldehyde ethanol dehydrogenase is any one DNA molecule of g11-g 13:

g11) the coding sequence is cDNA or genome DNA of 70 th-2746 th nucleotide of SEQ ID NO. 3;

g12) cDNA or genomic DNA which hybridizes under stringent conditions with the DNA molecule defined in g11) and codes for the acetaldehyde ethanol dehydrogenase;

g13) cDNA or genomic DNA having 90% identity to the DNA molecule defined in g11) or g12) and encoding the acetaldehyde ethanol dehydrogenase.

6. A recombinant bacterium constructed by the recombinant bacterium construction method of any one of claims 1 to 5.

7. Use of the recombinant bacterium of claim 6 for the production of ethanol.

8. Use according to claim 7, wherein ethanol production is carried out using xylose as carbon source.

9. A method for preparing ethanol by using the recombinant bacterium of any one of claims 1 to 6, wherein the method comprises using xylose as a carbon source to carry out bioconversion by using the recombinant bacterium to prepare ethanol.

Images