CN107603998A - Utilize the genetic engineering bacterium and its construction method of acetic acid production glycolic and application - Google Patents
Utilize the genetic engineering bacterium and its construction method of acetic acid production glycolic and application Download PDFInfo
- Publication number
- CN107603998A CN107603998A CN201710940646.1A CN201710940646A CN107603998A CN 107603998 A CN107603998 A CN 107603998A CN 201710940646 A CN201710940646 A CN 201710940646A CN 107603998 A CN107603998 A CN 107603998A
- Authority
- CN
- China
- Prior art keywords
- sequence
- ala
- leu
- gly
- glu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention discloses a kind of genetic engineering bacterium using acetic acid production glycolic and its construction method and application.The method provided by the present invention for preparing the engineering bacteria for producing glycolic, comprises the following steps：Improve acetyl-CoA-synthetase, phosphate transacetylase, acetokinase, citrate synthase, isocitrate lyase, isocitric dehydrogenase kinases, the expression of glyoxylate reductase and/or activity in recipient bacterium, and malate synthase, the expression of glycolate oxidase and isocitrate lyase aporepressor and/or activity in the recipient bacterium are reduced, so as to obtain the engineering bacteria for being used to produce glycolic；The recipient bacterium is that the bacterium of carbon source for growth can be used as using acetic acid.Recombinant bacterium prepared by the present invention can produce glycolic by carbon source of acetic acid, and the yield of the glycolic in Shaking culture and yield can reach higher level, have preferable industrial applications prospect.
Description
Technical field
The invention belongs to biotechnology, genetic engineering and field of fermentation engineering, relate to the use of the base of acetic acid production glycolic
Because of engineering bacteria and its construction method and application.
Background technology
Glycolic (Glycolic acid), also known as hydroxyacetic acid, it is the most simple member in hydroxycarboxylic acid family.Ethanol
Acid is a small molecule for having alcohol and medium strong acid function concurrently, is a kind of important organic synthesis raw material.Glycolic is in chemical industry, doctor
The multiple fields such as medicine, weaving and metallurgy are widely used.For example, the mixed acid of 2% glycolic and 1% formic acid is a kind of efficiently low
The cleaning agent of cost, the cleaning available for boiler, pipeline, condenser and heat exchanger etc.；Glyclolic acid molecules are small, can effectively permeate
Pore, solve the problems such as skin aging, wrinkle and dark sore, be commonly used for cosmetic additive agent；Glycolic is commonly used in textile industry to make
For dyeing and finishing wool fiber and the crosslinking couplant of cellulose fabric；In addition, glycolic also acts as bactericide, bonding agent, oil
Demulsifier, welding compound and chemical assistant etc..
In nature, glycolic is present in sugarcane, beet and immature grape juice, content it is low and with a variety of things
Matter coexists, and isolates and purifies more difficult.Glycolic is generally industrially obtained using the method for chemical synthesis, its preparation method has chlorine
Acetic, formaldehyde carbonylation method and cyaniding etc..Chemical synthesis production glycolic technique is more ripe, is commonly used at present
Industrial preparation process, but the harsh (strong acid of material toxicity big (formaldehyde, carbon monoxide, cyanide etc.), working condition be present
Or highly basic, HTHP), consersion unit require high, isolate and purify the problems such as complicated and environmental pollution, do not meet current low-carbon,
Environmental protection, sustainable development theory, there is an urgent need to develop new green syt route and technique.
Nitrilase can be catalyzed the hydrolysis generation glycolic of hydroxyacetonitrile, Acidovorax facilis, Rhodococcus
Nitrilase in the microorganisms such as rhodochrous and Brevibacterium casei has the activity, and this causes enzyme process to close
It is achieved into glycolic.It is excellent that enzymatic clarification has that reaction condition is gentle, equipment requirement is relatively low and products obtained therefrom concentration is higher etc.
Point, but in terms of raw material, hydroxyacetonitrile belongs to the organic severe toxicity of B classes from petrochemicals such as formaldehyde and hydrogen cyanide
Article, it is unfavorable for large-scale industrial production.
Two-step oxidation reaction generation glycolic can occur in the presence of lactaldehyde reductase and glycolaldehyde dehydrogenase for ethylene glycol.
Kataoka etc. screens two plants of microorganism --- Pichia naganishii AKU for being capable of Oxidation of Glycol generation glycolic
4267 and Rhodotorula sp.3Pr-126, using 10% ethylene glycol as substrate, 35.3g/L and 25.1g/L can be obtained respectively
Glycolic (Kataoka, M., Sasaki, M., Hidalgo, A., Nakano, M., Shimizu, S., 2001.Glycolic
acid production using ethylene glycol-oxidizing
microorganisms.Biosci.Biotechnol.Biochem.65,2265-2270).Wei etc. utilizes Gluconobacter
Oxydans conversion of resting cells ethylene glycol synthesizing of glycolate, the ethylene glycol reforming rates of 48h are up to 86.7%, ethanol acid yield
70.2g/L(Wei,G.D.,Yang,X.P.,Gan,T.L.,Zhou,W.Y.,Lin,J.P.,Wei,D.Z.,2009.High
cell density fermentation of Gluconobacter oxydans DSM 2003for glycolic acid
production.J.Ind.Microbiol.Biotechnol.36,1029-1034).As a kind of chemical products, ethylene glycol master
Come from non-renewable petroleum resources, utilize it as substrate come synthesizing of glycolate not in full conformity with sustainable development will
Ask.
Glycolic is obtained using renewable biomass resources by the method for microbial fermentation, can avoid chemical method with
The drawbacks of enzymatic clarification, meet the requirement of following green chemical industry development.At present, studies have reported that utilizing glucose and wood
The problems such as sugar etc. are the glycolic route of synthesis and production bacterial strain of substrate, but cost of material is high still has to be solved.
The cheap raw material of wide material sources, cost is found, by Production by Microorganism Fermentation glycolic, there is good industry
Application prospect.Application of the non-traditional carbon source such as acetic acid, methane, methanol and synthesis gas in fermentation industry is also rare, such carbon
Source is compared with carbohydrate such as traditional glucose etc., and cost is relatively low and easy acquisition, its development and application are increasingly becoming
There are the hot fields of applications well prospect in industrial biotechnology.Escherichia coli, corynebacterium glutamicum and yeast microorganism can
To use acetic acid as carbon source for growth.
The content of the invention
It is an object of the invention to provide a kind of genetic engineering bacterium using acetic acid production glycolic and its construction method and answer
With.
The method provided by the present invention for preparing the engineering bacteria for producing glycolic, comprises the following steps：Improve acceptor
Acetyl-CoA-synthetase, phosphate transacetylase, acetokinase, citrate synthase, isocitrate lyase, isocitric acid in bacterium
Dehydrogenase kinase, the expression of glyoxylate reductase and/or activity, and reduce malate synthase, glycolic oxygen in the recipient bacterium
Change expression and/or the activity of enzyme and isocitrate lyase aporepressor, so as to obtain the engineering for being used to produce glycolic
Bacterium；The recipient bacterium is that the bacterium of carbon source for growth can be used as using acetic acid.
Wherein, the amino acid sequence of the acetyl-CoA-synthetase concretely sequence 10 or possesses function in sequence table
Random or/and direct mutagenesis sequence.The amino acid sequence of the phosphate transacetylase concretely in sequence table sequence 11 or
Protect that functional is random or/and direct mutagenesis sequence.The amino acid sequence of the acetokinase concretely sequence in sequence table
12 or protect that functional is random or/and direct mutagenesis sequence.The concretely sequence table of the amino acid sequence of the citrate synthase
Middle sequence 13 protects that functional is random or/and direct mutagenesis sequence.The amino acid sequence of the isocitrate lyase is specific
Can be sequence 14 or to protect that functional is random or/and direct mutagenesis sequence in sequence table.The isocitric dehydrogenase kinases
Amino acid sequence concretely sequence 15 or protects that functional is random or/and direct mutagenesis sequence in sequence table.The glyoxalic acid
The amino acid sequence of reductase concretely sequence 16 or protects that functional is random or/and direct mutagenesis sequence in sequence table.Institute
It is malate synthase 1 and/or malate synthase 2 to state malate synthase；The amino acid sequence of the malate synthase 1 is concretely
Sequence 17 or protect that functional is random or/and direct mutagenesis sequence in sequence table；The amino acid sequence tool of the malate synthase 2
Body can be sequence 18 or to protect that functional is random or/and direct mutagenesis sequence in sequence table.The amino of the glycolate oxidase
Acid sequence concretely sequence 19 or protects that functional is random or/and direct mutagenesis sequence in sequence table.The isocitric acid splits
Solve the amino acid sequence of enzyme repression albumen and concretely sequence 20 or protect that functional is random or/and direct mutagenesis sequence in sequence table
Row.
In the present invention, it is described " to improve acetyl-CoA-synthetase, phosphate transacetylase, acetokinase, lemon in recipient bacterium
Lemon acid synthase, isocitrate lyase, isocitric dehydrogenase kinases, the expression of glyoxylate reductase and/or activity " is specifically
Pass through the encoding gene of the encoding gene (acs) of importing acetyl-CoA-synthetase, phosphate transacetylase into the recipient bacterium
(pta), the encoding gene (ackA) of acetokinase, the encoding gene (gltA) of citrate synthase, the volume of isocitrate lyase
Code gene (aceA), the encoding gene (aceK) of isocitric dehydrogenase kinases and the encoding gene (ycdW) of glyoxylate reductase
Come what is realized.It is described " to reduce malate synthase in the recipient bacterium, glycolate oxidase and isocitrate lyase aporepressor
Expression and/or activity " be by knocking out the encoding gene of malate synthase in the recipient bacterium (aceB, glcB), glycolic
The encoding gene of the encoding gene (glcD) of oxidizing ferment and the encoding gene (iclR) of isocitrate lyase aporepressor comes real
Existing.
In the present invention, the nucleotide sequence of the encoding gene (acs) of the acetyl-CoA-synthetase is specifically sequence table
The 70-2028 positions of middle sequence 2 protect that functional is random or/and direct mutagenesis sequence.The coding of the phosphate transacetylase
The nucleotides sequence of gene (pta) is classified as the 1347-3491 positions of sequence 3 in sequence table or protects functional at random or/and pinpoint
Mutagenized sequences.The nucleotides sequence of the encoding gene (ackA) of the acetokinase is classified as the 70-1272 positions of sequence 3 in sequence table
Or protect that functional is random or/and direct mutagenesis sequence.The nucleotide sequence of the encoding gene (gltA) of the citrate synthase
70-1353 positions for sequence in sequence table 1 protect that functional is random or/and direct mutagenesis sequence.The isocitric acid splits
It is random that the nucleotides sequence of the encoding gene (aceA) of solution enzyme is classified as the 70-1374 positions of sequence 5 or guarantor's functional in sequence table
Or/and direct mutagenesis sequence.The nucleotides sequence of the encoding gene (aceK) of the isocitric dehydrogenase kinases is classified as sequence table
The 1557-3293 positions of middle sequence 5 protect that functional is random or/and direct mutagenesis sequence.The volume of the glyoxylate reductase
The nucleotides sequence of code gene (ycdW) is classified as the 70-1008 positions of sequence 4 in sequence table or protects functional at random or/and pinpoint
Mutagenized sequences.The nucleotides sequence of the encoding gene (aceB) of the malate synthase 1 is classified as sequence 21 in sequence table or possesses work(
The random or/and direct mutagenesis sequence of energy.The nucleotides sequence of the encoding gene (glcB) of the malate synthase 2 is classified as sequence table
Middle sequence 22 protects that functional is random or/and direct mutagenesis sequence.The encoding gene (glcD) of the glycolate oxidase
Nucleotides sequence is classified as in sequence table sequence 23 or protects that functional is random or/and direct mutagenesis sequence.The isocitric acid cracking
The nucleotides sequence of the encoding gene (iclR) of enzyme repression albumen is classified as sequence 24 in sequence table or protects functional at random or/and determine
Point mutagenized sequences.
Further, in the present invention, the encoding gene (acs) of the acetyl-CoA-synthetase is by containing " startup
The DNA molecular of the encoding gene of son-acetyl-CoA-synthetase " structure is imported into the recipient bacterium；It is described to contain " startup
The DNA molecular of the encoding gene of son-acetyl-CoA-synthetase " structure is as shown in sequence 2 in sequence table.The phosphotransacetylase
The encoding gene (pta) of enzyme and the encoding gene (ackA) of the acetokinase are by containing " the volume of promoter-acetokinase
The DNA molecular of the encoding gene of code gene-phosphate transacetylase " structure is imported into the recipient bacterium；It is described to contain " startup
The institute of sequence 3 in the DNA molecular such as sequence table of the encoding gene of encoding gene-phosphate transacetylase of son-acetokinase " structure
Show.The encoding gene (gltA) of the citrate synthase is by containing " encoding gene of promoter-citrate synthase " structure
DNA molecular imported into the recipient bacterium；The DNA containing " encoding gene of promoter-citrate synthase " structure
Molecule is as shown in sequence 1 in sequence table.The encoding gene (aceA) of the isocitrate lyase and the isocitric acid dehydrogenation
The encoding gene (aceK) of kinase enzyme is by containing " the encoding gene of promoter-isocitrate lyase-isocitric acid dehydrogenation
The DNA molecular of the encoding gene of kinase enzyme " structure is imported into the recipient bacterium；It is described containing " promoter-isocitric acid splits
The DNA molecular of the encoding gene of encoding gene-isocitric dehydrogenase kinases of solution enzyme " structure is as shown in sequence 5 in sequence table.
The encoding gene (ycdW) of the glyoxylate reductase is by containing " encoding gene of promoter-glyoxylate reductase " structure
DNA molecular imported into the recipient bacterium；It is described containing " encoding gene of promoter-glyoxylate reductase " structure
DNA molecular is as shown in sequence 4 in sequence table.The encoding gene (aceB) of the malate synthase 1 is by λ-red homologous recombinations
Mode knocked out, the nucleotides sequence of wherein homologous recombination fragment is classified as sequence 6 in sequence table.The malate synthase 2
Encoding gene (glcB) be to be knocked out by way of λ-red homologous recombinations, the wherein nucleotides of homologous recombination fragment
Sequence is sequence 7 in sequence table.The encoding gene (glcD) of the glycolate oxidase is by way of λ-red homologous recombinations
Knocked out, the nucleotides sequence of wherein homologous recombination fragment is classified as sequence 8 in sequence table.The isocitrate lyase checks
The encoding gene (iclR) of albumen is knocked out by way of λ-red homologous recombinations, wherein the core of homologous recombination fragment
Nucleotide sequence is sequence 9 in sequence table.
More specifically, in the present invention, encoding gene (acs), the phosphoric acid of the acetyl-CoA-synthetase turn second
Encoding gene (pta), the encoding gene (ackA) of the acetokinase and the encoding gene of the citrate synthase of acyl enzyme
(gltA) it is to be imported into by recombinant expression carrier 1 in the recipient bacterium；The encoding gene of the isocitrate lyase
(aceA), the encoding gene (aceK) of the isocitric dehydrogenase kinases and the encoding gene of the glyoxylate reductase
(ycdW) it is to be imported into by recombinant expression carrier 2 in the recipient bacterium.The recombinant expression carrier 1 is by sequence in sequence table
DNA fragmentation shown in the 9-2028 positions of row 2 replaces the small fragment between the restriction enzyme site KpnI and XbaI of pUC19 plasmids, simultaneously
Between restriction enzyme site XbaI and HindIII that DNA fragmentation shown in the 9-3491 of sequence in sequence table 3 is replaced to pUC19 plasmids
Small fragment, while by DNA fragmentation shown in the 9-1353 of sequence in sequence table 1 replace pUC19 plasmids restriction enzyme site SacI
The recombinant plasmid obtained after small fragment between KpnI.The recombinant expression carrier 2 is by the 9- of sequence in sequence table 5
3293 shown DNA fragmentations replace the small fragment between the restriction enzyme site EcoRI and BamHI of pBBR1MCS-2 plasmids, same to sequential
DNA fragmentation shown in the 9-1008 positions of sequence 4 is replaced between the restriction enzyme site XhoI and EcoRI of pBBR1MCS-2 plasmids in list
Small fragment after obtained recombinant plasmid.
In the process, the recipient bacterium concretely Escherichia coli, corynebacterium glutamicum or saccharomycete.
In one embodiment of the invention, the recipient bacterium is Escherichia coli, specially E. coli
MG1655。
The engineering bacteria for being used to produce glycolic being prepared by method previously falls within protection scope of the present invention.
Application of the engineering bacteria in glycolic is produced using acetic acid as substrate falls within protection scope of the present invention.
The method of production glycolic provided by the present invention, specifically comprises the following steps：Using acetic acid as carbon source, fermentation training
The engineering bacteria is supported, tunning is collected, therefrom obtains glycolic.
Wherein, the condition of the fermented and cultured can be：37 DEG C of bottle concussion and cultivate 24-72h (such as 48h).The rotating speed tool of shaking flask
Body can be 200rpm.Used culture medium can be MM fluid nutrient mediums.
The composition of the MM fluid nutrient mediums is as follows：Every liter of culture medium acetic acid containing 10g, 2g NH4Cl、5.0g(NH4)2SO4、
6.0g KH2PO4, 8.214g MOPS, 0.5g NaCl, that is mould for 1mL trace element solutions, 0.1g ampicillins, 0.05g cards
Element, 2g dusty yeasts, surplus is water.
The composition of the trace element solution is as follows：Every liter of trace element solution FeCl containing 3.6g2·4H2O、5g
CaCl2·2H2O、1.3g MnCl2·2H2O、0.38g CuCl2·2H2O、0.5g CoCl2·6H2O、0.94g ZnCl2、
0.0311g H3BO3、0.4g Na2EDTA·2H2O, 1.01g thiamine-HCl, remaining is 0.5M HCl.
Beneficial effects of the present invention：The present invention is by the related gene of 7 metabolic pathways of expression in escherichia coli and striking
Except 4 endogenous genes, obtain and can ferment using acetic acid as carbon source and obtain the engineered strain of glycolic, and recombinant bacterium is shaking
The yield and yield of glycolic in bottle culture can reach higher level, have preferable industrial applications prospect.
Embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
Material used, reagent etc., unless otherwise specified, are commercially obtained in following embodiments.
Be related to the enzyme used in molecular biology manipulations in following embodiments, be purchased from NEB (New England Biolabs,
http://www.neb-china.com/) company；Kit used in plasmid extraction and DNA fragmentation recovery, is purchased from Beijing and wins
Mai De gene technology Co., Ltd (http://www.biomed168.com/)；The DNA synthesis being related in embodiment and sequencing work
Make, completed by Beijing Bo Maide gene technology Co., Ltd.
E.coli MG1655：The public can be from E.coli Genetic Resources at Yale CGSC, The
Coli Genetic Stock Center(http://cgsc2.biology.yale.edu/) obtain, numbering CGSC#6300.
E.coli NEB 5-alpha：The public can obtain from NEB (New England Biolabs) company, article No.
C2987I。
Plasmid pKD13：The public can be from E.coli Genetic Resources at Yale CGSC, The Coli
Genetic Stock Center are obtained, numbering CGSC#7633.
Plasmid pKD46：The public can be from E.coli Genetic Resources at Yale CGSC, The Coli
Genetic Stock Center are obtained, numbering CGSC#7739.
Plasmid pCP20：The public can be from E.coli Genetic Resources at Yale CGSC, The Coli
Genetic Stock Center are obtained, numbering CGSC#7637.
Plasmid pBBR1MCS-2：The public can voluntarily submit according to NCBI accession number U23751.1 sequence
Gene chemical synthesis company is obtained, and the plasmid is recorded in the following literature：Four new derivatives of the broad-
host-range cloning vector pBBR1MCS,carrying different antibiotic-resistance
cassettes,1995,Gene,166:175-176。
Plasmid pUC19：The public can obtain from NEB (New England Biolabs) company, article No. N3041S.
The composition of MM fluid nutrient mediums is as follows：Every liter of culture medium acetic acid containing 10g, 2g NH4Cl、5.0g(NH4)2SO4、6.0g
KH2PO4, 8.214g MOPS, 0.5g NaCl, 1mL trace element solutions, 0.1g ampicillins, 0.05g kanamycins, 2g ferment
Female powder, surplus are water.
Wherein, the composition of trace element solution is as follows：Every liter of trace element solution FeCl containing 3.6g2·4H2O、5g
CaCl2·2H2O、1.3g MnCl2·2H2O、0.38g CuCl2·2H2O、0.5g CoCl2·6H2O、0.94g ZnCl2、
0.0311g H3BO3、0.4g Na2EDTA·2H2O, 1.01g thiamine-HCl, remaining is 0.5M HCl.
Embodiment 1, structure recombinant bacterium E.coli Δ GA4 (pUC19-gltA-acs-pta-ackA+pMCS-ycdW-
aceAK)
First, recombinant expression carrier pUC19-gltA-acs-pta-ackA structure
1st, the DNA in artificial synthesized sequence table shown in sequence 1, containing gltA genes, upstream is SacI sites, and downstream is
KpnI sites, wherein 9-51 positions nucleotides is promoter sequence, 70-1353 positions nucleotides is gltA gene orders.
2nd, the DNA in artificial synthesized sequence table shown in sequence 2, containing acs genes, upstream is KpnI sites, and downstream is
XbaI sites, wherein 9-51 positions nucleotides is promoter sequence, 70-2028 positions nucleotides is acs gene orders.
3rd, the DNA in artificial synthesized sequence table shown in sequence 3, containing pta-ackA genes, upstream is XbaI sites, downstream
For HindIII sites, wherein 9-51 positions nucleotides is promoter sequence, 70-1272 positions nucleotides is ackA gene orders,
1347-3491 positions nucleotides is pta gene orders.
4th, with the DNA sequence dna synthesized in SacI and KpnI double digestion steps 1, the DNA fragmentation that recovery size is 1351bp；With
SacI and KpnI double digestion carrier pUC19, the DNA fragmentation that recovery size is 2680bp；By the two of above-mentioned 1351bp and 2680bp
Individual DNA fragmentation connection, obtains connection product and is imported into by the method for chemical conversion in E.coli NEB 5-alpha, and be coated with
In the LB solid mediums containing ammonia benzyl mycin, 37 DEG C of culture 16h, transformant is obtained.Extract the plasmid of transformant, with SacI and
KpnI carries out digestion verification, and digestion products size is 1351bp and 2680bp plasmid is positive plasmid, and this recombinant plasmid is ordered
Entitled pUC19-gltA.Obtained recombinant plasmid pUC19-gltA is subjected to sequence verification, the results showed that：In plasmid pUC19-
The DNA sequence dna as shown in the 9-1353 positions of sequence 1 in sequence table is inserted between gltA SacI and KpnI restriction enzyme sites, is shown
Plasmid is correct.
5th, with the DNA sequence dna synthesized in KpnI and XbaI double digestion steps 2, the DNA fragmentation that recovery size is 2026bp；With
KpnI and XbaI double digestion carrier pUC19, the DNA fragmentation that recovery size is 2671bp；By the two of above-mentioned 2026bp and 2671bp
Individual DNA fragmentation connection, obtains connection product and is imported into by the method for chemical conversion in E.coli NEB 5-alpha, and be coated with
In the LB solid mediums containing ammonia benzyl mycin, 37 DEG C of culture 16h, transformant is obtained.Extract the plasmid of transformant, with KpnI and
XbaI carries out digestion verification, and digestion products size is about 2026bp and 2671bp plasmid is positive plasmid, by this recombinant plasmid
It is named as pUC19-acs.Obtained recombinant plasmid pUC19-acs is subjected to sequence verification, the results showed that：In plasmid pUC19-
The DNA sequence dna as shown in the 9-2028 positions of sequence 2 in sequence table is inserted between acs KpnI and XbaI enzyme cutting site, is shown
Plasmid is correct.
6th, with the DNA sequence dna synthesized in XbaI and HindIII double digestion steps 3, the DNA pieces that recovery size is 3489bp
Section；With XbaI and HindIII double digestion carrier pUC19, the DNA fragmentation that recovery size is 2662bp；By above-mentioned 3489bp and
2662bp two DNA fragmentations connection, obtains connection product and imported into E.coli NEB 5- by the method for chemical conversion
In alpha, and the LB solid mediums containing ammonia benzyl mycin are coated on, 37 DEG C of culture 16h, obtain transformant.Extract transformant
Plasmid, carry out digestion verification with XbaI and HindIII, digestion products size is 3489bp and 2662bp plasmid is positive matter
Grain, pUC19-pta-ackA is named as by this recombinant plasmid.Obtained recombinant plasmid pUC19-pta-ackA is carried out into sequencing to test
Card, the results showed that：Sequence in being inserted between plasmid pUC19-pta-ackA XbaI and HindIII restriction enzyme sites such as sequence table
DNA sequence dna shown in 3 9-3491 positions, show that plasmid is correct.
7th, it is 4020bp's with the DNA sequence dna pUC19-gltA obtained in KpnI and XbaI double digestion steps 4, recovery size
DNA fragmentation；With the DNA sequence dna pUC19-acs obtained in KpnI and XbaI double digestion steps 5, the DNA that recovery size is 2022bp
Fragment；Above-mentioned 4020bp is connected with 2022bp two DNA fragmentations, connection product is obtained and is imported by the method for chemical conversion
Into E.coli NEB 5-alpha, and the LB solid mediums containing ammonia benzyl mycin are coated on, 37 DEG C of culture 16h, are turned
Beggar.The plasmid of transformant is extracted, carries out digestion verification with KpnI and XbaI, digestion products size is 4020bp's and 2022bp
Plasmid is positive plasmid, and this recombinant plasmid is named as into pUC19-gltA-acs.The recombinant plasmid pUC19-gltA- that will be obtained
Acs carries out sequence verification, the results showed that：Acs is inserted between plasmid pUC19-gltA-acs KpnI and XbaI enzyme cutting site
DNA sequence dna, show that plasmid is correct.
8th, it is with the DNA sequence dna pUC19-gltA obtained in XbaI and HindIII double digestion steps 4, recovery size
4007bp DNA fragmentation；With the DNA sequence dna pUC19-pta-ackA obtained in XbaI and HindIII double digestion steps 6, recovery
Size is 3489bp DNA fragmentation；Above-mentioned 4007bp is connected with 3489bp two DNA fragmentations, connection product is obtained and passes through
The method of chemical conversion is imported into E.coli NEB 5-alpha, and is coated on the LB solid mediums containing ammonia benzyl mycin,
37 DEG C of culture 16h, obtain transformant.The plasmid of transformant is extracted, carries out digestion verification with EcoRI and XhoI, digestion products are big
Small is that 4007bp and 3489bp plasmid is positive plasmid, and this recombinant plasmid is named as into pUC19-gltA-pta-ackA.Will
The recombinant plasmid pUC19-gltA-pta-ackA arrived carries out sequence verification, the results showed that：In plasmid pUC19-gltA-pta-
Pta-ackA fragments are inserted between ackA XbaI and HindIII restriction enzyme sites, show that plasmid is correct.
9th, it is with the DNA sequence dna pUC19-gltA-acs obtained in XbaI and HindIII double digestion steps 7, recovery size
6018bp DNA fragmentation；With the DNA sequence dna pUC19-pta-ackA obtained in XbaI and HindIII double digestion steps 6, recovery
Size is 3489bp DNA fragmentation；Above-mentioned 6018bp is connected with 3489bp two DNA fragmentations, connection product is obtained and passes through
The method of chemical conversion is imported into E.coli NEB 5-alpha, and is coated on the LB solid mediums containing ammonia benzyl mycin,
37 DEG C of culture 16h, obtain transformant.The plasmid of transformant is extracted, digestion verification, digestion products are carried out with XbaI and HindIII
Size is 6018bp and 3489bp plasmid is positive plasmid, and this recombinant plasmid is named as into pUC19-gltA-acs-pta-
ackA.Obtained recombinant plasmid pUC19-gltA-acs-pta-ackA is subjected to sequence verification, the results showed that：In plasmid
Pta-ackA fragments are inserted between pUC19-gltA-acs-pta-ackA XbaI and HindIII restriction enzyme sites, show plasmid just
Really.
Plasmid pUC19-gltA-acs-pta-ackA structure is described as：By the 9-2028 positions institute of sequence in sequence table 2
Show that DNA fragmentation replaces the small fragment between the restriction enzyme site KpnI and XbaI of pUC19 plasmids, while by sequence in sequence table 3
DNA fragmentation shown in 9-3491 replaces the small fragment between the restriction enzyme site XbaI and HindIII of pUC19 plasmids, while by sequence
DNA fragmentation shown in the 9-1353 of sequence 1 replaces the small fragment between the restriction enzyme site SacI and KpnI of pUC19 plasmids in list
The recombinant plasmid obtained afterwards.
2nd, recombinant expression carrier pMCS-ycdW-aceAK structure
1st, the DNA in artificial synthesized sequence table shown in sequence 4, containing ycdW genes, upstream is XhoI sites, and downstream is
EcoRI sites, wherein 9-51 positions nucleotides is promoter sequence, 70-1008 positions nucleotides is ycdW gene orders.
2nd, the DNA in artificial synthesized sequence table shown in sequence 5, containing aceA-aceK genes, upstream is EcoRI sites, under
Swim as BamHI sites, wherein 9-51 positions nucleotides is promoter sequence, 70-1374 positions nucleotides is aceA gene orders,
1557-3293 positions nucleotides is aceK gene orders.
3rd, with the DNA sequence dna synthesized in XhoI and EcoRI double digestion steps 1, the DNA fragmentation that recovery size is 1006bp；
With XhoI and EcoRI double digestion carrier pBBR1MCS-2, the DNA fragmentation that recovery size is 5111bp；By above-mentioned 1006bp and
5111bp two DNA fragmentations connection, obtains connection product and imported into E.coli NEB 5- by the method for chemical conversion
In alpha, and the LB solid mediums containing that penicillin of card are coated on, 37 DEG C of culture 16h, obtain transformant.Extraction conversion
The plasmid of son, carries out digestion verification, digestion products size is 1006bp and 5111bp plasmid is positive matter with XhoI and EcoRI
Grain, pMCS-ycdW is named as by this recombinant plasmid.Obtained recombinant plasmid pMCS-ycdW is subjected to sequence verification, as a result table
It is bright：The 9-1008 positions institute of sequence 4 in being inserted between plasmid pBBR1MCS-2 XhoI and EcoRI restriction enzyme sites such as sequence table
The DNA sequence dna shown, show that plasmid is correct.
4th, with the DNA sequence dna synthesized in EcoRI and BamHI double digestion steps 2, the DNA fragmentation that recovery size is 3291bp；
With the DNA sequence dna pMCS-ycdW obtained in EcoRI and BamHI double digestion steps 3, the DNA fragmentation that recovery size is 6099bp；
Above-mentioned 3291bp is connected with 6099bp two DNA fragmentations, connection product is obtained and is imported into by the method for chemical conversion
In E.coli NEB 5-alpha, and the LB solid mediums containing that penicillin of card are coated on, 37 DEG C of culture 16h, are turned
Beggar.The plasmid of transformant is extracted, carries out digestion verification with EcoRI and BamHI, digestion products size is 3291bp and 6099bp
Plasmid be positive plasmid, this recombinant plasmid is named as pMCS-ycdW-aceAK.The recombinant plasmid pMCS-ycdW- that will be obtained
AceAK carries out sequence verification, the results showed that：Inserted between plasmid pMCS-ycdW-aceAK EcoRI and BamHI restriction enzyme sites
DNA sequence dna as shown in the 9-3293 positions of sequence 5 in sequence table, shows that plasmid is correct.
Plasmid pMCS-ycdW-aceAK structure is described as：By DNA pieces shown in the 9-1008 positions of sequence in sequence table 4
Section replace pBBR1MCS-2 plasmids restriction enzyme site XhoI and EcoRI between small fragment, while in sequence table sequence 5 9-
Obtained after small fragment between the restriction enzyme site EcoRI and BamHI of 3293 shown DNA fragmentations replacement pBBR1MCS-2 plasmids
Recombinant plasmid.
3rd, E. coli Δ GA4 structure
1st, aceB genes are knocked out
1) the primer aceBF and aceBR used in aceB gene knockouts are synthesized, sequence is as follows：
aceBF：
5’-ATGACTGAACAGGCAACAACAACCGATGAACTGGCTTTCACAAGGCCGTATGGCGAGCAGGTGTAG
GCTGGAGCTGCTTCG-3’；
aceBR：
5’-TTTAATCAACAGGCGTGAGTAAGCATTCAGGAATGGTTTATCCATCGTCACTGCCTGTCTATTCCG
GGGATCCGTCGACC-3’。
2) using plasmid pKD13 as template, expand to obtain 1500bp or so DNA pieces using primer aceBF and aceBR, PCR
Section, is named as aceB homologous recombination fragments, agarose gel electrophoresis purifies to obtained DNA fragmentation.
By sequencing, the nucleotides sequence of aceB homologous recombination fragments is classified as sequence 6, wherein, 1-60 positions are aceB genes
Upstream homology arm, 61-1364 positions are FRT sequences and Kan resistant genes, and 1365-1424 positions are that aceB downstream of gene is homologous
Arm.
3) pKD46 is converted into F-strain E.coli MG1655 using the method for electricity conversion, and be coated on containing ammonia
The LB solid mediums of parasiticin, 30 DEG C of culture 24h, transformant is obtained, the checking of upgrading grain, obtains E.coli MG1655
(pKD46)。
4) E.coli MG1655 (pKD46) are inoculated into the LB fluid nutrient mediums containing ampicillin, 30 DEG C of cultures
1h, arabinose is added to final concentration 5g/L, continues to cultivate 1.5h, next prepares E.coli MG1655 (pKD46) impression
State cell, the DNA fragmentation obtained in step 2) is transferred in E.coli MG1655 (pKD46) competent cell, and be coated on
LB solid mediums containing kanamycins, 37 DEG C of culture 24h, obtain transformant.
5) method for utilizing bacterium colony PCR, using aceBF and aceBR as primer, will be sequenced after PCR primer purifying, screening is just
True aceB genes have been replaced by the clone of Kan resistant genes, obtain E.coli MG1655aceB-K (pKD46).
6) E.coli MG1655aceB-K (pKD46) are inoculated in LB fluid nutrient mediums, 42 DEG C of subcultures three times,
PKD46 plasmids are removed, obtain E.coli MG1655aceB-K；E.coli MG1655aceB-K are aceB genes by Kan genes
The E.coli MG1655 that substituted for.
7) E.coli MG1655aceB-K are inoculated into the LB fluid nutrient mediums containing kanamycins, 37 DEG C of cultures
24h, it is transferred in the LB fluid nutrient mediums containing kanamycins, 37 DEG C of culture 3h, prepares E.coli MG1655aceB-K impressions
State cell.
8) pCP20 is transformed into E.coli MG1655aceB-K competent cells using the method for electricity conversion, and be coated with
In the LB solid mediums containing ampicillin, 30 DEG C of culture 48h, transformant is obtained.
Using bacterium colony PCR method validation transformant, using aceBF and aceBR as primer, obtain 202bp fragments for sun
Property clone.
The positive colony is sent into sequencing, its bacterium obtained for the aceB genes on knockout E.coli MG1655 genomes,
The bacterium is inoculated into LB fluid nutrient mediums, 42 DEG C of passages three times, remove pCP20, are named as mutant E.coli Δs GA1.
2nd, glcB genes are knocked out
Method with above-mentioned 1 is essentially identical, the difference is that as follows：
It is as follows that glcB knocks out primer sequence：
glcBF：
5’-ATGAGTCAAACCATAACCCAGAGCCGTTTACGCATTGACGCCAATTTTAAACGTTTTGTGGTGTAG
GCTGGAGCTGCTTCG-3’；
glcBR：
5’-TTAATGACTTTC TTTTTC GCGTAAACGCCA GGCGTGTAATAACGGTTCGGTATAGCCGTTATT
CCGGGGATCCGTCGACC-3’；
The nucleotides sequence of glcB homologous recombination fragments is classified as sequence 7, wherein, 1-60 positions are that glcB upstream region of gene is homologous
Arm, 61-1364 positions are FRT sequences and Kan resistant genes, and 1365-1424 positions are glcB downstream of gene homology arms.
Transformation receptor bacterial strain is above-mentioned 1 obtained mutant E.coli Δs GA1.
Using bacterium colony PCR method validation transformant, using glcBF and glcBR as primer, the fragment for obtaining 202bp is positive
Clone.
The positive colony is sent into sequencing, it, will to knock out the bacterium that the glcB genes on E.coli Δ GA1 genomes obtain
The bacterium is inoculated into LB fluid nutrient mediums, and 42 DEG C of passages three times, remove pCP20, are named as mutant E.coli Δs GA2.
3rd, glcD genes are knocked out
Method with above-mentioned 1 is essentially identical, the difference is that as follows：
It is as follows that glcD knocks out primer sequence：
glcDF：
5’-ATGAGCATCTTGTACGAAGAGCGTCTTGATGGCGCTTTACCCGATGTCGACCGCACATCG
GTGTAGGCTGGAGCTGCTTCG-3’；
glcDR：
5’-ACGTCAGACTCCACGCCGTCCAGCTCGCATAACAAAATCGCTTCGGCGTCGACGGGATAA
ATTCCGGGGATCCGTCGACC-3’；
The nucleotides sequence of glcD homologous recombination fragments is classified as sequence 8, wherein, 1-60 positions are that glcD upstream region of gene is homologous
Arm, 61-1364 positions are FRT sequences and Kan resistant genes, and 1365-1424 positions are glcD downstream of gene homology arms.
Transformation receptor bacterial strain is above-mentioned 2 obtained mutant E.coli Δs GA2.
Using bacterium colony PCR method validation transformant, using glcDF and glcDR as primer, the fragment for obtaining 202bp is positive
Clone.
The positive colony is sent into sequencing, it, will to knock out the bacterium that the glcD genes on E.coli Δ GA2 genomes obtain
The bacterium is inoculated into LB fluid nutrient mediums, and 42 DEG C of passages three times, remove pCP20, are named as mutant E.coli Δs GA3.
4th, iclR genes are knocked out
Method with above-mentioned 1 is essentially identical, the difference is that as follows：
It is as follows that iclR knocks out primer sequence：
iclRF：
5’-ATGGTCGCACCCATTCCCGCGAAACGCGGCAGAAAACCCGCCGTTGCCACCGCACCAGCG
GTGTAGGCTGGAGCTGCTTCG-3’；
iclRR：
5’-TCAGCGCATTCCACCGTACGCCAGCGTCACTTCCTTCGCCGCTTTAATCACCATCGCGCCATTCCG
GGGATCCGTCGACC-3’；
The nucleotides sequence of iclR homologous recombination fragments is classified as sequence 9, wherein, 1-60 positions are that iclR upstream region of gene is homologous
Arm, 61-1364 positions are FRT sequences and Kan resistant genes, and 1365-1424 positions are iclR downstream of gene homology arms.
Transformation receptor bacterial strain is above-mentioned 3 obtained mutant E.coli Δs GA3.
Using bacterium colony PCR method validation transformant, using iclRF and iclRR as primer, the fragment for obtaining 202bp is positive
Clone.
The positive colony is sent into sequencing, it, will to knock out the bacterium that the iclR genes on E.coli Δ GA3 genomes obtain
The bacterium is inoculated into LB fluid nutrient mediums, and 42 DEG C of passages three times, remove pCP20, are named as mutant E.coli Δs GA4.
4th, recombinant bacterium E.coli Δs GA4 (pUC19-gltA-acs-pta-ackA+pMCS-ycdW-aceAK) structure
1st, the recombinant plasmid pUC19-gltA-acs-pta-ackA and above-mentioned two obtained recombinant plasmids obtained above-mentioned one
PMCS-ycdW-aceAK is transformed into above-mentioned three obtained E. coli Δ GA4 by the method for electricity conversion, and is coated on
LB solid mediums containing ampicillin and kanamycins, 37 DEG C of culture 24h.
2nd, picking monoclonal is in the LB fluid nutrient mediums containing ampicillin and kanamycins, 37 DEG C of culture 24h.
3rd, the plasmid of transformant is extracted, the correctness of conversion is verified, obtains the recombinant bacterium E.coli Δs containing two plasmids
GA4(pUC19-gltA-acs-pta-ackA+pMCS-ycdW-aceAK)。
E.coli Δs GA4 (pUC19-gltA-acs-pta-ackA+pMCS-ycdW-aceAK) be by gltA, acs, pta,
AckA, ycdW, aceA, aceK are transferred in E. coli MG1655, and the genome that will knock out E.coli MG1655
In malate synthase gene (aceB, glcB), glycolate oxidase gene (glcD) and isocitrate lyase aporepressor
The recombinant bacterium that gene (iclR) obtains.
5th, bacterium E.coli Δs GA4 (pUC19-gltA-acs-pta-ackA) structure is compareed
1st, the recombinant plasmid pUC19-gltA-acs-pta-ackA obtained above-mentioned one is transformed into by the method for electricity conversion
Above-mentioned three obtained E. coli Δ GA4, and the LB solid mediums containing ampicillin are coated on, 37 DEG C of cultures
24h。
2nd, picking monoclonal is in the LB fluid nutrient mediums containing ampicillin, 37 DEG C of culture 24h.
3rd, the plasmid of transformant is extracted, the correctness of conversion is verified, obtains the recombinant bacterium E.coli Δs GA4 containing plasmid
(pUC19-gltA-acs-pta-ackA)。
E.coli Δs GA4 (pUC19-gltA-acs-pta-ackA) is that gltA, acs, pta, ackA are transferred into Escherichia coli
In E.coliMG1655, and by knock out E.coli MG1655 genome in malate synthase gene (aceB, glcB), second
The recombinant bacterium that alcohol oxidase gene (glcD) and isocitrate lyase repressor protein gene (iclR) obtain.
6th, bacterium E.coli Δs GA4 (pMCS-ycdW-aceAK) structure is compareed
1st, the recombinant plasmid pMCS-ycdW-aceAK obtained above-mentioned two is transformed into above-mentioned three by the method for electricity conversion and obtained
The E. coli Δ GA4 arrived, and the LB solid mediums containing that penicillin of card are coated on, 37 DEG C of culture 24h.
2nd, picking monoclonal is in the LB fluid nutrient mediums containing that penicillin of card, 37 DEG C of culture 24h.
3rd, the plasmid of transformant is extracted, the correctness of conversion is verified, obtains the recombinant bacterium E.coli Δs GA4 containing plasmid
(pMCS-ycdW-aceAK)。
E.coli Δs GA4 (pMCS-ycdW-aceAK) is that ycdW, aceA, aceK are transferred into E. coli
In MG1655, and by knock out E.coli MG1655 genome in malate synthase gene (aceB, glcB), glycolic oxygen
The recombinant bacterium that change enzyme gene (glcD) and isocitrate lyase repressor protein gene (iclR) obtain.
7th, bacterium E.coli MG1655 (pUC19-gltA-acs-pta-ackA+pMCS-ycdW-aceAK) structure is compareed
1st, the recombinant plasmid pUC19-gltA-acs-pta-ackA and above-mentioned two obtained recombinant plasmids obtained above-mentioned one
PMCS-ycdW-aceAK is transformed into E. coli MG1655 by the method for electricity conversion, and is coated on blue or green containing ammonia benzyl
The LB solid mediums of mycin and kanamycins, 37 DEG C of culture 24h.
2nd, picking monoclonal is in the LB fluid nutrient mediums containing ampicillin and kanamycins, 37 DEG C of culture 24h.
3rd, the plasmid of transformant is extracted, the correctness of conversion is verified, obtains the recombinant bacterium E.coli containing two plasmids
MG1655(pUC19-gltA-acs-pta-ackA+pMCS-ycdW-aceAK)。
E.coli MG1655 (pUC19-gltA-acs-pta-ackA+pMCS-ycdW-aceAK) be by gltA, acs,
Pta, ackA, ycdW, aceA, aceK are transferred to the recombinant bacterium obtained in E. coli MG1655.
Embodiment 2, recombinant bacterium E.coli Δs GA4 (pUC19-gltA-acs-pta-ackA+pMCS-ycdW-aceAK) exist
Produce the application in glycolic
First, recombinant bacterium E.coli Δs GA4 (pUC19-gltA-acs-pta-ackA+pMCS-ycdW-aceAK) Shaking culture
Experiment
1st, the E.coli Δ GA4 (pUC19-gltA-acs-pta-ackA+pMCS-ycdW- prepared in embodiment 1 four
AceAK) in the LB fluid nutrient mediums containing ampicillin and kanamycins, cultivated under the conditions of 37 DEG C, rotating speed 200rpm
16h, as seed liquor.
2nd, 4% inoculum concentration by volume, seed liquor is inoculated into MM fluid nutrient mediums, liquid amount in 500ml shaking flasks
For 50ml, 48h is cultivated under the conditions of 37 DEG C, rotating speed 200rpm, during which collects zymotic fluid.
3rd, quantitative detection is carried out to glycolic caused by genetic engineering bacterium and the acetic acid of consumption by high performance liquid chromatography.Tool
Concrete conditions in the establishment of a specific crime is as follows：
Instrument：Shimadzu Corporation's Essentia LC series HPLC instrument, equipped with DGU-20A degassers, LC-16 liquid-feeding pumps, SIL-
16 type automatic samplers, RID-20A detectors.
Chromatographic condition：Bio-RadHPX-87H(7.8×300mm)；Flow velocity 0.50mL/min；37 DEG C of column temperature；
Mobile phase is 5mM aqueous sulfuric acids.
Detection method：
Take 0,1,2,3,4, the 5g/L glycolic standard items aqueous solution (Sigma-Aldrich, production code member 79141), use
0.22 μm of filtering with microporous membrane, the μ L of sample introduction 10, HPLC detections are carried out, with the chromatographic peak face of the glycolic standard liquid of various concentrations
Product is ordinate, and various concentrations concentration is abscissa, draws standard curve.The appearance time of glycolic is 12.914min.Take 0,
2nd, 4,6,8, the 10g/L acetic acid standard items aqueous solution (Sigma-Aldrich, production code member 64197), with 0.22 μm of miillpore filter
Filtering, the μ L of sample introduction 10, HPLC detections are carried out, the chromatographic peak area with the acetic acid standard liquid of various concentrations is ordinate, different
Concentration is abscissa, draws standard curve.The appearance time of acetic acid is 15.690min.
2mL zymotic fluid is taken, 10min is centrifuged in 12000rpm, its fermented supernatant fluid is transferred in new centrifuge tube, used
0.22 μm of filtering with microporous membrane, the μ L of sample introduction 10, carry out HPLC detections.
The glycolic chromatographic peak area of testing sample fermented supernatant fluid is substituted into above-mentioned standard curve, is calculated to be measured
The ethanol acid content of sample fermented supernatant fluid.It is bent that the acetic acid chromatographic peak area of testing sample fermented supernatant fluid is substituted into above-mentioned standard
In line, the remaining acetic acid content of testing sample fermented supernatant fluid is calculated, acetic acid content initial after inoculation is subtracted into fermentation
Remaining acetic acid content in supernatant obtains the acetic acid amount of recombinant bacterium consumption.
Second of the E.coli Δs GA4 (pUC19-gltA-acs-pta-ackA+pMCS-ycdW-aceAK) in Shaking culture
Alcohol acid yield and acetic acid consumption are as shown in table 1：
Table 1E.coli Δs GA4 (pUC19-gltA-acs-pta-ackA+pMCS-ycdW-aceAK) is in Shaking culture
Ethanol acid yield and acetic acid consumption
Note：Data are the average of gained is tested in repetition above three times in table.
As seen from Table 1, the recombinant bacterial strain that the present invention is built can be in the culture that addition acetic acid is carbon source
In base, fermentation obtains glycolic, and final ethanol acid yield is 4.30g/L, and the 60% of yield 0.76g/g, about theoretical yield.
2nd, bacterium E.coli Δs GA4 (pUC19-gltA-acs-pta-ackA) Shaking culture experiment is compareed
1st, the E.coli Δs GA4 (pUC19-gltA-acs-pta-ackA) prepared in embodiment 1 five is blue or green containing ammonia benzyl
In the LB fluid nutrient mediums of mycin, 16h is cultivated under the conditions of 37 DEG C, rotating speed 200rpm, as seed liquor.
2nd, 4% inoculum concentration by volume, is inoculated into MM fluid nutrient mediums by seed liquor and (contains ampicillin, without card
That mycin) in, liquid amount is 50ml in 500ml shaking flasks, and 48h is cultivated under the conditions of 37 DEG C, rotating speed 200rpm, during which collects fermentation
Liquid.
3rd, being detected by HPLC, described in 3 in actual conditions above-mentioned one, the accumulation for finding 48h glycolics is 0.16g/L,
Show gltA, acs, pta, ackA being transferred in Escherichia coli, while knock out the restructuring that aceB, glcB, glcD and iclR are obtained
Bacterium, resulting recombinant bacterium is using acetic acid as substrate, although energy synthesizing of glycolate, yield are very low.
3rd, bacterium E.coli Δs GA4 (pMCS-ycdW-aceAK) Shaking culture experiment is compareed
1st, the E.coli Δs GA4 (pMCS-ycdW-aceAK) prepared in embodiment 1 six is in the LB liquid containing kanamycins
In body culture medium, 16h is cultivated under the conditions of 37 DEG C, rotating speed 200rpm, as seed liquor.
2nd, 4% inoculum concentration by volume, is inoculated into MM fluid nutrient mediums by seed liquor and (contains kanamycins, without ammonia benzyl
Penicillin) in, liquid amount is 50ml in 500ml shaking flasks, and 48h is cultivated under the conditions of 37 DEG C, rotating speed 200rpm, during which collects fermentation
Liquid.
3rd, detected by HPLC, described in 3 in actual conditions above-mentioned one, the accumulation for finding glycolic is 3.33g/L, show by
YcdW, aceA, aceK are transferred in E. coli MG1655, while knock out what aceB, glcB, glcD and iclR were obtained
Recombinant bacterium, resulting recombinant bacterium can synthesize more glycolic using acetic acid as substrate, but prepared with embodiment 1 four
Recombinant bacterium also has certain gap.
4th, bacterium E.coli MG1655 (pUC19-gltA-acs-pta-ackA+pMCS-ycdW-aceAK) shaking flask is compareed
Culture experiment
1st, the E.coli MG1655 (pUC19-gltA-acs-pta-ackA+pMCS-ycdW- prepared in embodiment 1 seven
AceAK) in the LB fluid nutrient mediums containing ampicillin and kanamycins, cultivated under the conditions of 37 DEG C, rotating speed 200rpm
16h, as seed liquor.
2nd, 4% inoculum concentration by volume, it is (mould containing ampicillin and Ka Na that seed liquor is inoculated into MM fluid nutrient mediums
Element) in, liquid amount is 50ml in 500ml shaking flasks, and 72h is cultivated under the conditions of 37 DEG C, rotating speed 200rpm, during which collects zymotic fluid.
3rd, detected by HPLC, actual conditions above-mentioned one 3 described in, the accumulation for finding glycolic is 1.6g/L, is shown
GltA, acs, pta, ackA, ycdW, aceA, aceK are transferred in E. coli MG1655, resulting recombinant bacterium
Using acetic acid as substrate, although energy synthesizing of glycolate, yield are relatively low.
<110>Beijing University of Chemical Technology
<120>Utilize the genetic engineering bacterium and its construction method of acetic acid production glycolic and application
<130> GNCLN171814
<160> 24
<170> PatentIn version 3.5
<210> 1
<211> 1361
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 1
aagagctctt gacagctagc tcagtcctag gtataatgct agctactaga gaaagaggag 60
aaatatacca tggctgatac aaaagcaaaa ctcaccctca acggggatac agctgttgaa 120
ctggatgtgc tgaaaggcac gctgggtcaa gatgttattg atatccgtac tctcggttca 180
aaaggtgtgt tcacctttga cccaggcttc acttcaaccg catcctgcga atctaaaatt 240
acttttattg atggtgatga aggtattttg ctgcaccgcg gtttcccgat cgatcagctg 300
gcgaccgatt ctaactacct ggaagtttgt tacatcctgc tgaatggtga aaaaccgact 360
caggaacagt atgacgaatt taaaactacg gtgacccgtc ataccatgat ccacgagcag 420
attacccgtc tgttccatgc tttccgtcgc gactcgcatc caatggcagt catgtgtggt 480
attaccggcg cgctggcggc gttctatcac gactcgctgg atgttaacaa tcctcgtcac 540
cgtgaaattg ccgcgttccg cctgctgtcg aaaatgccga ccatggccgc gatgtgttac 600
aagtattcca ttggtcagcc atttgtttac ccgcgcaacg atctctccta cgccggtaac 660
ttcctgaata tgatgttctc cacgccgtgc gaaccgtatg aagttaatcc gattctggaa 720
cgtgctatgg accgtattct gatcctgcac gctgaccatg aacagaacgc ctctacctcc 780
accgtgcgta ccgctggctc ttcgggtgcg aacccgtttg cctgtatcgc agcaggtatt 840
gcttcactgt ggggacctgc gcacggcggt gctaacgaag cggcgctgaa aatgctggaa 900
gaaatcagct ccgttaaaca cattccggaa tttgttcgtc gtgcgaaaga caaaaatgat 960
tctttccgcc tgatgggctt cggtcaccgc gtgtacaaaa attacgaccc gcgcgccacc 1020
gtaatgcgtg aaacctgcca tgaagtgctg aaagagctgg gcacgaagga tgacctgctg 1080
gaagtggcta tggagctgga aaacatcgcg ctgaacgacc cgtactttat cgagaagaaa 1140
ctgtacccga acgtcgattt ctactctggt atcatcctga aagcgatggg tattccgtct 1200
tccatgttca ccgtcatttt cgcaatggca cgtaccgttg gctggatcgc ccactggagc 1260
gaaatgcaca gtgacggtat gaagattgcc cgtccgcgtc agctgtatac aggatatgaa 1320
aaacgcgact ttaaaagcga tatcaagcgt taaggtacca a 1361
<210> 2
<211> 2036
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 2
aaggtacctt gacagctagc tcagtcctag gtataatgct agctactaga gaaagaggag 60
aaatatacca tgagccaaat tcacaaacac accattcctg ccaacatcgc agaccgttgc 120
ctgataaacc ctcagcagta cgaggcgatg tatcaacaat ctattaacgt acctgatacc 180
ttctggggcg aacagggaaa aattcttgac tggatcaaac cttaccagaa ggtgaaaaac 240
acctcctttg cccccggtaa tgtgtccatt aaatggtacg aggacggcac gctgaatctg 300
gcggcaaact gccttgaccg ccatctgcaa gaaaacggcg atcgtaccgc catcatctgg 360
gaaggcgacg acgccagcca gagcaaacat atcagctata aagagctgca ccgcgacgtc 420
tgccgcttcg ccaataccct gctcgagctg ggcattaaaa aaggtgatgt ggtggcgatt 480
tatatgccga tggtgccgga agccgcggtt gcgatgctgg cctgcgcccg cattggcgcg 540
gtgcattcgg tgattttcgg cggcttctcg ccggaagccg ttgccgggcg cattattgat 600
tccaactcac gactggtgat cacttccgac gaaggtgtgc gtgccgggcg cagtattccg 660
ctgaagaaaa acgttgatga cgcgctgaaa aacccgaacg tcaccagcgt agagcatgtg 720
gtggtactga agcgtactgg cgggaaaatt gactggcagg aagggcgcga cctgtggtgg 780
cacgacctgg ttgagcaagc gagcgatcag caccaggcgg aagagatgaa cgccgaagat 840
ccgctgttta ttctctacac ctccggttct accggtaagc caaaaggtgt gctgcatact 900
accggcggtt atctggtgta cgcggcgctg acctttaaat atgtctttga ttatcatccg 960
ggtgatatct actggtgcac cgccgatgtg ggctgggtga ccggacacag ttacttgctg 1020
tacggcccgc tggcctgcgg tgcgaccacg ctgatgtttg aaggcgtacc caactggccg 1080
acgcctgccc gtatggcgca ggtggtggac aagcatcagg tcaatattct ctataccgca 1140
cccacggcga tccgcgcgct gatggcggaa ggcgataaag cgatcgaagg caccgaccgt 1200
tcgtcgctgc gcattctcgg ttccgtgggc gagccaatta acccggaagc gtgggagtgg 1260
tactggaaaa aaatcggcaa cgagaaatgt ccggtggtcg atacctggtg gcagaccgaa 1320
accggcggtt tcatgatcac cccgctgcct ggcgctaccg agctgaaagc cggttcggca 1380
acacgtccgt tcttcggcgt gcaaccggcg ctggtcgata acgaaggtaa cccgctggag 1440
ggggccaccg aaggtagcct ggtaatcacc gactcctggc cgggtcaggc gcgtacgctg 1500
tttggcgatc acgaacgttt tgaacagacc tacttctcca ccttcaaaaa tatgtatttc 1560
agcggcgacg gcgcgcgtcg cgatgaagat ggctattact ggataaccgg gcgtgtggac 1620
gacgtgctga acgtctccgg tcaccgtctg gggacggcag agattgagtc ggcgctggtg 1680
gcgcatccga agattgccga agccgccgta gtaggtattc cgcacaatat taaaggtcag 1740
gcgatctacg cctacgtcac gcttaatcac ggggaggaac cgtcaccaga actgtacgca 1800
gaagtccgca actgggtgcg taaagagatt ggcccgctgg cgacgccaga cgtgctgcac 1860
tggaccgact ccctgcctaa aacccgctcc ggcaaaatta tgcgccgtat tctgcgcaaa 1920
attgcggcgg gcgataccag caacctgggc gatacctcga cgcttgccga tcctggcgta 1980
gtcgagaagc tgcttgaaga gaagcaggct atcgcgatgc catcgtaatc tagaaa 2036
<210> 3
<211> 3499
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 3
aatctagatt gacagctagc tcagtcctag gtataatgct agctactaga gaaagaggag 60
aaatatacca tgtcgagtaa gttagtactg gttctgaact gcggtagttc ttcactgaaa 120
tttgccatca tcgatgcagt aaatggtgaa gagtaccttt ctggtttagc cgaatgtttc 180
cacctgcccg aagcacgtat caaatggaaa atggacggca ataaacagga agcggcttta 240
ggtgcaggcg ccgctcacag cgaagcgctc aactttatcg ttaatactat tctggcacaa 300
aaaccagaac tgtctgcgca gctgactgct atcggtcacc gtatcgtaca cggcggcgaa 360
aagtatacca gctccgtagt gatcgatgag tctgttattc agggtatcaa agatgcagct 420
tcttttgcac cgctgcacaa cccggctcac ctgatcggta tcgaagaagc tctgaaatct 480
ttcccacagc tgaaagacaa aaacgttgct gtatttgaca ccgcgttcca ccagactatg 540
ccggaagagt cttacctcta cgccctgcct tacaacctgt acaaagagca cggcatccgt 600
cgttacggcg cgcacggcac cagccacttc tatgtaaccc aggaagcggc aaaaatgctg 660
aacaaaccgg tagaagaact gaacatcatc acctgccacc tgggcaacgg tggttccgtt 720
tctgctatcc gcaacggtaa atgcgttgac acctctatgg gcctgacccc gctggaaggt 780
ctggtcatgg gtacccgttc tggtgatatc gatccggcga tcatcttcca cctgcacgac 840
accctgggca tgagcgttga cgcaatcaac aaactgctga ccaaagagtc tggcctgctg 900
ggtctgaccg aagtgaccag cgactgccgc tatgttgaag acaactacgc gacgaaagaa 960
gacgcgaagc gcgcaatgga cgtttactgc caccgcctgg cgaaatacat cggtgcctac 1020
actgcgctga tggatggtcg tctggacgct gttgtattca ctggtggtat cggtgaaaat 1080
gccgcaatgg ttcgtgaact gtctctgggc aaactgggcg tgctgggctt tgaagttgat 1140
catgaacgca acctggctgc acgtttcggc aaatctggtt tcatcaacaa agaaggtacc 1200
cgtcctgcgg tggttatccc aaccaacgaa gaactggtta tcgcgcaaga cgcgagccgc 1260
ctgactgcct gatttcacac cgccagctca gctggcggtg ctgttttgta acccgccaaa 1320
tcggcggtaa cgaaagagga taaaccatgt cccgtattat tatgctgatc cctaccggaa 1380
ccagcgtcgg tctgaccagc gtcagccttg gcgtgatccg tgcaatggaa cgcaaaggcg 1440
ttcgtctgag cgttttcaaa cctatcgctc agccgcgtac cggtggcgat gcgcccgatc 1500
agactacgac tatcgtgcgt gcgaactctt ccaccacgac ggccgctgaa ccgctgaaaa 1560
tgagctacgt tgaaggtctg ctttccagca atcagaaaga tgtgctgatg gaagagatcg 1620
tcgcaaacta ccacgctaac accaaagacg ctgaagtcgt tctggttgaa ggtctggtcc 1680
cgacacgtaa gcaccagttt gcccagtctc tgaactacga aatcgctaaa acgctgaatg 1740
cggaaatcgt cttcgttatg tctcagggca ctgacacccc ggaacagctg aaagagcgta 1800
tcgaactgac ccgcaacagc ttcggcggtg ccaaaaacac caacatcacc ggcgttatcg 1860
ttaacaaact gaacgcaccg gttgatgaac agggtcgtac tcgcccggat ctgtccgaga 1920
ttttcgacga ctcttccaaa gctaaagtaa acaatgttga tccggcgaag ctgcaagaat 1980
ccagcccgct gccggttctc ggcgctgtgc cgtggagctt tgacctgatc gcgactcgtg 2040
cgatcgatat ggctcgccac ctgaatgcga ccatcatcaa cgaaggcgac atcaatactc 2100
gccgcgttaa atccgtcact ttctgcgcac gcagcattcc gcacatgctg gagcacttcc 2160
gtgccggttc tctgctggtg acttccgcag accgtcctga cgtgctggtg gccgcttgcc 2220
tggcagccat gaacggcgta gaaatcggtg ccctgctgct gactggcggt tacgaaatgg 2280
acgcgcgcat ttctaaactg tgcgaacgtg ctttcgctac cggcctgccg gtatttatgg 2340
tgaacaccaa cacctggcag acctctctga gcctgcagag cttcaacctg gaagttccgg 2400
ttgacgatca cgaacgtatc gagaaagttc aggaatacgt tgctaactac atcaacgctg 2460
actggatcga atctctgact gccacttctg agcgcagccg tcgtctgtct ccgcctgcgt 2520
tccgttatca gctgactgaa cttgcgcgca aagcgggcaa acgtatcgta ctgccggaag 2580
gtgacgaacc gcgtaccgtt aaagcagccg ctatctgtgc tgaacgtggt atcgcaactt 2640
gcgtactgct gggtaatccg gcagagatca accgtgttgc agcgtctcag ggtgtagaac 2700
tgggtgcagg gattgaaatc gttgatccag aagtggttcg cgaaagctat gttggtcgtc 2760
tggtcgaact gcgtaagaac aaaggcatga ccgaaaccgt tgcccgcgaa cagctggaag 2820
acaacgtggt gctcggtacg ctgatgctgg aacaggatga agttgatggt ctggtttccg 2880
gtgctgttca cactaccgca aacaccatcc gtccgccgct gcagctgatc aaaactgcac 2940
cgggcagctc cctggtatct tccgtgttct tcatgctgct gccggaacag gtttacgttt 3000
acggtgactg tgcgatcaac ccggatccga ccgctgaaca gctggcagaa atcgcgattc 3060
agtccgctga ttccgctgcg gccttcggta tcgaaccgcg cgttgctatg ctctcctact 3120
ccaccggtac ttctggtgca ggtagcgacg tagaaaaagt tcgcgaagca actcgtctgg 3180
cgcaggaaaa acgtcctgac ctgatgatcg acggtccgct gcagtacgac gctgcggtaa 3240
tggctgacgt tgcgaaatcc aaagcgccga actctccggt tgcaggtcgc gctaccgtgt 3300
tcatcttccc ggatctgaac accggtaaca ccacctacaa agcggtacag cgttctgccg 3360
acctgatctc catcgggccg atgctgcagg gtatgcgcaa gccggttaac gacctgtccc 3420
gtggcgcact ggttgacgat atcgtctaca ccatcgcgct gactgcgatt cagtctgcac 3480
agcagcagta aaagcttaa 3499
<210> 4
<211> 1016
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 4
aactcgagtt gacagctagc tcagtcctag gtataatgct agctactaga gaaagaggag 60
aaatatacca tggatatcat cttttatcac ccaacgttcg atacccaatg gtggattgag 120
gcactgcgca aagctattcc tcaggcaaga gtcagagcat ggaaaagcgg agataatgac 180
tctgctgatt atgctttagt ctggcatcct cctgttgaaa tgctggcagg gcgcgatctt 240
aaagcggtgt tcgcactcgg ggccggtgtt gattctattt tgagcaagct acaggcacac 300
cctgaaatgc tgaacccttc tgttccactt tttcgcctgg aagataccgg tatgggcgag 360
caaatgcagg aatatgctgt cagtcaggtg ctgcattggt ttcgacgttt tgacgattat 420
cgcatccagc aaaatagttc gcattggcaa ccgctgcctg aatatcatcg ggaagatttt 480
accatcggca ttttgggcgc aggcgtactg ggcagtaaag ttgctcagag tctgcaaacc 540
tggcgctttc cgctgcgttg ctggagtcga acccgtaaat cgtggcctgg cgtgcaaagc 600
tttgccggac gggaagaact gtctgcattt ctgagccaat gtcgggtatt gattaatttg 660
ttaccgaata cccctgaaac cgtcggcatt attaatcaac aattactcga aaaattaccg 720
gatggcgcgt atctcctcaa cctggcgcgt ggtgttcatg ttgtggaaga tgacctgctc 780
gcggcgctgg atagcggcaa agttaaaggc gcaatgttgg atgtttttaa tcgtgaaccc 840
ttaccgcctg aaagtccgct ctggcaacat ccacgcgtga cgataacacc acatgtcgcc 900
gcgattaccc gtcccgctga agctgtggag tacatttctc gcaccattgc ccagctcgaa 960
aaaggggaga gggtctgcgg gcaagtcgac cgcgcacgcg gctactaaga attcaa 1016
<210> 5
<211> 3301
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 5
aagaattctt gacagctagc tcagtcctag gtataatgct agctactaga gaaagaggag 60
aaatatacca tgaaaacccg tacacaacaa attgaagaat tacagaaaga gtggactcaa 120
ccgcgttggg aaggcattac tcgcccatac agtgcggaag atgtggtgaa attacgcggt 180
tcagtcaatc ctgaatgcac gctggcgcaa ctgggcgcag cgaaaatgtg gcgtctgctg 240
cacggtgagt cgaaaaaagg ctacatcaac agcctcggcg cactgactgg cggtcaggcg 300
ctgcaacagg cgaaagcggg tattgaagca gtctatctgt cgggatggca ggtagcggcg 360
gacgctaacc tggcggccag catgtatccg gatcagtcgc tctatccggc aaactcggtg 420
ccagctgtgg tggagcggat caacaacacc ttccgtcgtg ccgatcagat ccaatggtcc 480
gcgggcattg agccgggcga tccgcgctat gtcgattact tcctgccgat cgttgccgat 540
gcggaagccg gttttggcgg tgtcctgaat gcctttgaac tgatgaaagc gatgattgaa 600
gccggtgcag cggcagttca cttcgaagat cagctggcgt cagtgaagaa atgcggtcac 660
atgggcggca aagttttagt gccaactcag gaagctattc agaaactggt cgcggcgcgt 720
ctggcagctg acgtgacggg cgttccaacc ctgctggttg cccgtaccga tgctgatgcg 780
gcggatctga tcacctccga ttgcgacccg tatgacagcg aatttattac cggcgagcgt 840
accagtgaag gcttcttccg tactcatgcg ggcattgagc aagcgatcag ccgtggcctg 900
gcgtatgcgc catatgctga cctggtctgg tgtgaaacct ccacgccgga tctggaactg 960
gcgcgtcgct ttgcacaagc tatccacgcg aaatatccgg gcaaactgct ggcttataac 1020
tgctcgccgt cgttcaactg gcagaaaaac ctcgacgaca aaactattgc cagcttccag 1080
cagcagctgt cggatatggg ctacaagttc cagttcatca ccctggcagg tatccacagc 1140
atgtggttca acatgtttga cctggcaaac gcctatgccc agggcgaggg tatgaagcac 1200
tacgttgaga aagtgcagca gccggaattt gccgccgcga aagatggcta taccttcgta 1260
tctcaccagc aggaagtggg tacaggttac ttcgataaag tgacgactat tattcagggc 1320
ggcacgtctt cagtcaccgc gctgaccggc tccactgaag aatcgcagtt ctaagcaaca 1380
acaaccgttg ctgactgtag gccggataag gcgttcacgc cgcatccggc aatcggtgca 1440
cgatgcctga tgcgacgctt gcgcgtctta tcatgcctac agccgttgcc gaacgtaggc 1500
tggataaggc gtttacgccg catccggcaa ttctctgctc ctgatgaggg cgctaaatgc 1560
cgcgtggcct ggaattattg attgctcaaa ccattttgca aggcttcgat gctcagtatg 1620
gtcgattcct cgaagtgacc tccggtgcgc agcagcgttt cgaacaggcc gactggcatg 1680
ctgtccagca ggcgatgaaa aaccgtatcc atctttacga tcatcacgtt ggtctggtcg 1740
tggagcaact gcgctgcatt actaacggcc aaagtacgga cgcggcattt ttactacgtg 1800
ttaaagagca ttacacccgg ctgttgccgg attacccgcg cttcgagatt gcggagagct 1860
tttttaactc cgtgtactgt cggttatttg accaccgctc gcttactccc gagcggcttt 1920
ttatctttag ctctcagcca gagcgccgct ttcgtaccat tccccgcccg ctggcgaaag 1980
actttcaccc cgatcacggc tgggaatctc tactgatgcg cgttatcagc gacctaccgc 2040
tgcgcctgcg ctggcagaat aaaagccgtg acatccatta cattattcgc catctgacgg 2100
aaacgctggg gacagacaac ctcgcggaaa gtcatttaca ggtggcgaac gaactgtttt 2160
accgcaataa agccgcctgg ctggtaggca aactgatcac accttccggc acattgccat 2220
ttttgctgcc gatccaccag acggacgacg gcgagttatt tattgatacc tgcctgacga 2280
cgaccgccga agcgagcatt gtttttggct ttgcgcgttc ttattttatg gtttatgcgc 2340
cgctgcccgc agcgctggtc gagtggctac gggaaattct gccaggtaaa accaccgctg 2400
aattgtatat ggctatcggc tgccagaagc acgccaaaac cgaaagctac cgcgaatatc 2460
tcgtttatct acagggctgt aatgagcagt tcattgaagc gccgggtatt cgtggaatgg 2520
tgatgttggt gtttacgctg ccgggctttg atcgggtatt caaagtcatc aaagacaggt 2580
tcgcgccgca gaaagagatg tctgccgctc acgttcgtgc ctgctatcaa ctggtgaaag 2640
agcacgatcg cgtgggccga atggcggaca cccaggagtt tgaaaacttt gtgctggaga 2700
agcggcatat ttccccggca ttaatggaat tactgcttca ggaagcagcg gaaaaaatca 2760
ccgatctcgg cgaacaaatt gtgattcgcc atctttatat tgagcggcgg atggtgccgc 2820
tcaatatctg gctggaacaa gtggaaggtc agcagttgcg cgacgccatt gaagaatacg 2880
gtaacgctat tcgccagctt gccgctgcta acattttccc tggcgacatg ctgtttaaaa 2940
acttcggtgt cacccgtcac gggcgtgtgg ttttttatga ttacgatgaa atttgctaca 3000
tgacggaagt gaatttccgc gacatcccgc cgccgcgcta tccggaagac gaacttgcca 3060
gcgaaccgtg gtacagcgtc tcgccgggcg atgttttccc ggaagagttt cgccactggc 3120
tatgcgccga cccgcgtatt ggtccgctgt ttgaagagat gcacgccgac ctgttccgcg 3180
ctgattactg gcgcgcacta caaaaccgca tacgtgaagg gcatgtggaa gatgtttatg 3240
cgtatcggcg caggcaaaga tttagcgtac ggtatgggga gatgcttttt tgaggatcca 3300
a 3301
<210> 6
<211> 1424
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 6
atgactgaac aggcaacaac aaccgatgaa ctggctttca caaggccgta tggcgagcag 60
gtgtaggctg gagctgcttc gaagttccta tactttctag agaataggaa cttcggaata 120
ggaacttcaa gatcccctta ttagaagaac tcgtcaagaa ggcgatagaa ggcgatgcgc 180
tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc ggtcagccca ttcgccgcca 240
agctcttcag caatatcacg ggtagccaac gctatgtcct gatagcggtc cgccacaccc 300
agccggccac agtcgatgaa tccagaaaag cggccatttt ccaccatgat attcggcaag 360
caggcatcgc catgggtcac gacgagatcc tcgccgtcgg gcatgcgcgc cttgagcctg 420
gcgaacagtt cggctggcgc gagcccctga tgctcttcgt ccagatcatc ctgatcgaca 480
agaccggctt ccatccgagt acgtgctcgc tcgatgcgat gtttcgcttg gtggtcgaat 540
gggcaggtag ccggatcaag cgtatgcagc cgccgcattg catcagccat gatggatact 600
ttctcggcag gagcaaggtg agatgacagg agatcctgcc ccggcacttc gcccaatagc 660
agccagtccc ttcccgcttc agtgacaacg tcgagcacag ctgcgcaagg aacgcccgtc 720
gtggccagcc acgatagccg cgctgcctcg tcctgcagtt cattcagggc accggacagg 780
tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca gccggaacac ggcggcatca 840
gagcagccga ttgtctgttg tgcccagtca tagccgaata gcctctccac ccaagcggcc 900
ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa acgatcctca tcctgtctct 960
tgatcagatc ttgatcccct gcgccatcag atccttggcg gcaagaaagc catccagttt 1020
actttgcagg gcttcccaac cttaccagag ggcgccccag ctggcaattc cggttcgctt 1080
gctgtccata aaaccgccca gtctagctat cgccatgtaa gcccactgca agctacctgc 1140
tttctctttg cgcttgcgtt ttcccttgtc cagatagccc agtagctgac attcatccgg 1200
ggtcagcacc gtttctgcgg actggctttc tacgtgttcc gcttccttta gcagcccttg 1260
cgccctgagt gcttgcggca gcgtgagctt caaaagcgct ctgaagttcc tatactttct 1320
agagaatagg aacttcgaac tgcaggtcga cggatccccg gaatagacag gcagtgacga 1380
tggataaacc attcctgaat gcttactcac gcctgttgat taaa 1424
<210> 7
<211> 1424
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 7
atgagtcaaa ccataaccca gagccgttta cgcattgacg ccaattttaa acgttttgtg 60
gtgtaggctg gagctgcttc gaagttccta tactttctag agaataggaa cttcggaata 120
ggaacttcaa gatcccctta ttagaagaac tcgtcaagaa ggcgatagaa ggcgatgcgc 180
tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc ggtcagccca ttcgccgcca 240
agctcttcag caatatcacg ggtagccaac gctatgtcct gatagcggtc cgccacaccc 300
agccggccac agtcgatgaa tccagaaaag cggccatttt ccaccatgat attcggcaag 360
caggcatcgc catgggtcac gacgagatcc tcgccgtcgg gcatgcgcgc cttgagcctg 420
gcgaacagtt cggctggcgc gagcccctga tgctcttcgt ccagatcatc ctgatcgaca 480
agaccggctt ccatccgagt acgtgctcgc tcgatgcgat gtttcgcttg gtggtcgaat 540
gggcaggtag ccggatcaag cgtatgcagc cgccgcattg catcagccat gatggatact 600
ttctcggcag gagcaaggtg agatgacagg agatcctgcc ccggcacttc gcccaatagc 660
agccagtccc ttcccgcttc agtgacaacg tcgagcacag ctgcgcaagg aacgcccgtc 720
gtggccagcc acgatagccg cgctgcctcg tcctgcagtt cattcagggc accggacagg 780
tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca gccggaacac ggcggcatca 840
gagcagccga ttgtctgttg tgcccagtca tagccgaata gcctctccac ccaagcggcc 900
ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa acgatcctca tcctgtctct 960
tgatcagatc ttgatcccct gcgccatcag atccttggcg gcaagaaagc catccagttt 1020
actttgcagg gcttcccaac cttaccagag ggcgccccag ctggcaattc cggttcgctt 1080
gctgtccata aaaccgccca gtctagctat cgccatgtaa gcccactgca agctacctgc 1140
tttctctttg cgcttgcgtt ttcccttgtc cagatagccc agtagctgac attcatccgg 1200
ggtcagcacc gtttctgcgg actggctttc tacgtgttcc gcttccttta gcagcccttg 1260
cgccctgagt gcttgcggca gcgtgagctt caaaagcgct ctgaagttcc tatactttct 1320
agagaatagg aacttcgaac tgcaggtcga cggatccccg gaataacggc tataccgaac 1380
cgttattaca cgcctggcgt ttacgcgaaa aagaaagtca ttaa 1424
<210> 8
<211> 1424
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 8
atgagcatct tgtacgaaga gcgtcttgat ggcgctttac ccgatgtcga ccgcacatcg 60
gtgtaggctg gagctgcttc gaagttccta tactttctag agaataggaa cttcggaata 120
ggaacttcaa gatcccctta ttagaagaac tcgtcaagaa ggcgatagaa ggcgatgcgc 180
tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc ggtcagccca ttcgccgcca 240
agctcttcag caatatcacg ggtagccaac gctatgtcct gatagcggtc cgccacaccc 300
agccggccac agtcgatgaa tccagaaaag cggccatttt ccaccatgat attcggcaag 360
caggcatcgc catgggtcac gacgagatcc tcgccgtcgg gcatgcgcgc cttgagcctg 420
gcgaacagtt cggctggcgc gagcccctga tgctcttcgt ccagatcatc ctgatcgaca 480
agaccggctt ccatccgagt acgtgctcgc tcgatgcgat gtttcgcttg gtggtcgaat 540
gggcaggtag ccggatcaag cgtatgcagc cgccgcattg catcagccat gatggatact 600
ttctcggcag gagcaaggtg agatgacagg agatcctgcc ccggcacttc gcccaatagc 660
agccagtccc ttcccgcttc agtgacaacg tcgagcacag ctgcgcaagg aacgcccgtc 720
gtggccagcc acgatagccg cgctgcctcg tcctgcagtt cattcagggc accggacagg 780
tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca gccggaacac ggcggcatca 840
gagcagccga ttgtctgttg tgcccagtca tagccgaata gcctctccac ccaagcggcc 900
ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa acgatcctca tcctgtctct 960
tgatcagatc ttgatcccct gcgccatcag atccttggcg gcaagaaagc catccagttt 1020
actttgcagg gcttcccaac cttaccagag ggcgccccag ctggcaattc cggttcgctt 1080
gctgtccata aaaccgccca gtctagctat cgccatgtaa gcccactgca agctacctgc 1140
tttctctttg cgcttgcgtt ttcccttgtc cagatagccc agtagctgac attcatccgg 1200
ggtcagcacc gtttctgcgg actggctttc tacgtgttcc gcttccttta gcagcccttg 1260
cgccctgagt gcttgcggca gcgtgagctt caaaagcgct ctgaagttcc tatactttct 1320
agagaatagg aacttcgaac tgcaggtcga cggatccccg gaatttatcc cgtcgacgcc 1380
gaagcgattt tgttatgcga gctggacggc gtggagtctg acgt 1424
<210> 9
<211> 1424
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 9
atggtcgcac ccattcccgc gaaacgcggc agaaaacccg ccgttgccac cgcaccagcg 60
gtgtaggctg gagctgcttc gaagttccta tactttctag agaataggaa cttcggaata 120
ggaacttcaa gatcccctta ttagaagaac tcgtcaagaa ggcgatagaa ggcgatgcgc 180
tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc ggtcagccca ttcgccgcca 240
agctcttcag caatatcacg ggtagccaac gctatgtcct gatagcggtc cgccacaccc 300
agccggccac agtcgatgaa tccagaaaag cggccatttt ccaccatgat attcggcaag 360
caggcatcgc catgggtcac gacgagatcc tcgccgtcgg gcatgcgcgc cttgagcctg 420
gcgaacagtt cggctggcgc gagcccctga tgctcttcgt ccagatcatc ctgatcgaca 480
agaccggctt ccatccgagt acgtgctcgc tcgatgcgat gtttcgcttg gtggtcgaat 540
gggcaggtag ccggatcaag cgtatgcagc cgccgcattg catcagccat gatggatact 600
ttctcggcag gagcaaggtg agatgacagg agatcctgcc ccggcacttc gcccaatagc 660
agccagtccc ttcccgcttc agtgacaacg tcgagcacag ctgcgcaagg aacgcccgtc 720
gtggccagcc acgatagccg cgctgcctcg tcctgcagtt cattcagggc accggacagg 780
tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca gccggaacac ggcggcatca 840
gagcagccga ttgtctgttg tgcccagtca tagccgaata gcctctccac ccaagcggcc 900
ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa acgatcctca tcctgtctct 960
tgatcagatc ttgatcccct gcgccatcag atccttggcg gcaagaaagc catccagttt 1020
actttgcagg gcttcccaac cttaccagag ggcgccccag ctggcaattc cggttcgctt 1080
gctgtccata aaaccgccca gtctagctat cgccatgtaa gcccactgca agctacctgc 1140
tttctctttg cgcttgcgtt ttcccttgtc cagatagccc agtagctgac attcatccgg 1200
ggtcagcacc gtttctgcgg actggctttc tacgtgttcc gcttccttta gcagcccttg 1260
cgccctgagt gcttgcggca gcgtgagctt caaaagcgct ctgaagttcc tatactttct 1320
agagaatagg aacttcgaac tgcaggtcga cggatccccg gaatggcgcg atggtgatta 1380
aagcggcgaa ggaagtgacg ctggcgtacg gtggaatgcg ctga 1424
<210> 10
<211> 652
<212> PRT
<213>Artificial sequence
<220>
<223>
<400> 10
Met Ser Gln Ile His Lys His Thr Ile Pro Ala Asn Ile Ala Asp Arg
1 5 10 15
Cys Leu Ile Asn Pro Gln Gln Tyr Glu Ala Met Tyr Gln Gln Ser Ile
20 25 30
Asn Val Pro Asp Thr Phe Trp Gly Glu Gln Gly Lys Ile Leu Asp Trp
35 40 45
Ile Lys Pro Tyr Gln Lys Val Lys Asn Thr Ser Phe Ala Pro Gly Asn
50 55 60
Val Ser Ile Lys Trp Tyr Glu Asp Gly Thr Leu Asn Leu Ala Ala Asn
65 70 75 80
Cys Leu Asp Arg His Leu Gln Glu Asn Gly Asp Arg Thr Ala Ile Ile
85 90 95
Trp Glu Gly Asp Asp Ala Ser Gln Ser Lys His Ile Ser Tyr Lys Glu
100 105 110
Leu His Arg Asp Val Cys Arg Phe Ala Asn Thr Leu Leu Glu Leu Gly
115 120 125
Ile Lys Lys Gly Asp Val Val Ala Ile Tyr Met Pro Met Val Pro Glu
130 135 140
Ala Ala Val Ala Met Leu Ala Cys Ala Arg Ile Gly Ala Val His Ser
145 150 155 160
Val Ile Phe Gly Gly Phe Ser Pro Glu Ala Val Ala Gly Arg Ile Ile
165 170 175
Asp Ser Asn Ser Arg Leu Val Ile Thr Ser Asp Glu Gly Val Arg Ala
180 185 190
Gly Arg Ser Ile Pro Leu Lys Lys Asn Val Asp Asp Ala Leu Lys Asn
195 200 205
Pro Asn Val Thr Ser Val Glu His Val Val Val Leu Lys Arg Thr Gly
210 215 220
Gly Lys Ile Asp Trp Gln Glu Gly Arg Asp Leu Trp Trp His Asp Leu
225 230 235 240
Val Glu Gln Ala Ser Asp Gln His Gln Ala Glu Glu Met Asn Ala Glu
245 250 255
Asp Pro Leu Phe Ile Leu Tyr Thr Ser Gly Ser Thr Gly Lys Pro Lys
260 265 270
Gly Val Leu His Thr Thr Gly Gly Tyr Leu Val Tyr Ala Ala Leu Thr
275 280 285
Phe Lys Tyr Val Phe Asp Tyr His Pro Gly Asp Ile Tyr Trp Cys Thr
290 295 300
Ala Asp Val Gly Trp Val Thr Gly His Ser Tyr Leu Leu Tyr Gly Pro
305 310 315 320
Leu Ala Cys Gly Ala Thr Thr Leu Met Phe Glu Gly Val Pro Asn Trp
325 330 335
Pro Thr Pro Ala Arg Met Ala Gln Val Val Asp Lys His Gln Val Asn
340 345 350
Ile Leu Tyr Thr Ala Pro Thr Ala Ile Arg Ala Leu Met Ala Glu Gly
355 360 365
Asp Lys Ala Ile Glu Gly Thr Asp Arg Ser Ser Leu Arg Ile Leu Gly
370 375 380
Ser Val Gly Glu Pro Ile Asn Pro Glu Ala Trp Glu Trp Tyr Trp Lys
385 390 395 400
Lys Ile Gly Asn Glu Lys Cys Pro Val Val Asp Thr Trp Trp Gln Thr
405 410 415
Glu Thr Gly Gly Phe Met Ile Thr Pro Leu Pro Gly Ala Thr Glu Leu
420 425 430
Lys Ala Gly Ser Ala Thr Arg Pro Phe Phe Gly Val Gln Pro Ala Leu
435 440 445
Val Asp Asn Glu Gly Asn Pro Leu Glu Gly Ala Thr Glu Gly Ser Leu
450 455 460
Val Ile Thr Asp Ser Trp Pro Gly Gln Ala Arg Thr Leu Phe Gly Asp
465 470 475 480
His Glu Arg Phe Glu Gln Thr Tyr Phe Ser Thr Phe Lys Asn Met Tyr
485 490 495
Phe Ser Gly Asp Gly Ala Arg Arg Asp Glu Asp Gly Tyr Tyr Trp Ile
500 505 510
Thr Gly Arg Val Asp Asp Val Leu Asn Val Ser Gly His Arg Leu Gly
515 520 525
Thr Ala Glu Ile Glu Ser Ala Leu Val Ala His Pro Lys Ile Ala Glu
530 535 540
Ala Ala Val Val Gly Ile Pro His Asn Ile Lys Gly Gln Ala Ile Tyr
545 550 555 560
Ala Tyr Val Thr Leu Asn His Gly Glu Glu Pro Ser Pro Glu Leu Tyr
565 570 575
Ala Glu Val Arg Asn Trp Val Arg Lys Glu Ile Gly Pro Leu Ala Thr
580 585 590
Pro Asp Val Leu His Trp Thr Asp Ser Leu Pro Lys Thr Arg Ser Gly
595 600 605
Lys Ile Met Arg Arg Ile Leu Arg Lys Ile Ala Ala Gly Asp Thr Ser
610 615 620
Asn Leu Gly Asp Thr Ser Thr Leu Ala Asp Pro Gly Val Val Glu Lys
625 630 635 640
Leu Leu Glu Glu Lys Gln Ala Ile Ala Met Pro Ser
645 650
<210> 11
<211> 714
<212> PRT
<213>Artificial sequence
<220>
<223>
<400> 11
Met Ser Arg Ile Ile Met Leu Ile Pro Thr Gly Thr Ser Val Gly Leu
1 5 10 15
Thr Ser Val Ser Leu Gly Val Ile Arg Ala Met Glu Arg Lys Gly Val
20 25 30
Arg Leu Ser Val Phe Lys Pro Ile Ala Gln Pro Arg Thr Gly Gly Asp
35 40 45
Ala Pro Asp Gln Thr Thr Thr Ile Val Arg Ala Asn Ser Ser Thr Thr
50 55 60
Thr Ala Ala Glu Pro Leu Lys Met Ser Tyr Val Glu Gly Leu Leu Ser
65 70 75 80
Ser Asn Gln Lys Asp Val Leu Met Glu Glu Ile Val Ala Asn Tyr His
85 90 95
Ala Asn Thr Lys Asp Ala Glu Val Val Leu Val Glu Gly Leu Val Pro
100 105 110
Thr Arg Lys His Gln Phe Ala Gln Ser Leu Asn Tyr Glu Ile Ala Lys
115 120 125
Thr Leu Asn Ala Glu Ile Val Phe Val Met Ser Gln Gly Thr Asp Thr
130 135 140
Pro Glu Gln Leu Lys Glu Arg Ile Glu Leu Thr Arg Asn Ser Phe Gly
145 150 155 160
Gly Ala Lys Asn Thr Asn Ile Thr Gly Val Ile Val Asn Lys Leu Asn
165 170 175
Ala Pro Val Asp Glu Gln Gly Arg Thr Arg Pro Asp Leu Ser Glu Ile
180 185 190
Phe Asp Asp Ser Ser Lys Ala Lys Val Asn Asn Val Asp Pro Ala Lys
195 200 205
Leu Gln Glu Ser Ser Pro Leu Pro Val Leu Gly Ala Val Pro Trp Ser
210 215 220
Phe Asp Leu Ile Ala Thr Arg Ala Ile Asp Met Ala Arg His Leu Asn
225 230 235 240
Ala Thr Ile Ile Asn Glu Gly Asp Ile Asn Thr Arg Arg Val Lys Ser
245 250 255
Val Thr Phe Cys Ala Arg Ser Ile Pro His Met Leu Glu His Phe Arg
260 265 270
Ala Gly Ser Leu Leu Val Thr Ser Ala Asp Arg Pro Asp Val Leu Val
275 280 285
Ala Ala Cys Leu Ala Ala Met Asn Gly Val Glu Ile Gly Ala Leu Leu
290 295 300
Leu Thr Gly Gly Tyr Glu Met Asp Ala Arg Ile Ser Lys Leu Cys Glu
305 310 315 320
Arg Ala Phe Ala Thr Gly Leu Pro Val Phe Met Val Asn Thr Asn Thr
325 330 335
Trp Gln Thr Ser Leu Ser Leu Gln Ser Phe Asn Leu Glu Val Pro Val
340 345 350
Asp Asp His Glu Arg Ile Glu Lys Val Gln Glu Tyr Val Ala Asn Tyr
355 360 365
Ile Asn Ala Asp Trp Ile Glu Ser Leu Thr Ala Thr Ser Glu Arg Ser
370 375 380
Arg Arg Leu Ser Pro Pro Ala Phe Arg Tyr Gln Leu Thr Glu Leu Ala
385 390 395 400
Arg Lys Ala Gly Lys Arg Ile Val Leu Pro Glu Gly Asp Glu Pro Arg
405 410 415
Thr Val Lys Ala Ala Ala Ile Cys Ala Glu Arg Gly Ile Ala Thr Cys
420 425 430
Val Leu Leu Gly Asn Pro Ala Glu Ile Asn Arg Val Ala Ala Ser Gln
435 440 445
Gly Val Glu Leu Gly Ala Gly Ile Glu Ile Val Asp Pro Glu Val Val
450 455 460
Arg Glu Ser Tyr Val Gly Arg Leu Val Glu Leu Arg Lys Asn Lys Gly
465 470 475 480
Met Thr Glu Thr Val Ala Arg Glu Gln Leu Glu Asp Asn Val Val Leu
485 490 495
Gly Thr Leu Met Leu Glu Gln Asp Glu Val Asp Gly Leu Val Ser Gly
500 505 510
Ala Val His Thr Thr Ala Asn Thr Ile Arg Pro Pro Leu Gln Leu Ile
515 520 525
Lys Thr Ala Pro Gly Ser Ser Leu Val Ser Ser Val Phe Phe Met Leu
530 535 540
Leu Pro Glu Gln Val Tyr Val Tyr Gly Asp Cys Ala Ile Asn Pro Asp
545 550 555 560
Pro Thr Ala Glu Gln Leu Ala Glu Ile Ala Ile Gln Ser Ala Asp Ser
565 570 575
Ala Ala Ala Phe Gly Ile Glu Pro Arg Val Ala Met Leu Ser Tyr Ser
580 585 590
Thr Gly Thr Ser Gly Ala Gly Ser Asp Val Glu Lys Val Arg Glu Ala
595 600 605
Thr Arg Leu Ala Gln Glu Lys Arg Pro Asp Leu Met Ile Asp Gly Pro
610 615 620
Leu Gln Tyr Asp Ala Ala Val Met Ala Asp Val Ala Lys Ser Lys Ala
625 630 635 640
Pro Asn Ser Pro Val Ala Gly Arg Ala Thr Val Phe Ile Phe Pro Asp
645 650 655
Leu Asn Thr Gly Asn Thr Thr Tyr Lys Ala Val Gln Arg Ser Ala Asp
660 665 670
Leu Ile Ser Ile Gly Pro Met Leu Gln Gly Met Arg Lys Pro Val Asn
675 680 685
Asp Leu Ser Arg Gly Ala Leu Val Asp Asp Ile Val Tyr Thr Ile Ala
690 695 700
Leu Thr Ala Ile Gln Ser Ala Gln Gln Gln
705 710
<210> 12
<211> 400
<212> PRT
<213>Artificial sequence
<220>
<223>
<400> 12
Met Ser Ser Lys Leu Val Leu Val Leu Asn Cys Gly Ser Ser Ser Leu
1 5 10 15
Lys Phe Ala Ile Ile Asp Ala Val Asn Gly Glu Glu Tyr Leu Ser Gly
20 25 30
Leu Ala Glu Cys Phe His Leu Pro Glu Ala Arg Ile Lys Trp Lys Met
35 40 45
Asp Gly Asn Lys Gln Glu Ala Ala Leu Gly Ala Gly Ala Ala His Ser
50 55 60
Glu Ala Leu Asn Phe Ile Val Asn Thr Ile Leu Ala Gln Lys Pro Glu
65 70 75 80
Leu Ser Ala Gln Leu Thr Ala Ile Gly His Arg Ile Val His Gly Gly
85 90 95
Glu Lys Tyr Thr Ser Ser Val Val Ile Asp Glu Ser Val Ile Gln Gly
100 105 110
Ile Lys Asp Ala Ala Ser Phe Ala Pro Leu His Asn Pro Ala His Leu
115 120 125
Ile Gly Ile Glu Glu Ala Leu Lys Ser Phe Pro Gln Leu Lys Asp Lys
130 135 140
Asn Val Ala Val Phe Asp Thr Ala Phe His Gln Thr Met Pro Glu Glu
145 150 155 160
Ser Tyr Leu Tyr Ala Leu Pro Tyr Asn Leu Tyr Lys Glu His Gly Ile
165 170 175
Arg Arg Tyr Gly Ala His Gly Thr Ser His Phe Tyr Val Thr Gln Glu
180 185 190
Ala Ala Lys Met Leu Asn Lys Pro Val Glu Glu Leu Asn Ile Ile Thr
195 200 205
Cys His Leu Gly Asn Gly Gly Ser Val Ser Ala Ile Arg Asn Gly Lys
210 215 220
Cys Val Asp Thr Ser Met Gly Leu Thr Pro Leu Glu Gly Leu Val Met
225 230 235 240
Gly Thr Arg Ser Gly Asp Ile Asp Pro Ala Ile Ile Phe His Leu His
245 250 255
Asp Thr Leu Gly Met Ser Val Asp Ala Ile Asn Lys Leu Leu Thr Lys
260 265 270
Glu Ser Gly Leu Leu Gly Leu Thr Glu Val Thr Ser Asp Cys Arg Tyr
275 280 285
Val Glu Asp Asn Tyr Ala Thr Lys Glu Asp Ala Lys Arg Ala Met Asp
290 295 300
Val Tyr Cys His Arg Leu Ala Lys Tyr Ile Gly Ala Tyr Thr Ala Leu
305 310 315 320
Met Asp Gly Arg Leu Asp Ala Val Val Phe Thr Gly Gly Ile Gly Glu
325 330 335
Asn Ala Ala Met Val Arg Glu Leu Ser Leu Gly Lys Leu Gly Val Leu
340 345 350
Gly Phe Glu Val Asp His Glu Arg Asn Leu Ala Ala Arg Phe Gly Lys
355 360 365
Ser Gly Phe Ile Asn Lys Glu Gly Thr Arg Pro Ala Val Val Ile Pro
370 375 380
Thr Asn Glu Glu Leu Val Ile Ala Gln Asp Ala Ser Arg Leu Thr Ala
385 390 395 400
<210> 13
<211> 427
<212> PRT
<213>Artificial sequence
<220>
<223>
<400> 13
Met Ala Asp Thr Lys Ala Lys Leu Thr Leu Asn Gly Asp Thr Ala Val
1 5 10 15
Glu Leu Asp Val Leu Lys Gly Thr Leu Gly Gln Asp Val Ile Asp Ile
20 25 30
Arg Thr Leu Gly Ser Lys Gly Val Phe Thr Phe Asp Pro Gly Phe Thr
35 40 45
Ser Thr Ala Ser Cys Glu Ser Lys Ile Thr Phe Ile Asp Gly Asp Glu
50 55 60
Gly Ile Leu Leu His Arg Gly Phe Pro Ile Asp Gln Leu Ala Thr Asp
65 70 75 80
Ser Asn Tyr Leu Glu Val Cys Tyr Ile Leu Leu Asn Gly Glu Lys Pro
85 90 95
Thr Gln Glu Gln Tyr Asp Glu Phe Lys Thr Thr Val Thr Arg His Thr
100 105 110
Met Ile His Glu Gln Ile Thr Arg Leu Phe His Ala Phe Arg Arg Asp
115 120 125
Ser His Pro Met Ala Val Met Cys Gly Ile Thr Gly Ala Leu Ala Ala
130 135 140
Phe Tyr His Asp Ser Leu Asp Val Asn Asn Pro Arg His Arg Glu Ile
145 150 155 160
Ala Ala Phe Arg Leu Leu Ser Lys Met Pro Thr Met Ala Ala Met Cys
165 170 175
Tyr Lys Tyr Ser Ile Gly Gln Pro Phe Val Tyr Pro Arg Asn Asp Leu
180 185 190
Ser Tyr Ala Gly Asn Phe Leu Asn Met Met Phe Ser Thr Pro Cys Glu
195 200 205
Pro Tyr Glu Val Asn Pro Ile Leu Glu Arg Ala Met Asp Arg Ile Leu
210 215 220
Ile Leu His Ala Asp His Glu Gln Asn Ala Ser Thr Ser Thr Val Arg
225 230 235 240
Thr Ala Gly Ser Ser Gly Ala Asn Pro Phe Ala Cys Ile Ala Ala Gly
245 250 255
Ile Ala Ser Leu Trp Gly Pro Ala His Gly Gly Ala Asn Glu Ala Ala
260 265 270
Leu Lys Met Leu Glu Glu Ile Ser Ser Val Lys His Ile Pro Glu Phe
275 280 285
Val Arg Arg Ala Lys Asp Lys Asn Asp Ser Phe Arg Leu Met Gly Phe
290 295 300
Gly His Arg Val Tyr Lys Asn Tyr Asp Pro Arg Ala Thr Val Met Arg
305 310 315 320
Glu Thr Cys His Glu Val Leu Lys Glu Leu Gly Thr Lys Asp Asp Leu
325 330 335
Leu Glu Val Ala Met Glu Leu Glu Asn Ile Ala Leu Asn Asp Pro Tyr
340 345 350
Phe Ile Glu Lys Lys Leu Tyr Pro Asn Val Asp Phe Tyr Ser Gly Ile
355 360 365
Ile Leu Lys Ala Met Gly Ile Pro Ser Ser Met Phe Thr Val Ile Phe
370 375 380
Ala Met Ala Arg Thr Val Gly Trp Ile Ala His Trp Ser Glu Met His
385 390 395 400
Ser Asp Gly Met Lys Ile Ala Arg Pro Arg Gln Leu Tyr Thr Gly Tyr
405 410 415
Glu Lys Arg Asp Phe Lys Ser Asp Ile Lys Arg
420 425
<210> 14
<211> 434
<212> PRT
<213>Artificial sequence
<220>
<223>
<400> 14
Met Lys Thr Arg Thr Gln Gln Ile Glu Glu Leu Gln Lys Glu Trp Thr
1 5 10 15
Gln Pro Arg Trp Glu Gly Ile Thr Arg Pro Tyr Ser Ala Glu Asp Val
20 25 30
Val Lys Leu Arg Gly Ser Val Asn Pro Glu Cys Thr Leu Ala Gln Leu
35 40 45
Gly Ala Ala Lys Met Trp Arg Leu Leu His Gly Glu Ser Lys Lys Gly
50 55 60
Tyr Ile Asn Ser Leu Gly Ala Leu Thr Gly Gly Gln Ala Leu Gln Gln
65 70 75 80
Ala Lys Ala Gly Ile Glu Ala Val Tyr Leu Ser Gly Trp Gln Val Ala
85 90 95
Ala Asp Ala Asn Leu Ala Ala Ser Met Tyr Pro Asp Gln Ser Leu Tyr
100 105 110
Pro Ala Asn Ser Val Pro Ala Val Val Glu Arg Ile Asn Asn Thr Phe
115 120 125
Arg Arg Ala Asp Gln Ile Gln Trp Ser Ala Gly Ile Glu Pro Gly Asp
130 135 140
Pro Arg Tyr Val Asp Tyr Phe Leu Pro Ile Val Ala Asp Ala Glu Ala
145 150 155 160
Gly Phe Gly Gly Val Leu Asn Ala Phe Glu Leu Met Lys Ala Met Ile
165 170 175
Glu Ala Gly Ala Ala Ala Val His Phe Glu Asp Gln Leu Ala Ser Val
180 185 190
Lys Lys Cys Gly His Met Gly Gly Lys Val Leu Val Pro Thr Gln Glu
195 200 205
Ala Ile Gln Lys Leu Val Ala Ala Arg Leu Ala Ala Asp Val Thr Gly
210 215 220
Val Pro Thr Leu Leu Val Ala Arg Thr Asp Ala Asp Ala Ala Asp Leu
225 230 235 240
Ile Thr Ser Asp Cys Asp Pro Tyr Asp Ser Glu Phe Ile Thr Gly Glu
245 250 255
Arg Thr Ser Glu Gly Phe Phe Arg Thr His Ala Gly Ile Glu Gln Ala
260 265 270
Ile Ser Arg Gly Leu Ala Tyr Ala Pro Tyr Ala Asp Leu Val Trp Cys
275 280 285
Glu Thr Ser Thr Pro Asp Leu Glu Leu Ala Arg Arg Phe Ala Gln Ala
290 295 300
Ile His Ala Lys Tyr Pro Gly Lys Leu Leu Ala Tyr Asn Cys Ser Pro
305 310 315 320
Ser Phe Asn Trp Gln Lys Asn Leu Asp Asp Lys Thr Ile Ala Ser Phe
325 330 335
Gln Gln Gln Leu Ser Asp Met Gly Tyr Lys Phe Gln Phe Ile Thr Leu
340 345 350
Ala Gly Ile His Ser Met Trp Phe Asn Met Phe Asp Leu Ala Asn Ala
355 360 365
Tyr Ala Gln Gly Glu Gly Met Lys His Tyr Val Glu Lys Val Gln Gln
370 375 380
Pro Glu Phe Ala Ala Ala Lys Asp Gly Tyr Thr Phe Val Ser His Gln
385 390 395 400
Gln Glu Val Gly Thr Gly Tyr Phe Asp Lys Val Thr Thr Ile Ile Gln
405 410 415
Gly Gly Thr Ser Ser Val Thr Ala Leu Thr Gly Ser Thr Glu Glu Ser
420 425 430
Gln Phe
<210> 15
<211> 578
<212> PRT
<213>Artificial sequence
<220>
<223>
<400> 15
Met Pro Arg Gly Leu Glu Leu Leu Ile Ala Gln Thr Ile Leu Gln Gly
1 5 10 15
Phe Asp Ala Gln Tyr Gly Arg Phe Leu Glu Val Thr Ser Gly Ala Gln
20 25 30
Gln Arg Phe Glu Gln Ala Asp Trp His Ala Val Gln Gln Ala Met Lys
35 40 45
Asn Arg Ile His Leu Tyr Asp His His Val Gly Leu Val Val Glu Gln
50 55 60
Leu Arg Cys Ile Thr Asn Gly Gln Ser Thr Asp Ala Ala Phe Leu Leu
65 70 75 80
Arg Val Lys Glu His Tyr Thr Arg Leu Leu Pro Asp Tyr Pro Arg Phe
85 90 95
Glu Ile Ala Glu Ser Phe Phe Asn Ser Val Tyr Cys Arg Leu Phe Asp
100 105 110
His Arg Ser Leu Thr Pro Glu Arg Leu Phe Ile Phe Ser Ser Gln Pro
115 120 125
Glu Arg Arg Phe Arg Thr Ile Pro Arg Pro Leu Ala Lys Asp Phe His
130 135 140
Pro Asp His Gly Trp Glu Ser Leu Leu Met Arg Val Ile Ser Asp Leu
145 150 155 160
Pro Leu Arg Leu Arg Trp Gln Asn Lys Ser Arg Asp Ile His Tyr Ile
165 170 175
Ile Arg His Leu Thr Glu Thr Leu Gly Thr Asp Asn Leu Ala Glu Ser
180 185 190
His Leu Gln Val Ala Asn Glu Leu Phe Tyr Arg Asn Lys Ala Ala Trp
195 200 205
Leu Val Gly Lys Leu Ile Thr Pro Ser Gly Thr Leu Pro Phe Leu Leu
210 215 220
Pro Ile His Gln Thr Asp Asp Gly Glu Leu Phe Ile Asp Thr Cys Leu
225 230 235 240
Thr Thr Thr Ala Glu Ala Ser Ile Val Phe Gly Phe Ala Arg Ser Tyr
245 250 255
Phe Met Val Tyr Ala Pro Leu Pro Ala Ala Leu Val Glu Trp Leu Arg
260 265 270
Glu Ile Leu Pro Gly Lys Thr Thr Ala Glu Leu Tyr Met Ala Ile Gly
275 280 285
Cys Gln Lys His Ala Lys Thr Glu Ser Tyr Arg Glu Tyr Leu Val Tyr
290 295 300
Leu Gln Gly Cys Asn Glu Gln Phe Ile Glu Ala Pro Gly Ile Arg Gly
305 310 315 320
Met Val Met Leu Val Phe Thr Leu Pro Gly Phe Asp Arg Val Phe Lys
325 330 335
Val Ile Lys Asp Arg Phe Ala Pro Gln Lys Glu Met Ser Ala Ala His
340 345 350
Val Arg Ala Cys Tyr Gln Leu Val Lys Glu His Asp Arg Val Gly Arg
355 360 365
Met Ala Asp Thr Gln Glu Phe Glu Asn Phe Val Leu Glu Lys Arg His
370 375 380
Ile Ser Pro Ala Leu Met Glu Leu Leu Leu Gln Glu Ala Ala Glu Lys
385 390 395 400
Ile Thr Asp Leu Gly Glu Gln Ile Val Ile Arg His Leu Tyr Ile Glu
405 410 415
Arg Arg Met Val Pro Leu Asn Ile Trp Leu Glu Gln Val Glu Gly Gln
420 425 430
Gln Leu Arg Asp Ala Ile Glu Glu Tyr Gly Asn Ala Ile Arg Gln Leu
435 440 445
Ala Ala Ala Asn Ile Phe Pro Gly Asp Met Leu Phe Lys Asn Phe Gly
450 455 460
Val Thr Arg His Gly Arg Val Val Phe Tyr Asp Tyr Asp Glu Ile Cys
465 470 475 480
Tyr Met Thr Glu Val Asn Phe Arg Asp Ile Pro Pro Pro Arg Tyr Pro
485 490 495
Glu Asp Glu Leu Ala Ser Glu Pro Trp Tyr Ser Val Ser Pro Gly Asp
500 505 510
Val Phe Pro Glu Glu Phe Arg His Trp Leu Cys Ala Asp Pro Arg Ile
515 520 525
Gly Pro Leu Phe Glu Glu Met His Ala Asp Leu Phe Arg Ala Asp Tyr
530 535 540
Trp Arg Ala Leu Gln Asn Arg Ile Arg Glu Gly His Val Glu Asp Val
545 550 555 560
Tyr Ala Tyr Arg Arg Arg Gln Arg Phe Ser Val Arg Tyr Gly Glu Met
565 570 575
Leu Phe
<210> 16
<211> 312
<212> PRT
<213>Artificial sequence
<220>
<223>
<400> 16
Met Asp Ile Ile Phe Tyr His Pro Thr Phe Asp Thr Gln Trp Trp Ile
1 5 10 15
Glu Ala Leu Arg Lys Ala Ile Pro Gln Ala Arg Val Arg Ala Trp Lys
20 25 30
Ser Gly Asp Asn Asp Ser Ala Asp Tyr Ala Leu Val Trp His Pro Pro
35 40 45
Val Glu Met Leu Ala Gly Arg Asp Leu Lys Ala Val Phe Ala Leu Gly
50 55 60
Ala Gly Val Asp Ser Ile Leu Ser Lys Leu Gln Ala His Pro Glu Met
65 70 75 80
Leu Asn Pro Ser Val Pro Leu Phe Arg Leu Glu Asp Thr Gly Met Gly
85 90 95
Glu Gln Met Gln Glu Tyr Ala Val Ser Gln Val Leu His Trp Phe Arg
100 105 110
Arg Phe Asp Asp Tyr Arg Ile Gln Gln Asn Ser Ser His Trp Gln Pro
115 120 125
Leu Pro Glu Tyr His Arg Glu Asp Phe Thr Ile Gly Ile Leu Gly Ala
130 135 140
Gly Val Leu Gly Ser Lys Val Ala Gln Ser Leu Gln Thr Trp Arg Phe
145 150 155 160
Pro Leu Arg Cys Trp Ser Arg Thr Arg Lys Ser Trp Pro Gly Val Gln
165 170 175
Ser Phe Ala Gly Arg Glu Glu Leu Ser Ala Phe Leu Ser Gln Cys Arg
180 185 190
Val Leu Ile Asn Leu Leu Pro Asn Thr Pro Glu Thr Val Gly Ile Ile
195 200 205
Asn Gln Gln Leu Leu Glu Lys Leu Pro Asp Gly Ala Tyr Leu Leu Asn
210 215 220
Leu Ala Arg Gly Val His Val Val Glu Asp Asp Leu Leu Ala Ala Leu
225 230 235 240
Asp Ser Gly Lys Val Lys Gly Ala Met Leu Asp Val Phe Asn Arg Glu
245 250 255
Pro Leu Pro Pro Glu Ser Pro Leu Trp Gln His Pro Arg Val Thr Ile
260 265 270
Thr Pro His Val Ala Ala Ile Thr Arg Pro Ala Glu Ala Val Glu Tyr
275 280 285
Ile Ser Arg Thr Ile Ala Gln Leu Glu Lys Gly Glu Arg Val Cys Gly
290 295 300
Gln Val Asp Arg Ala Arg Gly Tyr
305 310
<210> 17
<211> 533
<212> PRT
<213>Artificial sequence
<220>
<223>
<400> 17
Met Thr Glu Gln Ala Thr Thr Thr Asp Glu Leu Ala Phe Thr Arg Pro
1 5 10 15
Tyr Gly Glu Gln Glu Lys Gln Ile Leu Thr Ala Glu Ala Val Glu Phe
20 25 30
Leu Thr Glu Leu Val Thr His Phe Thr Pro Gln Arg Asn Lys Leu Leu
35 40 45
Ala Ala Arg Ile Gln Gln Gln Gln Asp Ile Asp Asn Gly Thr Leu Pro
50 55 60
Asp Phe Ile Ser Glu Thr Ala Ser Ile Arg Asp Ala Asp Trp Lys Ile
65 70 75 80
Arg Gly Ile Pro Ala Asp Leu Glu Asp Arg Arg Val Glu Ile Thr Gly
85 90 95
Pro Val Glu Arg Lys Met Val Ile Asn Ala Leu Asn Ala Asn Val Lys
100 105 110
Val Phe Met Ala Asp Phe Glu Asp Ser Leu Ala Pro Asp Trp Asn Lys
115 120 125
Val Ile Asp Gly Gln Ile Asn Leu Arg Asp Ala Val Asn Gly Thr Ile
130 135 140
Ser Tyr Thr Asn Glu Ala Gly Lys Ile Tyr Gln Leu Lys Pro Asn Pro
145 150 155 160
Ala Val Leu Ile Cys Arg Val Arg Gly Leu His Leu Pro Glu Lys His
165 170 175
Val Thr Trp Arg Gly Glu Ala Ile Pro Gly Ser Leu Phe Asp Phe Ala
180 185 190
Leu Tyr Phe Phe His Asn Tyr Gln Ala Leu Leu Ala Lys Gly Ser Gly
195 200 205
Pro Tyr Phe Tyr Leu Pro Lys Thr Gln Ser Trp Gln Glu Ala Ala Trp
210 215 220
Trp Ser Glu Val Phe Ser Tyr Ala Glu Asp Arg Phe Asn Leu Pro Arg
225 230 235 240
Gly Thr Ile Lys Ala Thr Leu Leu Ile Glu Thr Leu Pro Ala Val Phe
245 250 255
Gln Met Asp Glu Ile Leu His Ala Leu Arg Asp His Ile Val Gly Leu
260 265 270
Asn Cys Gly Arg Trp Asp Tyr Ile Phe Ser Tyr Ile Lys Thr Leu Lys
275 280 285
Asn Tyr Pro Asp Arg Val Leu Pro Asp Arg Gln Ala Val Thr Met Asp
290 295 300
Lys Pro Phe Leu Asn Ala Tyr Ser Arg Leu Leu Ile Lys Thr Cys His
305 310 315 320
Lys Arg Gly Ala Phe Ala Met Gly Gly Met Ala Ala Phe Ile Pro Ser
325 330 335
Lys Asp Glu Glu His Asn Asn Gln Val Leu Asn Lys Val Lys Ala Asp
340 345 350
Lys Ser Leu Glu Ala Asn Asn Gly His Asp Gly Thr Trp Ile Ala His
355 360 365
Pro Gly Leu Ala Asp Thr Ala Met Ala Val Phe Asn Asp Ile Leu Gly
370 375 380
Ser Arg Lys Asn Gln Leu Glu Val Met Arg Glu Gln Asp Ala Pro Ile
385 390 395 400
Thr Ala Asp Gln Leu Leu Ala Pro Cys Asp Gly Glu Arg Thr Glu Glu
405 410 415
Gly Met Arg Ala Asn Ile Arg Val Ala Val Gln Tyr Ile Glu Ala Trp
420 425 430
Ile Ser Gly Asn Gly Cys Val Pro Ile Tyr Gly Leu Met Glu Asp Ala
435 440 445
Ala Thr Ala Glu Ile Ser Arg Thr Ser Ile Trp Gln Trp Ile His His
450 455 460
Gln Lys Thr Leu Ser Asn Gly Lys Pro Val Thr Lys Ala Leu Phe Arg
465 470 475 480
Gln Met Leu Gly Glu Glu Met Lys Val Ile Ala Ser Glu Leu Gly Glu
485 490 495
Glu Arg Phe Ser Gln Gly Arg Phe Asp Asp Ala Ala Arg Leu Met Glu
500 505 510
Gln Ile Thr Thr Ser Asp Glu Leu Ile Asp Phe Leu Thr Leu Pro Gly
515 520 525
Tyr Arg Leu Leu Ala
530
<210> 18
<211> 723
<212> PRT
<213>Artificial sequence
<220>
<223>
<400> 18
Met Ser Gln Thr Ile Thr Gln Ser Arg Leu Arg Ile Asp Ala Asn Phe
1 5 10 15
Lys Arg Phe Val Asp Glu Glu Val Leu Pro Gly Thr Gly Leu Asp Ala
20 25 30
Ala Ala Phe Trp Arg Asn Phe Asp Glu Ile Val His Asp Leu Ala Pro
35 40 45
Glu Asn Arg Gln Leu Leu Ala Glu Arg Asp Arg Ile Gln Ala Ala Leu
50 55 60
Asp Glu Trp His Arg Ser Asn Pro Gly Pro Val Lys Asp Lys Ala Ala
65 70 75 80
Tyr Lys Ser Phe Leu Arg Glu Leu Gly Tyr Leu Val Pro Gln Pro Glu
85 90 95
Arg Val Thr Val Glu Thr Thr Gly Ile Asp Ser Glu Ile Thr Ser Gln
100 105 110
Ala Gly Pro Gln Leu Val Val Pro Ala Met Asn Ala Arg Tyr Ala Leu
115 120 125
Asn Ala Ala Asn Ala Arg Trp Gly Ser Leu Tyr Asp Ala Leu Tyr Gly
130 135 140
Ser Asp Ile Ile Pro Gln Glu Gly Ala Met Val Ser Gly Tyr Asp Pro
145 150 155 160
Gln Arg Gly Glu Gln Val Ile Ala Trp Val Arg Arg Phe Leu Asp Glu
165 170 175
Ser Leu Pro Leu Glu Asn Gly Ser Tyr Gln Asp Val Val Ala Phe Lys
180 185 190
Val Val Asp Lys Gln Leu Arg Ile Gln Leu Lys Asn Gly Lys Glu Thr
195 200 205
Thr Leu Arg Thr Pro Ala Gln Phe Val Gly Tyr Arg Gly Asp Ala Ala
210 215 220
Ala Pro Thr Cys Ile Leu Leu Lys Asn Asn Gly Leu His Ile Glu Leu
225 230 235 240
Gln Ile Asp Ala Asn Gly Arg Ile Gly Lys Asp Asp Pro Ala His Ile
245 250 255
Asn Asp Val Ile Val Glu Ala Ala Ile Ser Thr Ile Leu Asp Cys Glu
260 265 270
Asp Ser Val Ala Ala Val Asp Ala Glu Asp Lys Ile Leu Leu Tyr Arg
275 280 285
Asn Leu Leu Gly Leu Met Gln Gly Thr Leu Gln Glu Lys Met Glu Lys
290 295 300
Asn Gly Arg Gln Ile Val Arg Lys Leu Asn Asp Asp Arg His Tyr Thr
305 310 315 320
Ala Ala Asp Gly Ser Glu Ile Ser Leu His Gly Arg Ser Leu Leu Phe
325 330 335
Ile Arg Asn Val Gly His Leu Met Thr Ile Pro Val Ile Trp Asp Ser
340 345 350
Glu Gly Asn Glu Ile Pro Glu Gly Ile Leu Asp Gly Val Met Thr Gly
355 360 365
Ala Ile Ala Leu Tyr Asp Leu Lys Val Gln Lys Asn Ser Arg Thr Gly
370 375 380
Ser Val Tyr Ile Val Lys Pro Lys Met His Gly Pro Gln Glu Val Ala
385 390 395 400
Phe Ala Asn Lys Leu Phe Thr Arg Ile Glu Thr Met Leu Gly Met Ala
405 410 415
Pro Asn Thr Leu Lys Met Gly Ile Met Asp Glu Glu Arg Arg Thr Ser
420 425 430
Leu Asn Leu Arg Ser Cys Ile Ala Gln Ala Arg Asn Arg Val Ala Phe
435 440 445
Ile Asn Thr Gly Phe Leu Asp Arg Thr Gly Asp Glu Met His Ser Val
450 455 460
Met Glu Ala Gly Pro Met Leu Arg Lys Asn Gln Met Lys Ser Thr Pro
465 470 475 480
Trp Ile Lys Ala Tyr Glu Arg Asn Asn Val Leu Ser Gly Leu Phe Cys
485 490 495
Gly Leu Arg Gly Lys Ala Gln Ile Gly Lys Gly Met Trp Ala Met Pro
500 505 510
Asp Leu Met Ala Asp Met Tyr Ser Gln Lys Gly Asp Gln Leu Arg Ala
515 520 525
Gly Ala Asn Thr Ala Trp Val Pro Ser Pro Thr Ala Ala Thr Leu His
530 535 540
Ala Leu His Tyr His Gln Thr Asn Val Gln Ser Val Gln Ala Asn Ile
545 550 555 560
Ala Gln Thr Glu Phe Asn Ala Glu Phe Glu Pro Leu Leu Asp Asp Leu
565 570 575
Leu Thr Ile Pro Val Ala Glu Asn Ala Asn Trp Ser Ala Gln Glu Ile
580 585 590
Gln Gln Glu Leu Asp Asn Asn Val Gln Gly Ile Leu Gly Tyr Val Val
595 600 605
Arg Trp Val Glu Gln Gly Ile Gly Cys Ser Lys Val Pro Asp Ile His
610 615 620
Asn Val Ala Leu Met Glu Asp Arg Ala Thr Leu Arg Ile Ser Ser Gln
625 630 635 640
His Ile Ala Asn Trp Leu Arg His Gly Ile Leu Thr Lys Glu Gln Val
645 650 655
Gln Ala Ser Leu Glu Asn Met Ala Lys Val Val Asp Gln Gln Asn Ala
660 665 670
Gly Asp Pro Ala Tyr Arg Pro Met Ala Gly Asn Phe Ala Asn Ser Cys
675 680 685
Ala Phe Lys Ala Ala Ser Asp Leu Ile Phe Leu Gly Val Lys Gln Pro
690 695 700
Asn Gly Tyr Thr Glu Pro Leu Leu His Ala Trp Arg Leu Arg Glu Lys
705 710 715 720
Glu Ser His
<210> 19
<211> 499
<212> PRT
<213>Artificial sequence
<220>
<223>
<400> 19
Met Ser Ile Leu Tyr Glu Glu Arg Leu Asp Gly Ala Leu Pro Asp Val
1 5 10 15
Asp Arg Thr Ser Val Leu Met Ala Leu Arg Glu His Val Pro Gly Leu
20 25 30
Glu Ile Leu His Thr Asp Glu Glu Ile Ile Pro Tyr Glu Cys Asp Gly
35 40 45
Leu Ser Ala Tyr Arg Thr Arg Pro Leu Leu Val Val Leu Pro Lys Gln
50 55 60
Met Glu Gln Val Thr Ala Ile Leu Ala Val Cys His Arg Leu Arg Val
65 70 75 80
Pro Val Val Thr Arg Gly Ala Gly Thr Gly Leu Ser Gly Gly Ala Leu
85 90 95
Pro Leu Glu Lys Gly Val Leu Leu Val Met Ala Arg Phe Lys Glu Ile
100 105 110
Leu Asp Ile Asn Pro Val Gly Arg Arg Ala Arg Val Gln Pro Gly Val
115 120 125
Arg Asn Leu Ala Ile Ser Gln Ala Val Ala Pro His Asn Leu Tyr Tyr
130 135 140
Ala Pro Asp Pro Ser Ser Gln Ile Ala Cys Ser Ile Gly Gly Asn Val
145 150 155 160
Ala Glu Asn Ala Gly Gly Val His Cys Leu Lys Tyr Gly Leu Thr Val
165 170 175
His Asn Leu Leu Lys Ile Glu Val Gln Thr Leu Asp Gly Glu Ala Leu
180 185 190
Thr Leu Gly Ser Asp Ala Leu Asp Ser Pro Gly Phe Asp Leu Leu Ala
195 200 205
Leu Phe Thr Gly Ser Glu Gly Met Leu Gly Val Thr Thr Glu Val Thr
210 215 220
Val Lys Leu Leu Pro Lys Pro Pro Val Ala Arg Val Leu Leu Ala Ser
225 230 235 240
Phe Asp Ser Val Glu Lys Ala Gly Leu Ala Val Gly Asp Ile Ile Ala
245 250 255
Asn Gly Ile Ile Pro Gly Gly Leu Glu Met Met Asp Asn Leu Ser Ile
260 265 270
Arg Ala Ala Glu Asp Phe Ile His Ala Gly Tyr Pro Val Asp Ala Glu
275 280 285
Ala Ile Leu Leu Cys Glu Leu Asp Gly Val Glu Ser Asp Val Gln Glu
290 295 300
Asp Cys Glu Arg Val Asn Asp Ile Leu Leu Lys Ala Gly Ala Thr Asp
305 310 315 320
Val Arg Leu Ala Gln Asp Glu Ala Glu Arg Val Arg Phe Trp Ala Gly
325 330 335
Arg Lys Asn Ala Phe Pro Ala Val Gly Arg Ile Ser Pro Asp Tyr Tyr
340 345 350
Cys Met Asp Gly Thr Ile Pro Arg Arg Ala Leu Pro Gly Val Leu Glu
355 360 365
Gly Ile Ala Arg Leu Ser Gln Gln Tyr Asp Leu Arg Val Ala Asn Val
370 375 380
Phe His Ala Gly Asp Gly Asn Met His Pro Leu Ile Leu Phe Asp Ala
385 390 395 400
Asn Glu Pro Gly Glu Phe Ala Arg Ala Glu Glu Leu Gly Gly Lys Ile
405 410 415
Leu Glu Leu Cys Val Glu Val Gly Gly Ser Ile Ser Gly Glu His Gly
420 425 430
Ile Gly Arg Glu Lys Ile Asn Gln Met Cys Ala Gln Phe Asn Ser Asp
435 440 445
Glu Ile Thr Thr Phe His Ala Val Lys Ala Ala Phe Asp Pro Asp Gly
450 455 460
Leu Leu Asn Pro Gly Lys Asn Ile Pro Thr Leu His Arg Cys Ala Glu
465 470 475 480
Phe Gly Ala Met His Val His His Gly His Leu Pro Phe Pro Glu Leu
485 490 495
Glu Arg Phe
<210> 20
<211> 274
<212> PRT
<213>Artificial sequence
<220>
<223>
<400> 20
Met Val Ala Pro Ile Pro Ala Lys Arg Gly Arg Lys Pro Ala Val Ala
1 5 10 15
Thr Ala Pro Ala Thr Gly Gln Val Gln Ser Leu Thr Arg Gly Leu Lys
20 25 30
Leu Leu Glu Trp Ile Ala Glu Ser Asn Gly Ser Val Ala Leu Thr Glu
35 40 45
Leu Ala Gln Gln Ala Gly Leu Pro Asn Ser Thr Thr His Arg Leu Leu
50 55 60
Thr Thr Met Gln Gln Gln Gly Phe Val Arg Gln Val Gly Glu Leu Gly
65 70 75 80
His Trp Ala Ile Gly Ala His Ala Phe Met Val Gly Ser Ser Phe Leu
85 90 95
Gln Ser Arg Asn Leu Leu Ala Ile Val His Pro Ile Leu Arg Asn Leu
100 105 110
Met Glu Glu Ser Gly Glu Thr Val Asn Met Ala Val Leu Asp Gln Ser
115 120 125
Asp His Glu Ala Ile Ile Ile Asp Gln Val Gln Cys Thr His Leu Met
130 135 140
Arg Met Ser Ala Pro Ile Gly Gly Lys Leu Pro Met His Ala Ser Gly
145 150 155 160
Ala Gly Lys Ala Phe Leu Ala Gln Leu Ser Glu Glu Gln Val Thr Lys
165 170 175
Leu Leu His Arg Lys Gly Leu His Ala Tyr Thr His Ala Thr Leu Val
180 185 190
Ser Pro Val His Leu Lys Glu Asp Leu Ala Gln Thr Arg Lys Arg Gly
195 200 205
Tyr Ser Phe Asp Asp Glu Glu His Ala Leu Gly Leu Arg Cys Leu Ala
210 215 220
Ala Cys Ile Phe Asp Glu His Arg Glu Pro Phe Ala Ala Ile Ser Ile
225 230 235 240
Ser Gly Pro Ile Ser Arg Ile Thr Asp Asp Arg Val Thr Glu Phe Gly
245 250 255
Ala Met Val Ile Lys Ala Ala Lys Glu Val Thr Leu Ala Tyr Gly Gly
260 265 270
Met Arg
<210> 21
<211> 1602
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 21
atgactgaac aggcaacaac aaccgatgaa ctggctttca caaggccgta tggcgagcag 60
gagaagcaaa ttcttactgc cgaagcggta gaatttctga ctgagctggt gacgcatttt 120
acgccacaac gcaataaact tctggcagcg cgcattcagc agcagcaaga tattgataac 180
ggaacgttgc ctgattttat ttcggaaaca gcttccattc gcgatgctga ttggaaaatt 240
cgcgggattc ctgcggactt agaagaccgc cgcgtagaga taactggccc ggtagagcgc 300
aagatggtga tcaacgcgct caacgccaat gtgaaagtct ttatggccga tttcgaagat 360
tcactggcac cagactggaa caaagtgatc gacgggcaaa ttaacctgcg tgatgcggtt 420
aacggcacca tcagttacac caatgaagca ggcaaaattt accagctcaa gcccaatcca 480
gcggttttga tttgtcgggt acgcggtctg cacttgccgg aaaaacatgt cacctggcgt 540
ggtgaggcaa tccccggcag cctgtttgat tttgcgctct atttcttcca caactatcag 600
gcactgttgg caaagggcag tggtccctat ttctatctgc cgaaaaccca gtcctggcag 660
gaagcggcct ggtggagcga agtcttcagc tatgcagaag atcgctttaa tctgccgcgc 720
ggcaccatca aggcgacgtt gctgattgaa acgctgcccg ccgtgttcca gatggatgaa 780
atccttcacg cgctgcgtga ccatattgtt ggtctgaact gcggtcgttg ggattacatc 840
ttcagctata tcaaaacgtt gaaaaactat cccgatcgcg tcctgccaga cagacaggca 900
gtgacgatgg ataaaccatt cctgaatgct tactcacgcc tgttgattaa aacctgccat 960
aaacgcggtg cttttgcgat gggcggcatg gcggcgttta ttccgagcaa agatgaagag 1020
cacaataacc aggtgctcaa caaagtaaaa gcggataaat cgctggaagc caataacggt 1080
cacgatggca catggatcgc tcacccaggc cttgcggaca cggcaatggc ggtattcaac 1140
gacattctcg gctcccgtaa aaatcagctt gaagtgatgc gcgaacaaga cgcgccgatt 1200
actgccgatc agctgctggc accttgtgat ggtgaacgca ccgaagaagg tatgcgcgcc 1260
aacattcgcg tggctgtgca gtacatcgaa gcgtggatct ctggcaacgg ctgtgtgccg 1320
atttatggcc tgatggaaga tgcggcgacg gctgaaattt cccgtacctc gatctggcag 1380
tggatccatc atcaaaaaac gttgagcaat ggcaaaccgg tgaccaaagc cttgttccgc 1440
cagatgctgg gcgaagagat gaaagtcatt gccagcgaac tgggcgaaga acgtttctcc 1500
caggggcgtt ttgacgatgc cgcacgcttg atggaacaga tcaccacttc cgatgagtta 1560
attgatttcc tgaccctgcc aggctaccgc ctgttagcgt aa 1602
<210> 22
<211> 2172
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 22
atgagtcaaa ccataaccca gagccgttta cgcattgacg ccaattttaa acgttttgtg 60
gatgaagaag ttttaccggg aacagggctg gacgctgcgg cgttctggcg caattttgat 120
gagatcgttc atgatctggc accagaaaat cgtcagttgc tggcagaacg cgatcgcatt 180
caggcagcgc ttgatgagtg gcatcgcagc aatccggggc cggtaaaaga taaagcggcc 240
tataaatctt tcctgcgtga actgggctac ctggtgccgc aaccggagcg cgtgacggtg 300
gaaaccacgg gcattgacag cgaaatcacc agccaggcgg ggccgcagct ggtggttccg 360
gcaatgaacg cccgctacgc gctgaacgcg gcgaacgctc gctggggctc actgtacgat 420
gcgttatacg gcagcgacat catcccgcag gaaggggcga tggtcagcgg ctacgatccg 480
caacgcggtg agcaggttat cgcctgggtt cggcgtttcc tcgatgaatc tctaccgctg 540
gaaaacggca gctatcagga tgtggtggcg tttaaggtgg ttgataaaca attacgcatc 600
cagttgaaaa atggtaaaga aaccacgtta cgtactccag cacagtttgt cggttaccgt 660
ggcgatgccg ctgcgccgac ctgcattttg ctgaaaaata acggcctgca tattgagctg 720
caaatcgatg ccaatgggcg gattggcaaa gacgatccgg cgcacatcaa cgatgttatc 780
gtcgaagctg ctatcagtac cattctcgac tgcgaagatt cggtcgcggc ggttgatgcg 840
gaagataaaa tcctgctgta ccgcaacctg ctgggcctga tgcaggggac tctgcaagag 900
aaaatggaga aaaacggtcg gcaaatcgtg cgtaaactga atgacgatcg tcattacacc 960
gccgccgatg gctctgaaat ttctctgcac ggacgctcgc tgctgtttat ccgcaacgtg 1020
ggtcatttga tgaccattcc tgtgatttgg gacagcgaag gcaatgaaat cccggaaggc 1080
attcttgatg gcgtcatgac tggcgcgatt gccctctatg atttaaaagt gcagaaaaac 1140
tcgcgcactg gcagcgtcta tattgtgaaa ccgaaaatgc acggtccgca ggaagtggcg 1200
ttcgccaaca aactgtttac ccgcattgag acaatgctcg gtatggcacc gaataccctg 1260
aaaatgggca ttatggatga agaacgtcgg acctcgctga acttgcgtag ctgtatcgct 1320
caggcgcgca accgcgtggc gttcatcaat accggtttcc tcgaccgtac cggcgatgaa 1380
atgcattcgg tgatggaagc tggcccgatg ctgcgtaaaa atcagatgaa atcgacgcct 1440
tggatcaaag cctacgagcg taataacgtg ctttccggtc tgttctgtgg gctgcgcggt 1500
aaagcgcaaa ttggtaaagg catgtgggca atgccggacc tgatggcaga catgtacagc 1560
cagaagggcg accaactgcg tgccggggca aacacagcct gggttccgtc accaaccgct 1620
gctacgctcc atgcgctgca ctaccaccaa accaacgtac agagcgtaca agccaacatt 1680
gcccagaccg agttcaatgc tgaatttgaa ccgctgctgg acgatctgct gactattccg 1740
gttgctgaaa acgctaactg gtcggcgcaa gagatccaac aagagctgga taacaacgtg 1800
caggggattc tggggtacgt ggtgcgctgg gtggagcagg ggattggttg ttcaaaagtg 1860
ccggatattc acaatgtggc gttgatggaa gaccgcgcaa cgctgcgtat ctccagccag 1920
catatcgcca actggttacg tcacggtatt ctgaccaaag aacaggtgca ggcgtcgctg 1980
gagaatatgg cgaaagtggt tgatcagcaa aacgctggcg atccggctta tcgtccgatg 2040
gcggggaatt tcgctaactc gtgtgctttt aaagctgcca gcgatttaat cttcctcggc 2100
gtgaaacagc caaacggcta taccgaaccg ttattacacg cctggcgttt acgcgaaaaa 2160
gaaagtcatt aa 2172
<210> 23
<211> 1500
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 23
atgagcatct tgtacgaaga gcgtcttgat ggcgctttac ccgatgtcga ccgcacatcg 60
gtactgatgg cactgcgtga gcatgtccct ggacttgaga tcctgcatac cgatgaggag 120
atcattcctt acgagtgtga cgggttgagc gcgtatcgca cgcgtccatt actggttgtt 180
ctgcctaagc aaatggaaca ggtgacagcg attctggctg tctgccatcg cctgcgtgta 240
ccggtggtga cccgtggtgc aggcaccggg ctttctggtg gcgcgctgcc gctggaaaaa 300
ggtgtgttgt tggtgatggc gcgctttaaa gagatcctcg acattaaccc cgttggtcgc 360
cgcgcgcgcg tgcagccagg cgtgcgtaac ctggcgatct cccaggccgt tgcaccgcat 420
aatctctact acgcaccgga cccttcctca caaatcgcct gttccattgg cggcaatgtg 480
gctgaaaatg ccggcggcgt ccactgcctg aaatatggtc tgaccgtaca taacctgctg 540
aaaattgaag tgcaaacgct ggacggcgag gcactgacgc ttggatcgga cgcgctggat 600
tcacctggtt ttgacctgct ggcgctgttc accggatcgg aaggtatgct cggcgtgacc 660
accgaagtga cggtaaaact gctgccgaag ccgcccgtgg cgcgggttct gttagccagc 720
tttgactcgg tagaaaaagc cggacttgcg gttggtgaca tcatcgccaa tggcattatc 780
cccggcgggc tggagatgat ggataacctg tcgatccgcg cggcggaaga ttttattcat 840
gccggttatc ccgtcgacgc cgaagcgatt ttgttatgcg agctggacgg cgtggagtct 900
gacgtacagg aagactgcga gcgggttaac gacatcttgt tgaaagcggg cgcgactgac 960
gtccgtctgg cacaggacga agcagagcgc gtacgtttct gggccggtcg caaaaatgcg 1020
ttcccggcgg taggacgtat ctccccggat tactactgca tggatggcac catcccgcgt 1080
cgcgccctgc ctggcgtact ggaaggcatt gcccgtttat cgcagcaata tgatttacgt 1140
gttgccaacg tctttcatgc cggagatggc aacatgcacc cgttaatcct tttcgatgcc 1200
aacgaacccg gtgaatttgc ccgcgcggaa gagctgggcg ggaagatcct cgaactctgc 1260
gttgaagttg gcggcagcat cagtggcgaa catggcatcg ggcgagaaaa aatcaatcaa 1320
atgtgcgccc agttcaacag cgatgaaatc acgaccttcc atgcggtcaa ggcggcgttt 1380
gaccccgatg gtttgctgaa ccctgggaaa aacattccca cgctacaccg ctgtgctgaa 1440
tttggtgcca tgcatgtgca tcacggtcat ttacctttcc ctgaactgga gcgtttctga 1500
<210> 24
<211> 825
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 24
atggtcgcac ccattcccgc gaaacgcggc agaaaacccg ccgttgccac cgcaccagcg 60
actggacagg ttcagtcttt aacgcgtggc ctgaaattac tggagtggat tgccgaatcc 120
aatggcagtg tggcactcac ggaactggcg caacaagccg ggttacccaa ttccacgacc 180
caccgcctgc taaccacgat gcaacagcag ggtttcgtgc gtcaggttgg cgaactggga 240
cattgggcaa tcggcgcaca tgcctttatg gtcggcagca gctttctcca gagccgtaat 300
ttgttagcga ttgttcaccc tatcctgcgc aatctaatgg aagagtctgg cgaaacggtc 360
aatatggcgg tgcttgatca aagcgatcac gaagcgatta ttatcgacca ggtacagtgt 420
acgcatctga tgcgaatgtc cgcgcctatc ggcggtaaat tgccgatgca cgcttccggt 480
gcgggtaaag cctttttagc ccaactgagc gaagaacagg tgacgaagct gctgcaccgc 540
aaagggttac atgcctatac ccacgcaacg ctggtgtctc ctgtgcattt aaaagaagat 600
ctcgcccaaa cgcgcaaacg gggttattca tttgacgatg aggaacatgc actggggcta 660
cgttgccttg cagcgtgtat tttcgatgag caccgtgaac cgtttgccgc aatttctatt 720
tccggaccga tttcacgtat taccgatgac cgcgtgaccg agtttggcgc gatggtgatt 780
aaagcggcga aggaagtgac gctggcgtac ggtggaatgc gctga 825
Claims (10)
1. preparing the method for the engineering bacteria for producing glycolic, comprise the following steps：Acetyl coenzyme A in recipient bacterium is improved to synthesize
Enzyme, phosphate transacetylase, acetokinase, citrate synthase, isocitrate lyase, isocitric dehydrogenase kinases, glyoxalic acid
The expression of reductase and/or activity, and reduce malate synthase in the recipient bacterium, glycolate oxidase and isocitric acid cracking
The expression of enzyme repression albumen and/or activity, so as to obtain the engineering bacteria for being used to produce glycolic；The recipient bacterium is can
The bacterium of carbon source for growth is used as using acetic acid.
2. according to the method for claim 1, it is characterised in that：
The amino acid sequence of the acetyl-CoA-synthetase is sequence 10 or to protect that functional is random or/and fixed point in sequence table
Mutagenized sequences；And/or
The amino acid sequence of the phosphate transacetylase is sequence 11 or to protect that functional is random or/and direct mutagenesis in sequence table
Sequence；And/or
The amino acid sequence of the acetokinase is sequence 12 or to protect that functional is random or/and direct mutagenesis sequence in sequence table
Row；And/or
The amino acid sequence of the citrate synthase is sequence 13 or to protect that functional is random or/and direct mutagenesis sequence in sequence table
Row；And/or
The amino acid sequence of the isocitrate lyase is sequence 14 in sequence table or guarantor's functional is random or/and fixed point lures
Become sequence；And/or
The amino acid sequence of the isocitric dehydrogenase kinases is that sequence 15 or guarantor's functional are random or/and fixed in sequence table
Point mutagenized sequences；And/or
The amino acid sequence of the glyoxylate reductase is sequence 16 or to protect that functional is random or/and direct mutagenesis in sequence table
Sequence；And/or
The malate synthase is malate synthase 1 and/or malate synthase 2；The amino acid sequence of the malate synthase 1 is
Sequence 17 or protect that functional is random or/and direct mutagenesis sequence in sequence table；The amino acid sequence of the malate synthase 2 is
Sequence 18 or protect that functional is random or/and direct mutagenesis sequence in sequence table；And/or
The amino acid sequence of the glycolate oxidase is sequence 19 or to protect that functional is random or/and direct mutagenesis in sequence table
Sequence；And/or
The amino acid sequence of the isocitrate lyase aporepressor be in sequence table sequence 20 or protect functional it is random or/
With direct mutagenesis sequence.
3. method according to claim 1 or 2, it is characterised in that：It is described " improve recipient bacterium in acetyl-CoA-synthetase,
Phosphate transacetylase, acetokinase, citrate synthase, isocitrate lyase, isocitric dehydrogenase kinases, glyoxalic acid reduction
The expression of enzyme and/or activity " is to turn second by importing encoding gene, the phosphoric acid of acetyl-CoA-synthetase into the recipient bacterium
The encoding gene of acyl enzyme, the encoding gene of acetokinase, the encoding gene of citrate synthase, the coding base of isocitrate lyase
Realized because of the encoding gene of the, encoding gene of isocitric dehydrogenase kinases and glyoxylate reductase；
It is described " to reduce the table of malate synthase, glycolate oxidase and isocitrate lyase aporepressor in the recipient bacterium
Reach and/or activity " be encoding gene by knocking out the encoding gene of malate synthase, glycolate oxidase in the recipient bacterium
Realized with the encoding gene of isocitrate lyase aporepressor.
4. according to the method for claim 3, it is characterised in that：
The nucleotides sequence of the encoding gene of the acetyl-CoA-synthetase is classified as the 70-2028 positions of sequence 2 or guarantor in sequence table
Functional is random or/and direct mutagenesis sequence；And/or
The nucleotides sequence of the encoding gene of the phosphate transacetylase is classified as the 1347-3491 positions of sequence 3 or guarantor in sequence table
Functional is random or/and direct mutagenesis sequence；And/or
The nucleotides sequence of the encoding gene of the acetokinase is classified as the 70-1272 positions of sequence 3 in sequence table or possesses function
Random or/and direct mutagenesis sequence；And/or
The nucleotides sequence of the encoding gene of the citrate synthase is classified as the 70-1353 positions of sequence 1 in sequence table or possesses work(
The random or/and direct mutagenesis sequence of energy；And/or
The nucleotides sequence of the encoding gene of the isocitrate lyase is classified as the 70-1374 positions of sequence 5 or guarantor in sequence table
Functional is random or/and direct mutagenesis sequence；And/or
The nucleotides sequence of the encoding gene of the isocitric dehydrogenase kinases is classified as the 1557-3293 of sequence 5 in sequence table
Position protects that functional is random or/and direct mutagenesis sequence；And/or
The nucleotides sequence of the encoding gene of the glyoxylate reductase is classified as the 70-1008 positions of sequence 4 in sequence table or possessed
The random or/and direct mutagenesis sequence of function；And/or
The nucleotides sequence of the encoding gene of the malate synthase 1 be classified as in sequence table sequence 21 or protect functional it is random or/
With direct mutagenesis sequence；And/or
The nucleotides sequence of the encoding gene of the malate synthase 2 be classified as in sequence table sequence 22 or protect functional it is random or/
With direct mutagenesis sequence；
The nucleotides sequence of the encoding gene of the glycolate oxidase be classified as in sequence table sequence 23 or protect functional it is random or/
With direct mutagenesis sequence；And/or
The nucleotides sequence of the encoding gene of the isocitrate lyase aporepressor is classified as sequence 24 in sequence table or possesses work(
The random or/and direct mutagenesis sequence of energy.
5. the method according to claim 3 or 4, it is characterised in that：The encoding gene of the acetyl-CoA-synthetase is logical
The DNA molecular in sequence table shown in sequence 2 is crossed to import in the recipient bacterium；And/or
The encoding gene of the encoding gene of the phosphate transacetylase and the acetokinase is by sequence table shown in sequence 3
DNA molecular import in the recipient bacterium；And/or
The encoding gene of the citrate synthase is to be imported by the DNA molecular shown in sequence in sequence table 1 in the recipient bacterium
's；And/or
The encoding gene of the encoding gene of the isocitrate lyase and the isocitric dehydrogenase kinases is to pass through sequence
DNA molecular in table shown in sequence 5 is imported in the recipient bacterium；And/or
The encoding gene of the glyoxylate reductase is to import the recipient bacterium by the DNA molecular shown in sequence in sequence table 4
In.
6. the method according to claim 3 or 4, it is characterised in that：The encoding gene of the malate synthase 1 be by λ-
What the mode of red homologous recombinations was knocked out, the nucleotides sequence of wherein homologous recombination fragment is classified as sequence 6 in sequence table；And/or
The encoding gene of the malate synthase 2 is knocked out by way of λ-red homologous recombinations, wherein homologous recombination
The nucleotides sequence of fragment is classified as sequence 7 in sequence table；And/or
The encoding gene of the glycolate oxidase is knocked out by way of λ-red homologous recombinations, wherein homologous heavy
The nucleotides sequence of pack section is classified as sequence 8 in sequence table；And/or
The encoding gene of the isocitrate lyase aporepressor is knocked out by way of λ-red homologous recombinations,
The nucleotides sequence of wherein homologous recombination fragment is classified as sequence 9 in sequence table.
7. according to any described method in claim 1-7, it is characterised in that：The recipient bacterium is Escherichia coli, Cray primary
Salmonella or saccharomycete.
8. the engineering bacteria for being used to produce glycolic being prepared by any described method in claim 1-7.
9. application of the engineering bacteria described in claim 8 in glycolic is produced using acetic acid as substrate.
10. a kind of method for producing glycolic, comprises the following steps：Using acetic acid as carbon source, institute in fermented and cultured claim 8
Engineering bacteria is stated, tunning is collected, therefrom obtains glycolic.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710940646.1A CN107603998B (en) | 2017-10-11 | 2017-10-11 | Genetically engineered bacterium for producing glycolic acid by using acetic acid and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710940646.1A CN107603998B (en) | 2017-10-11 | 2017-10-11 | Genetically engineered bacterium for producing glycolic acid by using acetic acid and construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107603998A true CN107603998A (en) | 2018-01-19 |
| CN107603998B CN107603998B (en) | 2020-10-09 |
Family
ID=61068849
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710940646.1A Active CN107603998B (en) | 2017-10-11 | 2017-10-11 | Genetically engineered bacterium for producing glycolic acid by using acetic acid and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107603998B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109266596A (en) * | 2018-09-28 | 2019-01-25 | 中国科学院微生物研究所 | Efficiently utilize the Escherichia coli recombinant strain and its construction method of fatty acid synthesis glycine and application |
| CN109337848A (en) * | 2018-10-19 | 2019-02-15 | 北京化工大学 | Genetic engineering bacterium that is a kind of while producing glycolic and lactic acid and its construction method and application |
| CN112695051A (en) * | 2019-10-22 | 2021-04-23 | 北京化工大学 | Genetically engineered bacterium for producing ethanol by using xylose and construction method and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101437949A (en) * | 2006-05-09 | 2009-05-20 | 三井化学株式会社 | Method of producing hydroxycarboxylic acid by regenerating coenzyme |
| CN101466841A (en) * | 2006-06-09 | 2009-06-24 | 代谢探索者公司 | Glycolic acid production by fermentation from renewable resources |
| CN105126242A (en) * | 2015-07-26 | 2015-12-09 | 北京化工大学 | Polymer coating microneedle patch convenient for antibiotic skin testing and preparation method thereof |
| CN105586304A (en) * | 2014-11-18 | 2016-05-18 | 北京化工大学 | Recombinant strain for producing glycolate based polymers and application of recombinant strain |
-
2017
- 2017-10-11 CN CN201710940646.1A patent/CN107603998B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101437949A (en) * | 2006-05-09 | 2009-05-20 | 三井化学株式会社 | Method of producing hydroxycarboxylic acid by regenerating coenzyme |
| CN101466841A (en) * | 2006-06-09 | 2009-06-24 | 代谢探索者公司 | Glycolic acid production by fermentation from renewable resources |
| CN105586304A (en) * | 2014-11-18 | 2016-05-18 | 北京化工大学 | Recombinant strain for producing glycolate based polymers and application of recombinant strain |
| CN105126242A (en) * | 2015-07-26 | 2015-12-09 | 北京化工大学 | Polymer coating microneedle patch convenient for antibiotic skin testing and preparation method thereof |
Non-Patent Citations (1)
| Title |
|---|
| CAM Y ET.AL: "Engineering of a synthetic metabolic pathway for the assimilation of (D)-xylose into value-added chemicals.", 《ACS SYNTH BIOL》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109266596A (en) * | 2018-09-28 | 2019-01-25 | 中国科学院微生物研究所 | Efficiently utilize the Escherichia coli recombinant strain and its construction method of fatty acid synthesis glycine and application |
| CN109266596B (en) * | 2018-09-28 | 2022-03-01 | 中国科学院微生物研究所 | Escherichia coli recombinant bacterium for efficiently synthesizing glycine by using fatty acid and construction method and application thereof |
| CN109337848A (en) * | 2018-10-19 | 2019-02-15 | 北京化工大学 | Genetic engineering bacterium that is a kind of while producing glycolic and lactic acid and its construction method and application |
| CN109337848B (en) * | 2018-10-19 | 2022-03-01 | 北京化工大学 | Genetically engineered bacterium for simultaneously producing glycolic acid and lactic acid and construction method and application thereof |
| CN112695051A (en) * | 2019-10-22 | 2021-04-23 | 北京化工大学 | Genetically engineered bacterium for producing ethanol by using xylose and construction method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107603998B (en) | 2020-10-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7470770B2 (en) | Gene encoding malic enzyme and method for preparing succinic acid using the same | |
| JP6341936B2 (en) | High production strain of 5-aminolevulinic acid and its production method and use | |
| US7241594B2 (en) | Gene encoding formate dehydrogenases D & E and method for preparing succinic acid using the same | |
| US7588934B2 (en) | Gene encoding fumarate hydratase C and use thereof | |
| CN109321590B (en) | Genetically engineered bacterium for producing L-lactic acid by using acetic acid and construction method and application thereof | |
| JP5644108B2 (en) | Method for producing organic acid | |
| JPWO2008133131A1 (en) | Method for producing organic acid | |
| JP2016518145A (en) | Recombinant E. coli and the use of recombinant E. coli to produce succinic acid | |
| CN102994439A (en) | Escherichia coli recombinant strain producing shikimic acid, and construction method and application thereof | |
| CN104254612A (en) | A method of production of 2,4-dihydroxybutyric acid | |
| CN107603998A (en) | Utilize the genetic engineering bacterium and its construction method of acetic acid production glycolic and application | |
| CA2947663A1 (en) | Genetically modified microorganism for improved production of fine chemicals on sucrose | |
| CN109554386A (en) | A kind of utilizing works Escherichia coli are using Corncob hydrolysate as the method for substrate high yield D- xylonic | |
| CN111748535B (en) | Alanine dehydrogenase mutant and application thereof in fermentation production of L-alanine | |
| CN102517303B (en) | Recombination blue-green alga for producing lactic acid as well as preparation method and applications thereof | |
| CN112080452B (en) | High-yield phenyllactic acid bacillus licheniformis genetically engineered bacterium, method for producing phenyllactic acid and application | |
| CN106434772B (en) | One plant of genetic engineering bacterium for producing L MALIC ACID and its construction method and application | |
| CN110904062B (en) | Strain capable of producing L-alanine at high yield | |
| CN107119003B (en) | Recombinant bacterium for synthesizing 3-hydroxypropionic acid by utilizing glucan and construction method and application thereof | |
| CN102286387A (en) | Construction method and use of fumaric acid producing candida glabrata engineering strain | |
| CN107267476B (en) | It a kind of lactic dehydrogenase and its is applied in preparing lactic acid | |
| JP5609869B2 (en) | Method for producing organic acid | |
| EP2995684B1 (en) | Recombinant microorganism metabolizing 3,6-anhydride-l-galactose and a use thereof | |
| CN106086082B (en) | A method of improvement recombination bacillus coli produces 9- decenol | |
| CN114317306B (en) | Genetically engineered strain for synthesizing resveratrol and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |