CN112695047B

CN112695047B - Method for producing fucoxanthin by using mutant strain expressing exogenous pyruvate phosphate dikinase in phaeodactylum tricornutum

Info

Publication number: CN112695047B
Application number: CN202110031208.XA
Authority: CN
Inventors: 范勇; 李福利; 姜尔颖; 丁晓婷; 师晓艺
Original assignee: Qingdao Institute of Bioenergy and Bioprocess Technology of CAS
Current assignee: Qingdao High Energy Hecheng Biotechnology Co ltd
Priority date: 2021-01-11
Filing date: 2021-01-11
Publication date: 2021-11-30
Anticipated expiration: 2041-01-11
Also published as: CN112695047A

Abstract

The invention provides a method for producing fucoxanthin by a mutant strain expressing exogenous pyruvate phosphate dikinase in phaeodactylum tricornutum, in particular to a method for optimizing algae preference codons of an original CyPPDK gene to obtain a new CyPPDK gene, wherein the nucleotide sequence is shown as SEQ ID No. 7; the constructed shuttle expression vector is named pPha-fcp-PPDK; introducing the cells into a host algae cell Phaeodactylum tricornutum by an electrotransformation mode, and screening a transformant to obtain a transgenic phaeodactylum tricornutum strain over-expressing pyruvate phosphate dikinase; compared with the non-optimized transformant, the optimized transformant carrying out phosphorylation sites on CyPPDK gene has the advantages that the biomass accumulation is improved by 33.3 percent, the content of EPA in oil is improved by 11.5 percent, and the yield of fucoxanthin is improved by 21.2 percent.

Description

Method for producing fucoxanthin by using mutant strain expressing exogenous pyruvate phosphate dikinase in phaeodactylum tricornutum

Technical Field

The invention relates to a method for producing fucoxanthin by expressing exogenous pyruvate phosphate dikinase overexpression mutant strains in phaeodactylum tricornutum, belonging to the technical field of biological engineering.

Background

Phaeodactylum tricornutum belongs to the phylum Diatom, class Luciformes, order Phaeodactylum, genus Phaeodactylum, is an important aquatic food, and is rich in active substances such as EPA (Eicosapentaenoic acid) and Fucoxanthin (Fucoxanthin). Fucoxanthin, also known as fucoxanthin, is an oxygen-containing derivative of carotene having one allene bond, one epoxide, and one conjugated carbonyl group on its molecular polyene chain, and is a polar carotenoid. Fucoxanthin has various biological activities, and has effects of promoting metabolism, increasing metabolism of triglyceride and cholesterol, resisting inflammation, tumor, obesity and oxidation. The phaeodactylum tricornutum has high propagation speed, can be cultured in a photoreactor, and has high content of unsaturated fatty acid and fucoxanthin in cells, so that the improvement of the phaeodactylum tricornutum to improve the accumulation of the fucoxanthin and the polyunsaturated fatty acid has important significance.

C₄C contained in plant₄Related enzymes in the pathway can promote the conversion of CO into mesophyll cells₂With C₄The compound is fixed, so that the plant can utilize limited water and low-concentration CO under the conditions of strong light, high temperature, drought and other adverse conditions and closed leaf pores₂And high photosynthetic efficiency is kept. Currently, a series of C's are screened and identified in Phaeodactylum tricornutum₄A gene related to the pathway, wherein Pyruvate Phosphate Dikinase (PPDK) is C₄A very important rate-limiting enzyme in the photosynthetic pathway catalyzes pyruvate and ATP to produce phosphoenolpyruvate. And phosphoenolpyruvate can bind CO₂Thus the step is C₄The photosynthetic pathway provides an important carbon skeleton. In plants, two forms of PPDK were detected. One is Chloroplast localized PPDK (Chloroplast PPDK), and the other is Cytoplasmic PPDK (Cytoplastic PPDK). CyPPDK is generally expressed in non-photosynthetic tissues of plants, such as roots and seeds. Some studies found C₃The PPDK gene overexpression in the plant generates obvious response to some adversity stresses, and the tolerance of the plant to the adversity stresses is improved.

Disclosure of Invention

Aiming at the problem of low fucoxanthin yield in the existing large-scale culture of phaeodactylum tricornutum, the invention aims to use the genetic transformation technology to convert exogenous C₄The CyPPDK of the pathway is over-expressed in phaeodactylum tricornutum, and the phosphorylation of the enzyme activity is regulated and controlledThe site optimization improves the enzyme catalysis level, promotes the carbon fixation efficiency of cells, and improves the accumulation of unsaturated fatty acid and fucoxanthin.

The inventor finds that the phaeodactylum tricornutum algae is extremely sensitive to temperature in the culture process, and the temperature rise greatly influences the culture and production of the phaeodactylum tricornutum algae in the seasonal variation process, so that the construction of the mutant algae species capable of tolerating higher temperature (more than 35 ℃ and less than 40 ℃) is helpful for the production of the phaeodactylum tricornutum algae. Therefore, the CyPPDK in the exogenous marine microalgae is further expressed in the phaeodactylum tricornutum through codon optimization and phosphorylation site optimization for the first time by a genetic transformation technology, and the growth rate and the accumulation amount of EPA and fucoxanthin of the transformation mutant strain at high temperature are obviously improved.

A method for constructing a mutant strain of overexpressed pyruvate phosphate dikinase in phaeodactylum tricornutum comprises the following steps:

(1) carrying out algae preference codon optimization on the original CyPPDK gene to obtain a new CyPPDK gene, wherein the nucleotide sequence is shown as SEQ ID No. 7;

(2) construction of overexpression vector of CyPPDK gene

Using plasmid pPha-T1 (figure 1) as a basic expression vector, using fcp-A as a promoter, inserting the PPDK gene obtained above into the downstream of the fcp-A promoter to construct a PPDK expression vector, using plasmid pPha-T1 as a template, and using primers pPha-BB-F/R to perform PCR amplification on a skeleton fragment required by the constructed vector; PCR amplifying PPDK gene segment by using the obtained PPDK gene as a template and using a primer CyPPDK-F/R; based on the overlapping region between the PPDK fragment and the vector backbone fragment, the fragments were ligated using a seamless ligase kit, and the constructed shuttle expression vector was named pPha-fcp-PPDK, and the primer sequences were as follows:

pPha-BB-F：aaggcgcactaacagaagcgtgctatcgaact SEQ ID NO.1；

pPha-BB-R：ttttcgcggcatcattcgaaacggcagacaaa SEQ ID NO.2；

CyPPDK-F：gtttcgaatgatgccgcgaaaagacaagtg SEQ ID NO.3；

CyPPDK-R：cacgcttctgttagtgcgccttgccattac SEQ ID NO.4。

the italicized bold portions of the sequence indicate the overlapping (over-lap) segments that need to be designed during vector construction using a seamless ligase.

(3) Preparation of transformant

Taking the expression vector pPha-fcp-PPDK constructed in the step (2) as a template, utilizing a primer Trans-F/R to perform PCR amplification on a PPDK gene and a linearized fragment of a resistance gene (figure 2), introducing the PPDK gene and the linearized fragment into a host algal cell Phaeodactylum tricornutum (Phaeodactylum tricornutum) cell in an electrotransformation way, and screening a transformant to obtain a Phaeodactylum tricornutum transgenic algal strain over-expressing pyruvate phosphate dikinase, wherein the sequence of the primer is as follows:

Trans-F：atttaggtgacactatagaaccaga SEQ ID NO.5

Trans-R：gcttatcgaaattaatacgactcactataggga SEQ ID NO.6。

preferably, the PCR reaction system in step (2) is as follows:

DNA template 0.5. mu.L, upstream primer 10. mu.M 1. mu.L, downstream primer 10. mu.M 1. mu.L, KAPA HiFi DNA polymerase 12.5. mu.L, ddH₂O 10μL。

Further preferably, the PCR reaction conditions in step (2) are as follows:

pre-denaturation at 95 ℃ for 5 min; denaturation at 98 ℃ for 20s, annealing at 15s, extension at 72 ℃ for 2000bp/min, repeating 35 cycles; extension at 72 ℃ for 5 min.

Preferably, the PCR reaction system in step (3) is as follows:

DNA template 0.5. mu.L, upstream primer 10. mu.M 1. mu.L, downstream primer 10. mu.M 1. mu.L, KAPA HiFi DNA polymerase 25. mu.L, ddH₂O 22.5μL。

Further preferably, the PCR reaction conditions in step (3) are as follows:

Preferably, in step (3), the host algal cells are cultured in f/2 liquid medium to logarithmic growth phase, and are collected by centrifugal concentration (3-5). times.10)⁸(ii) individual cells; using 375 (c)Washing 4-6 times with mM sorbitol, adding 3-5 μ g PPDK gene and linear fragment of resistance gene into the algae solution, mixing uniformly, and placing on ice for reaction for 10-60 minutes; adding the algae liquid after reaction into an electric rotating cup, and carrying out electric shock under the conditions of 500-1500V, 400-1000 omega and 25-100 muF; immediately transferring the electrically shocked algae liquid to 10mL of fresh f/2 culture medium, and recovering for 24-48 hours at room temperature in a dark place; centrifuging the recovered algae liquid for 1500g 5 minutes, discarding the supernatant, suspending the algae liquid in a proper amount of fresh culture medium, coating the algae liquid on an f/2 resistant plate containing 5-100 mu g/ml of bleomycin resistance, culturing the algae liquid in an illumination incubator, and selecting transformants after 6-12 weeks.

Preferably, the Kit Trans Direct Plant Tissue PCR Kit is used for extracting the genome of the transformant, then the Direct PCR amplification operation is carried out on the algae cells, and the positive clone is verified by PCR product sequencing.

The culture method of the transgenic algae strain comprises the following steps:

culturing the transgenic strain at 22 + -1 deg.C for 10 days under the condition of illumination of 50 μmol phosns m for the first 7 days^-2·s^-1The light intensity is 16h light, 8h dark, and the rest 3 days 24h light.

According to the present invention, preferably, in the above culture method, the transgenic algal strain is cultured in f/2 medium.

The transgenic algae strain is applied to producing fucoxanthin and/or EPA.

Use of pyruvate phosphate dikinase in diatom to increase production of fucoxanthin and/or EPA.

According to the invention, the nucleotide sequence of the coding gene of the pyruvate phosphate dikinase is shown as SEQ ID NO. 10.

According to the invention, the amino acid sequence of the pyruvate phosphate dikinase is shown as SEQ ID NO. 8.

Preferably according to the invention, the diatom is phaeodactylum tricornutum.

The invention constructs codon optimization and phosphorylation site optimization based on exogenous CyPPDK, and expresses in Phaeodactylum tricornutum to ensure that the Phaeodactylum tricornutum has cytoplasmNow C₄The possibility of the pathway phenotypically increases the content of unsaturated fatty acids and fucoxanthin in the phaeodactylum tricornutum under high temperature conditions.

The invention has the beneficial effects

1. According to the invention, the exogenous CyPPDK gene is expressed in Phaeodactylum tricornutum, so that the growth rate of the transgenic algae is improved by 53%, the content of EPA in oil is improved by 25%, and the yield of fucoxanthin is improved by 36% compared with the growth rate of the wild algae under the high-temperature and high-light conditions in summer.

2. According to the invention, phosphorylation sites of CyPPDK genes are optimized, and compared with a CyPPDK transformant without optimized phosphorylation sites, the biomass accumulation of the CyPPDK transformant with optimized phosphorylation sites is improved by 33.3%, the content of EPA in oil is improved by 11.5%, and the yield of fucoxanthin is improved by 21.2%.

Drawings

FIG. 1 construction and linearization of pPha-fcp-PPDK expression vector;

FIG. 2 PCR validation of CyPPDK fragment in transformants;

FIG. 3 growth curves of UN-CyPPDK transformant, OP-CyPPDK and wild type algal strains;

FIG. 4 EPA contents of UN-CyPPDK transformant, OP-CyPPDK transformant and wild type algal strain;

FIG. 5 fucoxanthin contents of UN-CyPPDK transformant, OP-CyPPDK transformant and wild type algal strain;

FIG. 6 shows the growth curves of UN-CyPPDK transformant, OP-CyPPDK and wild strain under high temperature conditions;

FIG. 7 EPA contents of UN-CyPPDK transformant, OP-CyPPDK transformant and wild type algal strain under high temperature condition;

FIG. 8 shows the fucoxanthin contents of the UN-CyPPDK transformant, OP-CyPPDK transformant and wild type algal strains under high temperature conditions.

Detailed Description

The technical solutions of the present invention are further described below with reference to the following embodiments and the drawings of the specification, but the scope of the present invention is not limited thereto.

Source of biological material

Phaeodactylum tricornutum (Phaeodactylum tricornutum) purchased from microalgae germplasm pool of China oceanic university, number MACC/B228; plasmid pPha-T1 was constructed from public data of the database, GenBank: AF 219942.1; the PPDK gene was synthesized by Beijing Ongkogaku Biotechnology Co., Ltd after modifying a specific base according to the public data of the database (GenBank: EWM23135.1) and bioinformatics analysis.

Other sources of raw materials

The sea salt is Blue Treasure sea salt purchased from saline science and technology limited of Qingdao sea, and is a common commercial product.

The contents of the examples, which are not specified in specific conditions, were carried out under conventional conditions; the reagents or instruments used are not indicated by manufacturers, and are all common commercial products.

Algal Strain number Specification

OP-CyPPDK, mutant strain obtained by transformation of CyPPDK with optimized phosphorylation site

UN-CyPPDK, a mutant strain obtained by transforming non-phosphorylation site-optimized CyPPDK

WT, wild type algal strain

Example 1

Specific phosphorylation site prediction of the PPDK protein (GenBank: EWM23135.1) of exogenous Nannochloropsis sp was performed using Netphos, reference Blom N, Gamma Lift S, Brunak S.sequence and structure-based prediction of eukaryotic protein phosphorylation sites [ J ]. Journal of Molecular Biology,1999,294(5): 1351-62. 79(T) in the protein sequence in the analysis result; 93 (S); 165 (T); 190 (S); 193 (S); 246 (S); 251 (T); 256 (T); 290 (T); 312 (T); 334 (T); 336 (T); 340 (T); 386 (T); 482 (T); 531 (S); 550 (S); 609 (T); 652 (S); 669 (T); 734 (T); 741 (T); 815 (T); 876 (T); 880(S) etc. site is the major phosphorylation site, 290 (T); 312 (T); 334 (T); 531 (S); 550 (S); 652 (S); 669(T) is the major site of engineering we have selected, and preferably, 652(S) is modified by phosphorylation. We entrusted the gene synthesis company to construct PPDK phosphorylation site mutants, changed the 652 th serine (S) to alanine (A), performed suitable for Phaeodactylum tricornutum codon optimization, and confirmed the mutation base position by DNA sequencing.

A construction method of a CyPPDK transformant, and expression determination of growth and high value-added product yield of the CyPPDK transformant.

The construction method of the CyPPDK transformant comprises the following steps:

(1) codon optimization and phosphorylation site optimization of CyPPDK gene and construction of expression vector

The invention optimizes the preferential codons of the original CyPPDK gene of algae, the nucleotide sequence of the optimized CyPPDK gene is shown as SEQ ID NO.7, and the amino acid sequence is consistent with the original amino acid sequence and is shown as SEQ ID NO. 8.

Specific phosphorylation site prediction is carried out on CyPPDK protein by using NetPhos, and in an analysis result, serine at position 652 in a protein sequence is subjected to phosphorylation modification, and protein kinase can catalyze ATP to transfer phosphate groups of the ATP to serine sites. We entrusted the gene synthesis company to construct PPDK phosphorylation site mutants. Mutation of DNA base results in change of protein amino acid, the 652 th serine (S) in the mutant PPDK protein sequence is changed into alanine (A), and the mutant protein can be normally expressed in algae cells, and the amino acid sequence is shown as SEQ ID NO. 9.

The PPDK expression vector was constructed by inserting the PPDK gene obtained above downstream of the fcp-A promoter using pPha-T1 as a base expression vector. Taking the plasmid pPha-T1 as a template, and carrying out PCR amplification on a skeleton fragment required by the constructed vector by using a primer pPha-BB-F/R; the PPDK gene fragment is amplified by PCR by using the obtained PPDK gene as a template and using a primer CyPPDK-F/R, wherein the sequence of the primer is as follows, and the sequence is shown in a table 1:

TABLE 1

^*The italicized bold part of the sequence is indicated in the vectorIn the body construction process, overlapping (over-lap) fragments that need to be designed for seamless ligase are used.

And (3) PCR reaction system:

TABLE 2

And (3) PCR reaction conditions:

TABLE 3

Based on the overlap region between PPDK fragment and vector backbone fragment, using a seamless ligase kit (

Basic Seamless Cloning and Assembly Kit, beijing holothurian limited organism, CU201) and the constructed shuttle expression vector was named pha-fcp-PPDK, as shown in fig. 1.

Connecting a reaction system:

TABLE 4

^＊In a 10. mu.L reaction system, the amount of vector and DNA fragment added was 0.01 to 0.25pmol, and the molar ratio of vector to each fragment was 1: 2.

the connection reaction conditions are as follows: the reaction system is blown and beaten, mixed evenly and then placed at 50 ℃ for reaction for 15 minutes.

Electrotransformation of transformants

(1) Electric conversion

a. The expression vector pPha-fcp-PPDK constructed above is used as a template, primers Trans-F and Trans-R are used for PCR amplification to co-express PPDK gene and a linearized fragment of a resistance gene (figure 2), the linearized fragment is introduced into a host algal cell Phaeodactylum tricornutum (Phaeodactylum tricornutum) cell in an electrotransformation mode, a single-copy transformant strain is screened, and a Phaeodactylum tricornutum transgenic algal strain which overexpresses pyruvate phosphate dikinase is obtained, wherein the primer sequences are as follows, and are shown in Table 5:

TABLE 5

Trans-F	atttaggtgacactatagaaccaga
		Trans-R	gcttatcgaaattaatacgactcactataggga

And (3) PCR reaction system:

TABLE 6

And (3) PCR reaction conditions:

TABLE 7

b. Culturing algae cells in f/2 liquid culture medium to logarithmic growth phase, centrifuging, concentrating and collecting (3-5) x 10⁸And (4) cells.

c. Washing with 375mM sorbitol for 4-6 times, finally suspending with 100-200 mu L sorbitol, adding 3-5 mu g PPDK gene and linear fragment of resistance gene into the algae liquid, mixing uniformly, and placing on ice for reaction for 10-60 minutes.

d. Adding the algae liquid after reaction into an electric rotating cup, carrying out electric shock under the conditions of 500-1500V, 400-1000 omega and 25-100 muF, immediately transferring the algae liquid after electric shock into 10mL of fresh F/2 culture medium, and recovering for 24-48 hours in a dark place at room temperature;

e. centrifuging the recovered algae liquid for 1500g 5 minutes, discarding the supernatant, suspending the algae liquid in a proper amount of fresh culture medium, coating the algae liquid on a resistance plate containing 5-100 mu g/ml of bleomycin, culturing the algae liquid in an illumination incubator, and selecting transformants after 6-12 weeks.

(3) Screening of transformant

The transformants were picked up in a fresh f/2 liquid medium, placed in a light incubator and cultured for 9 days, and 8mL of algal solution was taken and treated with the Trans Direct Plant Tissue PCR Kit (AD 301, Beijing Quanjin biology Co., Ltd.) (the operation method is described in the specification) to verify the PPDK transformant. Using the primers CyPPDK-F: gtttcgaatgatgccgcgaaaagacaagtg and CyPPDK-R: cacgcttctgttagtgcgccttgccattac PCR amplification, agarose gel electrophoresis, and sequencing verification to obtain mutant strains: OP-CyPPDK, and obtaining UN-CyPPDK in the same way.

(4) Phenotypic assay culture

The transformants OP-CyPPDK and UN-CyPPDK were compared with the wild type strain at the same initial OD₇₅₀The cells were cultured at 22. + -. 1 ℃ for 10 days in f/2 medium under light conditions of 50. mu. mol of photons. multidot.m for the first 7 days^-2·s^-1The light intensity is 16h light and 8h dark, the rest 3 days are 24h light, and the light intensity is 100 mu mol photons.m^-2·s^-1(ii) a The used f/2 culture medium comprises the following components per liter:

1g NaNO₃30g of sea salt, 4.37mg of Na₂EDTA，300mg Na₂SiO₃·7H₂O，0.01mg CuSO₄·5H₂O，0.022mg ZnSO₄·7H₂O，0.01mg CoCl₂·6H₂O，0.18mg MnCl₂·4H₂O，0.006mg Na₂MoO₄·2H₂O。

Growth curves of the transformants and the wild-type algal strains were compared as shown in FIG. 3.

(5) Measurement of EPA

Reference is made to the method of Bigogno (see literature: BIGOGNO C, KHOZIN-GOLDBERG I, BOUSSIBA S, et ale green oleaginous alga Parietochloris incisa,the richest plant source of arachidonic acid[J]Phytochemistry,2002,60(5):497-503.) oil and fat were extracted, 20mL of Phaeodactylum tricornutum cells were collected by centrifugation at 4000g, and the supernatant was discarded. 6mL of chloroform-methanol (volume ratio: 4: 2) was added, and the mixture was shaken at 37 ℃ for 1 hour. Then adding 2mL of 0.9% KCl, shaking fully, and centrifuging for 5min at 5000g to separate lipid and algae residue. Blowing dried algae oil (i.e., the above-mentioned separated lipids) was added with 1.5mL of n-hexane and 4.5mL of 2% H₂SO₄(dissolved in methanol), carrying out methyl esterification reaction at 85 ℃ for 3h, cooling, adding 2mL of 0.9% KCl, fully shaking, standing for 3-5 min, and taking the upper organic phase in a centrifuge tube for gas chromatography analysis.

Analysis was carried out by Agilent 7890A gas chromatography on HP-5(30 m.times.320. mu.m.times.0.25 μm). Sample inlet temperature: 250 ℃; sample introduction volume: 1 mu L of the solution; setting a temperature rise program: maintaining at 120 deg.C for 5min, then increasing to 240 deg.C at 3.5 deg.C/min, and maintaining for 10 min; the results of the EPA-fatty acid composition ratio are shown in FIG. 4.

(6) Determination of fucoxanthin

The phaeodactylum tricornutum algae cells were collected by centrifugation at 4000g, washed once with distilled water, centrifuged again and the algae cells were collected. The pigment extraction was carried out by resuspending the algal cells in absolute ethanol (ethanol: volume of algal solution 1: 1; v/v), incubating at 45 ℃ for 2 hours, shaking every half hour, and finally, separating the extracted pigment from the algal residue by centrifugation at 10000 g.

The fucoxanthin content in the extracted pigment is determined by selecting reversed phase Agilent C18 chromatographic column (2.7 μm, 100 × 4.6mm) with Hitachi high performance liquid chromatograph detection system. The detection wavelength is 445nm, the flow rate of the mobile phase is 1mL/min, and the sample injection amount is as follows: 5 μ L. The mobile phase is acetonitrile and water for gradient elution. The proportion of acetonitrile is increased from 80% to 100% within 8min, after the elution is maintained for 3min, the proportion of acetonitrile is linearly decreased to 80% within 5min, and then the concentration of acetonitrile is increased to 100% and maintained for 15 min; the results of fucoxanthin content are shown in fig. 5.

Example 2

The culture conditions are different from the culture conditions in the step (4) in the example 1 in that a high-temperature time period of 4-6 h/d at 37 ℃ is set, and the growth conditions of OP-CyPPDK, UN-CyPPDK and wild type and the contents of EPA and fucoxanthin are measured under the condition that other culture conditions are the same, so that the growth conditions of the algae strains under the high-temperature condition are generally inferior to those of the algae strains cultured under the normal condition, and the contents of EPA and fucoxanthin are relatively lower, as shown in figures 6, 7 and 8.

Examples of effects

The measured data of OP-CyPPDK, UN-CyPPDK and wild type growth, EPA and fucoxanthin contents in example 1 and example 2 are shown in tables 8 and 9

Table 8 shows the respective indices of the culture conditions in example 1

Table 9 shows the respective indices of the culture conditions in example 2

The method comprises the steps of carrying out codon optimization on exogenous CyPPDK of marine microalgae, improving the expression level of the CyPPDK, predicting possible phosphorylation sites and carrying out site-directed mutagenesis to dephosphorize the phosphorylation sites, so that the activity of the PPDK is activated, expressing the PPDK in phaeodactylum tricornutum, and improving the growth rate and the accumulation amount of bioactive substances (EPA and fucoxanthin) under the high-temperature stress condition.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and the best mode for practicing the invention, and is not intended to limit the invention in any way, so that any simple modification, equivalent change or modification made to the above embodiments according to the technical spirit of the present invention will still fall within the scope of the technical solution of the present invention without departing from the content of the technical solution of the present invention.

SEQUENCE LISTING

<110> institute of bioenergy and Process in Qingdao, China academy of sciences

<120> a mutant strain expressing exogenous pyruvate phosphate dikinase in phaeodactylum tricornutum for producing fucoxanthin

Method

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 32

<212> DNA

<213> Artificial sequence

<400> 1

aaggcgcact aacagaagcg tgctatcgaa ct 32

<210> 2

<211> 32

<212> DNA

<213> Artificial sequence

<400> 2

ttttcgcggc atcattcgaa acggcagaca aa 32

<210> 3

<211> 30

<212> DNA

<213> Artificial sequence

<400> 3

gtttcgaatg atgccgcgaa aagacaagtg 30

<210> 4

<211> 30

<212> DNA

<213> Artificial sequence

<400> 4

cacgcttctg ttagtgcgcc ttgccattac 30

<210> 5

<211> 25

<212> DNA

<213> Artificial sequence

<400> 5

atttaggtga cactatagaa ccaga 25

<210> 6

<211> 33

<212> DNA

<213> Artificial sequence

<400> 6

gcttatcgaa attaatacga ctcactatag gga 33

<210> 7

<211> 2667

<212> DNA

<213> Artificial sequence

<400> 7

atgccccgta aggacaagtg cgtctacatg ttcgccgaag gacgtattga ccagaaggaa 60

ctcctcggaa acaagggagc caacctctgc gaaatgtccc gtctcggact ccccgtcccc 120

cccggattcg tcatcaccac caccacctgc ctcgactttt tcgaagccaa gggaaagatg 180

cccgcctccc tcaaggaaga atacattgtc gccctcgcca aggtcgaaaa gcagaccgga 240

aagaagttcg gagacaagac caaccccctc ctcctctccg tccgttccgg agccgccgtc 300

tccatgcccg gaatgatgga caccgtcctc aacctcggac tcaacgacga cattgccgcc 360

gccctcgtcg aagccaccgg aaacaagaag tgggtctacg actgctaccg tcgtctcatt 420

cagatgtacc agaacgtcgt cctcggaaag tccaccgacc cctacgaaca ggtcattaag 480

aaggtcaagg ccaccaaggg atacaagtac gatatggaac tctccggtga agactgggaa 540

tccgtcgtcg tcgaatttaa gattctctcc aagggatccc tcccctccga tccgcacgaa 600

cagctcgaaa ccgccattgc cgccgtcttt aactcctggt tcaccccccg tgccgtccgt 660

taccgtgaat acaacaacat tgaaggtctc ctcggtaccg cctgcaacgt ccagaccatg 720

gtcttcggaa acaagtccgc cgactccgga accggtgtcg ccttcacccg taaccccgcc 780

accggtgaaa acttgttctt tggtgaatac ctcgaagaag ccgaaggtga agacgtcgtc 840

tccggaatcc gcacccccca ccccctcacc tacctcaagg aaaccatgcc cgacgtctac 900

aacgaactcg acaagtccca gcgtctcctc gaaacccact tccgtgacat gcaagatctc 960

gaattctccg tcgaagaccg caccctctac atgctccaga cccgtaccgg aaagcgcacc 1020

gccaaggcct ccgtccagat tgcctgcgac atggtcgccg aaggaatgat taacgaacac 1080

gaagccctct tgcgtattga ccccgaacgt atgaactact tcctccaccc caccgtcgac 1140

accaacgccg aaaagaccgt cctcggaaag ggactccccg cctcccccgg agccgccacc 1200

ggaatggtcg tcttctgccc cgaagtcgcc gaagccaaga ttaaggccga ccccaaggtc 1260

caactcattc tcgtccgttc cgaaaccacc gccgacgaca ttcacggaat gcgtgccgcc 1320

accggtattc tcaccgaaaa cggaggaatg acctcccacg ccgccgtcgt cgcccgtgga 1380

atgggaaagt gttgcgtcgc cggagcccac aacctccacg tcgacgtcga acgtaagcaa 1440

ttcaccacca aggaaggaaa gattattaag gccggagata ttattaccct cgacggagcc 1500

accggactcg tcctcatggg agatgtcccc cgcgtccccc ccggttccga tgcctgcttc 1560

cagaccctca tgggatgggc ccgtaagtac tcccgtctcg ccgtcgccgc caacgccgat 1620

tcccccgaag acgcccgtgt cgccctctcc ttcggtgcca ccggtatcgg actctgccgt 1680

accgaacaca tgtttttccc ctccgaccgt attgacgtca tgcgtgaaat gattctcgcc 1740

gaaaccaagg aagatcgtga aaaggccctc gaccgtctct tcgtcttcca aaaggaagac 1800

atgaagggaa tgttcgaagt catgaccgga aagcacgtca ccattcgtct cctcgatccc 1860

cccctccacg aattcttgcc caccaacgtc tccgacaccg aagccctcgc cgcccgtatt 1920

ggaaagcagg tcgacgtcgt cgcccgcgaa atttccgacc tcaaggaagc caaccccatg 1980

ctcggatttc gtggttgccg cctcaccatt aagttccccg aaatcaccct catgcaggtc 2040

aaggccatta ttaccgccgc cctcgaagcc caggaaggag gagccgaagt ccaccccgaa 2100

attatgatcc cgctcattgc caccgccaag gaactcgaag ccatcgtccc cctcatggaa 2160

gccgaaattc agaaggtctt tgccgccaac ggaggaaaga ccgtccccta ccgtctcgga 2220

accatgattg aagtcccccg cgcctgcctc atcgccgaaa acattgcccc ctacgtctcc 2280

ttcatttcct tcggtaccaa cgacctcacc cagatggcct ggggattctc ccgtgatgac 2340

gtctcccact tcctccccca atacctcgaa aagaaggtcg tcaaggtcga ccccttcgtc 2400

accattgacg aagaaggagt cggtcagctc gtcaagatga ccaccgaaaa gatgaaggcc 2460

gtcaagcagg gtcagacctt taccgccgga atctgcggag aacacggagg agaccccccc 2520

tccgtctcct ttttttccaa cgtcggcctc gactacgtct cctgctcccc ctaccgtgtc 2580

cccattgcct ggattgccgc cgcccaggcc gccattaaga acggtacctc caagggatcc 2640

gtcaacggta acggtaaggc ccactaa 2667

<210> 8

<211> 888

<212> PRT

<213> Artificial sequence

<400> 8

Met Pro Arg Lys Asp Lys Cys Val Tyr Met Phe Ala Glu Gly Arg Ile

1 5 10 15

Asp Gln Lys Glu Leu Leu Gly Asn Lys Gly Ala Asn Leu Cys Glu Met

20 25 30

Ser Arg Leu Gly Leu Pro Val Pro Pro Gly Phe Val Ile Thr Thr Thr

35 40 45

Thr Cys Leu Asp Phe Phe Glu Ala Lys Gly Lys Met Pro Ala Ser Leu

50 55 60

Lys Glu Glu Tyr Ile Val Ala Leu Ala Lys Val Glu Lys Gln Thr Gly

65 70 75 80

Lys Lys Phe Gly Asp Lys Thr Asn Pro Leu Leu Leu Ser Val Arg Ser

85 90 95

Gly Ala Ala Val Ser Met Pro Gly Met Met Asp Thr Val Leu Asn Leu

100 105 110

Gly Leu Asn Asp Asp Ile Ala Ala Ala Leu Val Glu Ala Thr Gly Asn

115 120 125

Lys Lys Trp Val Tyr Asp Cys Tyr Arg Arg Leu Ile Gln Met Tyr Gln

130 135 140

Asn Val Val Leu Gly Lys Ser Thr Asp Pro Tyr Glu Gln Val Ile Lys

145 150 155 160

Lys Val Lys Ala Thr Lys Gly Tyr Lys Tyr Asp Met Glu Leu Ser Gly

165 170 175

Glu Asp Trp Glu Ser Val Val Val Glu Phe Lys Ile Leu Ser Lys Gly

180 185 190

Ser Leu Pro Ser Asp Pro His Glu Gln Leu Glu Thr Ala Ile Ala Ala

195 200 205

Val Phe Asn Ser Trp Phe Thr Pro Arg Ala Val Arg Tyr Arg Glu Tyr

210 215 220

Asn Asn Ile Glu Gly Leu Leu Gly Thr Ala Cys Asn Val Gln Thr Met

225 230 235 240

Val Phe Gly Asn Lys Ser Ala Asp Ser Gly Thr Gly Val Ala Phe Thr

245 250 255

Arg Asn Pro Ala Thr Gly Glu Asn Leu Phe Phe Gly Glu Tyr Leu Glu

260 265 270

Glu Ala Glu Gly Glu Asp Val Val Ser Gly Ile Arg Thr Pro His Pro

275 280 285

Leu Thr Tyr Leu Lys Glu Thr Met Pro Asp Val Tyr Asn Glu Leu Asp

290 295 300

Lys Ser Gln Arg Leu Leu Glu Thr His Phe Arg Asp Met Gln Asp Leu

305 310 315 320

Glu Phe Ser Val Glu Asp Arg Thr Leu Tyr Met Leu Gln Thr Arg Thr

325 330 335

Gly Lys Arg Thr Ala Lys Ala Ser Val Gln Ile Ala Cys Asp Met Val

340 345 350

Ala Glu Gly Met Ile Asn Glu His Glu Ala Leu Leu Arg Ile Asp Pro

355 360 365

Glu Arg Met Asn Tyr Phe Leu His Pro Thr Val Asp Thr Asn Ala Glu

370 375 380

Lys Thr Val Leu Gly Lys Gly Leu Pro Ala Ser Pro Gly Ala Ala Thr

385 390 395 400

Gly Met Val Val Phe Cys Pro Glu Val Ala Glu Ala Lys Ile Lys Ala

405 410 415

Asp Pro Lys Val Gln Leu Ile Leu Val Arg Ser Glu Thr Thr Ala Asp

420 425 430

Asp Ile His Gly Met Arg Ala Ala Thr Gly Ile Leu Thr Glu Asn Gly

435 440 445

Gly Met Thr Ser His Ala Ala Val Val Ala Arg Gly Met Gly Lys Cys

450 455 460

Cys Val Ala Gly Ala His Asn Leu His Val Asp Val Glu Arg Lys Gln

465 470 475 480

Phe Thr Thr Lys Glu Gly Lys Ile Ile Lys Ala Gly Asp Ile Ile Thr

485 490 495

Leu Asp Gly Ala Thr Gly Leu Val Leu Met Gly Asp Val Pro Arg Val

500 505 510

Pro Pro Gly Ser Asp Ala Cys Phe Gln Thr Leu Met Gly Trp Ala Arg

515 520 525

Lys Tyr Ser Arg Leu Ala Val Ala Ala Asn Ala Asp Ser Pro Glu Asp

530 535 540

Ala Arg Val Ala Leu Ser Phe Gly Ala Thr Gly Ile Gly Leu Cys Arg

545 550 555 560

Thr Glu His Met Phe Phe Pro Ser Asp Arg Ile Asp Val Met Arg Glu

565 570 575

Met Ile Leu Ala Glu Thr Lys Glu Asp Arg Glu Lys Ala Leu Asp Arg

580 585 590

Leu Phe Val Phe Gln Lys Glu Asp Met Lys Gly Met Phe Glu Val Met

595 600 605

Thr Gly Lys His Val Thr Ile Arg Leu Leu Asp Pro Pro Leu His Glu

610 615 620

Phe Leu Pro Thr Asn Val Ser Asp Thr Glu Ala Leu Ala Ala Arg Ile

625 630 635 640

Gly Lys Gln Val Asp Val Val Ala Arg Glu Ile Ser Asp Leu Lys Glu

645 650 655

Ala Asn Pro Met Leu Gly Phe Arg Gly Cys Arg Leu Thr Ile Lys Phe

660 665 670

Pro Glu Ile Thr Leu Met Gln Val Lys Ala Ile Ile Thr Ala Ala Leu

675 680 685

Glu Ala Gln Glu Gly Gly Ala Glu Val His Pro Glu Ile Met Ile Pro

690 695 700

Leu Ile Ala Thr Ala Lys Glu Leu Glu Ala Ile Val Pro Leu Met Glu

705 710 715 720

Ala Glu Ile Gln Lys Val Phe Ala Ala Asn Gly Gly Lys Thr Val Pro

725 730 735

Tyr Arg Leu Gly Thr Met Ile Glu Val Pro Arg Ala Cys Leu Ile Ala

740 745 750

Glu Asn Ile Ala Pro Tyr Val Ser Phe Ile Ser Phe Gly Thr Asn Asp

755 760 765

Leu Thr Gln Met Ala Trp Gly Phe Ser Arg Asp Asp Val Ser His Phe

770 775 780

Leu Pro Gln Tyr Leu Glu Lys Lys Val Val Lys Val Asp Pro Phe Val

785 790 795 800

Thr Ile Asp Glu Glu Gly Val Gly Gln Leu Val Lys Met Thr Thr Glu

805 810 815

Lys Met Lys Ala Val Lys Gln Gly Gln Thr Phe Thr Ala Gly Ile Cys

820 825 830

Gly Glu His Gly Gly Asp Pro Pro Ser Val Ser Phe Phe Ser Asn Val

835 840 845

Gly Leu Asp Tyr Val Ser Cys Ser Pro Tyr Arg Val Pro Ile Ala Trp

850 855 860

Ile Ala Ala Ala Gln Ala Ala Ile Lys Asn Gly Thr Ser Lys Gly Ser

865 870 875 880

Val Asn Gly Asn Gly Lys Ala His

885

<210> 9

<211> 888

<212> PRT

<213> Artificial sequence

<400> 9

Met Pro Arg Lys Asp Lys Cys Val Tyr Met Phe Ala Glu Gly Arg Ile

1 5 10 15

Asp Gln Lys Glu Leu Leu Gly Asn Lys Gly Ala Asn Leu Cys Glu Met

20 25 30

Ser Arg Leu Gly Leu Pro Val Pro Pro Gly Phe Val Ile Thr Thr Thr

35 40 45

Thr Cys Leu Asp Phe Phe Glu Ala Lys Gly Lys Met Pro Ala Ser Leu

50 55 60

Lys Glu Glu Tyr Ile Val Ala Leu Ala Lys Val Glu Lys Gln Thr Gly

65 70 75 80

Lys Lys Phe Gly Asp Lys Thr Asn Pro Leu Leu Leu Ser Val Arg Ser

85 90 95

Gly Ala Ala Val Ser Met Pro Gly Met Met Asp Thr Val Leu Asn Leu

100 105 110

Gly Leu Asn Asp Asp Ile Ala Ala Ala Leu Val Glu Ala Thr Gly Asn

115 120 125

Lys Lys Trp Val Tyr Asp Cys Tyr Arg Arg Leu Ile Gln Met Tyr Gln

130 135 140

Asn Val Val Leu Gly Lys Ser Thr Asp Pro Tyr Glu Gln Val Ile Lys

145 150 155 160

Lys Val Lys Ala Thr Lys Gly Tyr Lys Tyr Asp Met Glu Leu Ser Gly

165 170 175

Glu Asp Trp Glu Ser Val Val Val Glu Phe Lys Ile Leu Ser Lys Gly

180 185 190

Ser Leu Pro Ser Asp Pro His Glu Gln Leu Glu Thr Ala Ile Ala Ala

195 200 205

Val Phe Asn Ser Trp Phe Thr Pro Arg Ala Val Arg Tyr Arg Glu Tyr

210 215 220

Asn Asn Ile Glu Gly Leu Leu Gly Thr Ala Cys Asn Val Gln Thr Met

225 230 235 240

Val Phe Gly Asn Lys Ser Ala Asp Ser Gly Thr Gly Val Ala Phe Thr

245 250 255

Arg Asn Pro Ala Thr Gly Glu Asn Leu Phe Phe Gly Glu Tyr Leu Glu

260 265 270

Glu Ala Glu Gly Glu Asp Val Val Ser Gly Ile Arg Thr Pro His Pro

275 280 285

Leu Thr Tyr Leu Lys Glu Thr Met Pro Asp Val Tyr Asn Glu Leu Asp

290 295 300

Lys Ser Gln Arg Leu Leu Glu Thr His Phe Arg Asp Met Gln Asp Leu

305 310 315 320

Glu Phe Ser Val Glu Asp Arg Thr Leu Tyr Met Leu Gln Thr Arg Thr

325 330 335

Gly Lys Arg Thr Ala Lys Ala Ser Val Gln Ile Ala Cys Asp Met Val

340 345 350

Ala Glu Gly Met Ile Asn Glu His Glu Ala Leu Leu Arg Ile Asp Pro

355 360 365

Glu Arg Met Asn Tyr Phe Leu His Pro Thr Val Asp Thr Asn Ala Glu

370 375 380

Lys Thr Val Leu Gly Lys Gly Leu Pro Ala Ser Pro Gly Ala Ala Thr

385 390 395 400

Gly Met Val Val Phe Cys Pro Glu Val Ala Glu Ala Lys Ile Lys Ala

405 410 415

Asp Pro Lys Val Gln Leu Ile Leu Val Arg Ser Glu Thr Thr Ala Asp

420 425 430

Asp Ile His Gly Met Arg Ala Ala Thr Gly Ile Leu Thr Glu Asn Gly

435 440 445

Gly Met Thr Ser His Ala Ala Val Val Ala Arg Gly Met Gly Lys Cys

450 455 460

Cys Val Ala Gly Ala His Asn Leu His Val Asp Val Glu Arg Lys Gln

465 470 475 480

Phe Thr Thr Lys Glu Gly Lys Ile Ile Lys Ala Gly Asp Ile Ile Thr

485 490 495

Leu Asp Gly Ala Thr Gly Leu Val Leu Met Gly Asp Val Pro Arg Val

500 505 510

Pro Pro Gly Ser Asp Ala Cys Phe Gln Thr Leu Met Gly Trp Ala Arg

515 520 525

Lys Tyr Ser Arg Leu Ala Val Ala Ala Asn Ala Asp Ser Pro Glu Asp

530 535 540

Ala Arg Val Ala Leu Ser Phe Gly Ala Thr Gly Ile Gly Leu Cys Arg

545 550 555 560

Thr Glu His Met Phe Phe Pro Ser Asp Arg Ile Asp Val Met Arg Glu

565 570 575

Met Ile Leu Ala Glu Thr Lys Glu Asp Arg Glu Lys Ala Leu Asp Arg

580 585 590

Leu Phe Val Phe Gln Lys Glu Asp Met Lys Gly Met Phe Glu Val Met

595 600 605

Thr Gly Lys His Val Thr Ile Arg Leu Leu Asp Pro Pro Leu His Glu

610 615 620

Phe Leu Pro Thr Asn Val Ser Asp Thr Glu Ala Leu Ala Ala Arg Ile

625 630 635 640

Gly Lys Gln Val Asp Val Val Ala Arg Glu Ile Ala Asp Leu Lys Glu

645 650 655

Ala Asn Pro Met Leu Gly Phe Arg Gly Cys Arg Leu Thr Ile Lys Phe

660 665 670

Pro Glu Ile Thr Leu Met Gln Val Lys Ala Ile Ile Thr Ala Ala Leu

675 680 685

Glu Ala Gln Glu Gly Gly Ala Glu Val His Pro Glu Ile Met Ile Pro

690 695 700

Leu Ile Ala Thr Ala Lys Glu Leu Glu Ala Ile Val Pro Leu Met Glu

705 710 715 720

Ala Glu Ile Gln Lys Val Phe Ala Ala Asn Gly Gly Lys Thr Val Pro

725 730 735

Tyr Arg Leu Gly Thr Met Ile Glu Val Pro Arg Ala Cys Leu Ile Ala

740 745 750

Glu Asn Ile Ala Pro Tyr Val Ser Phe Ile Ser Phe Gly Thr Asn Asp

755 760 765

Leu Thr Gln Met Ala Trp Gly Phe Ser Arg Asp Asp Val Ser His Phe

770 775 780

Leu Pro Gln Tyr Leu Glu Lys Lys Val Val Lys Val Asp Pro Phe Val

785 790 795 800

Thr Ile Asp Glu Glu Gly Val Gly Gln Leu Val Lys Met Thr Thr Glu

805 810 815

Lys Met Lys Ala Val Lys Gln Gly Gln Thr Phe Thr Ala Gly Ile Cys

820 825 830

Gly Glu His Gly Gly Asp Pro Pro Ser Val Ser Phe Phe Ser Asn Val

835 840 845

Gly Leu Asp Tyr Val Ser Cys Ser Pro Tyr Arg Val Pro Ile Ala Trp

850 855 860

Ile Ala Ala Ala Gln Ala Ala Ile Lys Asn Gly Thr Ser Lys Gly Ser

865 870 875 880

Val Asn Gly Asn Gly Lys Ala His

885

<210> 10

<211> 2667

<212> DNA

<213> Artificial sequence

<400> 10

atgccgcgaa aagacaagtg cgtctacatg tttgccgagg gacgaatcga ccagaaggag 60

ttgctgggca ataagggcgc taatctctgt gaaatgtcgc gccttggcct tcctgtcccc 120

cccggttttg tcattaccac aaccacctgc ctcgatttct tcgaggccaa ggggaagatg 180

ccggcctctc tcaaggagga gtatatcgtc gccttggcca aggtggagaa gcagaccggc 240

aaaaaattcg gggacaagac caaccccttg cttctctccg tgcgttcagg tgcagccgtc 300

tccatgcctg gcatgatgga cacggtgctt aatctcggcc tcaatgacga cattgccgcg 360

gcgttggtag aggcaacagg caataaaaag tgggtctatg actgttaccg ccgattgatc 420

caaatgtatc aaaatgtggt gttgggcaag agcacggacc catacgaaca ggtgattaag 480

aaggtaaagg ccacaaaagg ttacaagtac gacatggagc tgagcgggga ggattgggaa 540

tcggtggtgg tggagtttaa aatactgagc aaaggaagct tgccctctga tccgcatgag 600

cagcttgaga cggccattgc ggcggttttc aattcgtggt ttacgccgcg ggcagtgcgg 660

taccgtgaat acaacaacat tgagggcctc ttggggactg cgtgcaatgt ccaaacaatg 720

gtgtttggga acaagtcggc cgattcaggc acgggggtgg ctttcacgcg caaccctgct 780

actggtgaga atttattttt tggggaatat ttggaggagg ctgagggaga ggatgtggtc 840

tcgggcatac gaaccccaca ccctttgaca tatttgaagg agaccatgcc cgatgtgtac 900

aatgagctgg ataaaagcca acggctgctg gagacgcatt tccgagacat gcaagatttg 960

gagttcagtg tcgaggaccg gacactgtac atgctccaga cccgtaccgg gaagcgcacg 1020

gctaaggcca gcgtgcagat tgcatgtgac atggtggcgg aagggatgat caacgagcat 1080

gaggccctcc tccgtatcga tcctgaacgt atgaactact tcctgcatcc cacggtggac 1140

acgaatgcgg agaagactgt cttgggaaag gggctgccgg cctcgcctgg cgccgcgaca 1200

ggaatggtag tattttgtcc tgaggtggcc gaggctaaga tcaaggcaga tcccaaagtg 1260

caacttatct tggtgcgcag tgaaacgacg gctgatgaca ttcacgggat gagggcggcg 1320

acggggattc tgaccgaaaa tggtggcatg acgagtcatg ctgctgttgt ggcccgcggg 1380

atgggaaagt gctgtgtggc tggcgcccac aatctgcacg tggacgttga gaggaagcag 1440

tttacgacga aggagggaaa aatcatcaag gccggcgata tcatcacgtt ggacggtgcc 1500

acgggcttgg tactcatggg tgatgtgcct cgcgtgcctc ctggctcgga tgcatgcttc 1560

cagacgctca tggggtgggc ccggaagtac agtcggttgg cagtggcggc gaacgcggac 1620

agtcccgagg acgcgcgtgt cgcgctttcc tttggcgcca ccggcattgg cctctgccgc 1680

acggagcaca tgtttttccc ttctgatcgc attgacgtga tgcgggagat gatattggcg 1740

gagacgaagg aagaccggga gaaggcatta gaccgcctct ttgtcttcca gaaggaggac 1800

atgaagggca tgtttgaagt aatgacgggt aagcacgtga caatccgtct attggatccg 1860

ccccttcacg aattcctccc cacgaatgtc agcgacacgg aggccctagc cgctcgcatt 1920

ggcaaacagg tggacgtagt ggcccgggaa atttctgatt tgaaggaggc gaatcccatg 1980

ctcggttttc gaggctgtcg tttgaccatt aaattcccgg agattacctt gatgcaggtc 2040

aaggccatta tcaccgccgc tctcgaagcg caggaaggcg gggcggaggt tcaccctgag 2100

attatgattc cactaattgc gacggccaag gagctggagg cgatcgttcc tttgatggaa 2160

gcggagattc agaaggtttt tgctgccaat ggcggaaaga ctgtgccata tcgtttgggg 2220

accatgattg aggtgccccg agcctgttta attgccgaaa acattgcgcc ttacgtctct 2280

ttcatctcgt ttggcaccaa cgacttgacg cagatggctt ggggattttc ccgcgatgac 2340

gtcagccact ttttgcccca gtacctggag aagaaggtcg tcaaggtcga cccctttgtc 2400

actatcgatg aagaaggtgt ggggcagcta gttaagatga ccacggagaa gatgaaggcc 2460

gtgaagcagg gccagacttt cactgccggc atttgcggtg aacacggcgg tgatccgccg 2520

agtgtctcgt tcttttctaa cgtgggcctc gattatgtct cgtgctctcc ttaccgtgtg 2580

cccattgctt ggatagcggc agctcaagcg gccatcaaga atggtacgag taagggaagc 2640

gtcaacggta atggcaaggc gcactaa 2667

Claims

1. A method for constructing an overexpressed pyruvate phosphate dikinase mutant strain in phaeodactylum tricornutum is characterized by comprising the following steps of:

(1) to the originalCyPPDKThe gene is optimized by preferential codon of alga to obtain new oneCyPPDKThe gene has a nucleotide sequence shown as SEQ ID NO. 7;

(2) construction of overexpression vector of CyPPDK gene

Based on the plasmid pPha-T1, the expression vectorfcp-AAs a promoter, infcp-ADownstream of the promoter inserted into the above-obtainedPPDKGene, constructing PPDK expression vector, taking plasmid pPha-T1 as a template, utilizing primer pPha-BB-F/R, primer nucleotide sequence is shown as SEQ ID NO.1 and SEQ ID NO.2, PCR amplifying the skeleton segment required by constructing the vector; obtained by using a primer CyPPDK-F/R, the nucleotide sequence of which is shown as SEQ ID NO.3 and SEQ ID NO.4PPDKPCR amplification using the Gene as templatePPDKA gene fragment; based on the overlapping region between the PPDK fragment and the vector skeleton fragment, using a seamless ligase kit to perform fragment ligation, and designating the constructed shuttle expression vector as pPha-fcp-PPDK;

(3) preparation of transformant

Taking the expression vector pPha-fcp-PPDK constructed in the step (2) as a template, utilizing primer Trans-F/R, and primer nucleotide sequences are shown as SEQ ID NO.5 and SEQ ID NO.6, and carrying out PCR amplificationPPDKThe linearized segment of the gene and the resistance gene is introduced into the host algal cell phaeodactylum tricornutum by means of electrotransformation (Phaeodactylum tricornutum) And (4) screening the transformant in the cell to obtain a phaeodactylum tricornutum transgenic algae strain over-expressing pyruvate phosphate dikinase.

2. The method of claim 1, wherein the PCR reaction system in step (2) is as follows:

DNA template 0.5. mu.L, upstream primer 10. mu.M 1. mu.L, downstream primer 10. mu.M 1. mu.L, KAPA HiFi DNA polymerase 12.5. mu.L, ddH₂O 10 μL。

3. The method of claim 2, wherein the PCR reaction conditions in step (2) are as follows:

4. The method of claim 1, wherein the PCR reaction system in step (3) is as follows:

DNA template 0.5. mu.L, upstream primer 10. mu.M 1. mu.L, downstream primer 10. mu.M 1. mu.L, KAPA HiFi DNA polymerase 25. mu.L, ddH₂O 22.5 μL。

5. The method of claim 4, wherein the PCR reaction conditions in step (3) are as follows:

6. The method of claim 1, wherein in step (3), the host algal cells are cultured in f/2 liquid medium to logarithmic growth phase, and collected by centrifugation and concentration (3-5) x 10⁸(ii) individual cells; washing the algae for 4-6 times by using 375mM sorbitol, and adding 3-5 mug into the algae liquidPPDKUniformly mixing linear fragments of the gene and the resistance gene, and placing the mixture on ice to react for 10-60 minutes; adding the algae liquid after reaction into an electric rotating cup, and carrying out electric shock under the conditions of 500-1500V, 400-1000 omega and 25-100 mu F; immediately transferring the electrically shocked algae liquid to 10mL of fresh f/2 culture medium, and recovering for 24-48 hours at room temperature in a dark place; centrifuging the recovered algae liquid for 1500g and 5 minutes, discarding the supernatant, resuspending the algae liquid in a proper amount of fresh culture medium, coating the algae liquid on a f/2 resistant plate containing 5-100 mug/ml bleomycin resistance, culturing the algae liquid in an illumination incubator, and selecting transformants after 6-12 weeks.

7. The method of claim 6, wherein the positive clone is verified by PCR product sequencing by performing Direct PCR amplification operation on algal cells after genome extraction of the transformant using the Trans Direct Plant Tissue PCR Kit.

8. The method for culturing the phaeodactylum tricornutum transgenic algae strain obtained in any one of claims 1 to 7, which is characterized by comprising the following steps:

culturing the transgenic strain at 22 + -1 deg.C for 10 days under the condition of illumination of 50 μmol phosns m for the first 7 days⁻²·s⁻¹The light intensity is 16h light, 8h dark, and the rest 3 days are 24h light.

9. The culture method according to claim 8, wherein the transgenic algal strain is cultured in f/2 medium.

10. Use of the transgenic strain of Phaeodactylum tricornutum obtained according to any one of claims 1 to 7 for the production of fucoxanthin and/or EPA (Eicosapentaenoic acid).

11. The application of the coding gene for expressing pyruvate phosphate dikinase in improving the yield of fucoxanthin and/or EPA (Eicosapentaenoic acid) in phaeodactylum tricornutum is disclosed, wherein the nucleotide sequence of the coding gene for expressing pyruvate phosphate dikinase is shown as SEQ ID NO. 10.

12. The use according to claim 11, wherein the pyruvate phosphate dikinase has the amino acid sequence shown in SEQ ID No. 8.